>gb|BT009262.1| Triticum aestivum clone wlk4.pk0022.b7:fis, full insert mRNA sequence
          Length = 2997

 Score =  168 bits (85), Expect = 6e-39
 Identities = 100/105 (95%)
 Strand = Plus / Minus

                                                                        
Query: 93   tagtcactaccgcgtttctcaaccatgcacaccactgcgcttattaactgtcccacaact 152
            |||||||||||| | ||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 2712 tagtcactaccgtggttctcaaccatgcacaccactgcgcttattaacagtcccgcaact 2653

                                                         
Query: 153  ataacaacctgctattttctgaaacacaagttctgaatcaccaaa 197
            |||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 2652 ataacagcctgctattttctgaaacacaagttctgaatcaccaaa 2608



 Score =  111 bits (56), Expect = 1e-21
 Identities = 59/60 (98%)
 Strand = Plus / Minus

                                                                        
Query: 241  atctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccgg 300
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 2571 atctatgtggtgaggatggggggaaggtagtccgacttggcgccgaggatgcgggcccgg 2512



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 11   aacagtaatacaaacatcagaaaccgtgtaaagtatc 47
            |||||| ||||||||| ||||||||||||||||||||
Sbjct: 2760 aacagtgatacaaacagcagaaaccgtgtaaagtatc 2724

>dbj|AK061865.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-H06, full
           insert sequence
          Length = 1084

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 242 tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
           |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 769 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 712

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                         
Query: 242     tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
               |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 3723982 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 3724039

>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0583G08
          Length = 135295

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                        
Query: 242    tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
              |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 132462 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 132519

>dbj|AK119523.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-E03, full
            insert sequence
          Length = 2831

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 242  tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
            |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 2559 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 2502

>dbj|AK065102.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001N03, full
            insert sequence
          Length = 2851

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 242  tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
            |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 2553 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 2496

>gb|AY105267.1| Zea mays PCO139922 mRNA sequence
          Length = 541

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 243 ctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggc 296
           |||||||||||||||||| || ||||| ||||||||| ||||||||| ||||||
Sbjct: 353 ctatgtggtgaggatgggcgggaggtaatccgacttgttgccgaggacgcgggc 406

>dbj|AB001920.1| Oryza sativa (japonica cultivar-group) gene for phospholipase D,
            complete cds
          Length = 5871

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 242  tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
            |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 5333 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 5276

>dbj|D73411.1|RICPHD2 Oryza sativa (japonica cultivar-group) mRNA for phospholipase D,
            complete cds
          Length = 2990

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 242  tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggcccg 299
            |||||| ||||||||||||||| | ||| |||||||||| |||||||| |||||||||
Sbjct: 2621 tctatgaggtgaggatggggggcatgtaatccgacttggcgccgaggacgcgggcccg 2564

>gb|AY109642.1| Zea mays CL1830_1 mRNA sequence
          Length = 2876

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 242  tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggc 296
            ||||||||||||||||||| || ||||| ||||||||| | ||||||| ||||||
Sbjct: 2546 tctatgtggtgaggatgggcgggaggtaatccgacttgttcccgaggacgcgggc 2492

>dbj|D73410.1|MZEPHD1 Zea mays mRNA for phospholipase D, complete cds
          Length = 2793

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 242  tctatgtggtgaggatggggggaaggtagtccgacttggtgccgaggatgcgggc 296
            ||||||||||||||||||| || ||||| ||||||||| | ||||||| ||||||
Sbjct: 2546 tctatgtggtgaggatgggcgggaggtaatccgacttgttcccgaggacgcgggc 2492

>gb|AC009229.5| Homo sapiens BAC clone RP11-314C9 from 2, complete sequence
          Length = 209156

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 244   tatgtggtgaggatggggggaag 266
             |||||||||||||||||||||||
Sbjct: 92801 tatgtggtgaggatggggggaag 92779

>gb|AC006663.1| Caenorhabditis elegans fosmid H24K24, complete sequence
          Length = 32209

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 14    agtaatacaaacatcagaaacc 35
             ||||||||||||||||||||||
Sbjct: 22145 agtaatacaaacatcagaaacc 22166

