Clone Name | rbasd2j21 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|BT009573.1| Triticum aestivum clone wre1n.pk0027.d4:fis, full... | 64 | 3e-08 | 2 | dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... | 36 | 6.6 |
---|
>gb|BT009573.1| Triticum aestivum clone wre1n.pk0027.d4:fis, full insert mRNA sequence Length = 1042 Score = 63.9 bits (32), Expect = 3e-08 Identities = 45/50 (90%) Strand = Plus / Minus Query: 1 ttttctgacgntgctggcatagactgtaggancctgcttttgttgctcag 50 |||||||||| || ||||||||||| ||||| ||||||||| |||||||| Sbjct: 676 ttttctgacgttgttggcatagactctaggatcctgcttttcttgctcag 627
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 36.2 bits (18), Expect = 6.6 Identities = 18/18 (100%) Strand = Plus / Plus Query: 14 ctggcatagactgtagga 31 |||||||||||||||||| Sbjct: 805694 ctggcatagactgtagga 805711 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 231,713 Number of Sequences: 3902068 Number of extensions: 231713 Number of successful extensions: 57992 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57989 Number of HSP's gapped (non-prelim): 3 length of query: 50 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 30 effective length of database: 17,155,003,908 effective search space: 514650117240 effective search space used: 514650117240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)