>ref|NM_070954.2| Caenorhabditis elegans H24K24.2 (H24K24.2) mRNA, complete cds
          Length = 1473

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 14  agtaatacaaacatcagaaacc 35
           ||||||||||||||||||||||
Sbjct: 469 agtaatacaaacatcagaaacc 490

>ref|NM_112443.1| Arabidopsis thaliana PLDALPHA1 (PHOSPHOLIPASE D ALPHA 1);
            phospholipase D AT3G15730 (PLDALPHA1) mRNA, complete cds
          Length = 2795

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 265  aggtagtccgacttggtgccgaggatgcgggcc 297
            |||||||| || |||||||||||||| ||||||
Sbjct: 2502 aggtagtctgatttggtgccgaggatacgggcc 2470

>gb|BT014735.1| Arabidopsis thaliana At3g15730.1 mRNA sequence
          Length = 718

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 265 aggtagtccgacttggtgccgaggatgcgggcc 297
           |||||||| || |||||||||||||| ||||||
Sbjct: 696 aggtagtctgatttggtgccgaggatacgggcc 664

>gb|AF428278.1|AF428278 Arabidopsis thaliana AT3g15730/MSJ11_13 mRNA, complete cds
          Length = 1886

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 265  aggtagtccgacttggtgccgaggatgcgggcc 297
            |||||||| || |||||||||||||| ||||||
Sbjct: 1597 aggtagtctgatttggtgccgaggatacgggcc 1565

>gb|BT003026.1| Arabidopsis thaliana At3g15730/MSJ11_13 gene, complete cds
          Length = 1572

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 265  aggtagtccgacttggtgccgaggatgcgggcc 297
            |||||||| || |||||||||||||| ||||||
Sbjct: 1550 aggtagtctgatttggtgccgaggatacgggcc 1518

>dbj|AB017071.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11
          Length = 81370

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 265   aggtagtccgacttggtgccgaggatgcgggcc 297
             |||||||| || |||||||||||||| ||||||
Sbjct: 42804 aggtagtctgatttggtgccgaggatacgggcc 42772

>gb|BC032099.2| Homo sapiens pygopus homolog 2 (Drosophila), mRNA (cDNA clone
           MGC:20502 IMAGE:4126360), complete cds
          Length = 3190

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 936 gtggtgaggatggggggaag 955

>gb|BC013725.1| Homo sapiens pygopus homolog 2 (Drosophila), mRNA (cDNA clone
           IMAGE:3859726), partial cds
          Length = 2508

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 246 gtggtgaggatggggggaag 265

>ref|XM_525221.1| PREDICTED: Pan troglodytes similar to Pygopus homolog 2
           (LOC469836), mRNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 626 gtggtgaggatggggggaag 645

>ref|XM_593770.2| PREDICTED: Bos taurus similar to Pygopus homolog 2 (LOC540401), mRNA
          Length = 1773

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 247  gtggtgaggatggggggaag 266
            ||||||||||||||||||||
Sbjct: 1106 gtggtgaggatggggggaag 1125

>ref|NM_138300.3| Homo sapiens pygopus homolog 2 (Drosophila) (PYGO2), mRNA
          Length = 3227

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 970 gtggtgaggatggggggaag 989

>gb|AC132454.3| Mus musculus BAC clone RP23-127P22 from chromosome 19, complete sequence
          Length = 225152

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 168    tttctgaaacacaagttctg 187
              ||||||||||||||||||||
Sbjct: 136964 tttctgaaacacaagttctg 136945

>emb|AL451085.20| Human DNA sequence from clone RP11-307C12 on chromosome 1 Contains the
             PMVK gene for phosphomevalonate kinase, the PBXIP1 gene
             for pre-B-cell leukemia transcription factor interacting
             protein 1, the gene for pygopus 2 (PYGO2), the  SHC1 gene
             for SHC (Src homology 2 domain containing) transforming
             protein 1, the CKS1B gene for CDC28 protein kinase
             regulatory subunit 1B, the gene for FAD-synthetase
             (PP591), the LENEP gene for lens epithelial protein, the
             ZFP67 gene for zinc finger protein 67 homolog (mouse), the
             gene for a novel protein (FLJ32934), a novel gene, the
             gene for a novel protein (FLJ32785) the 5' end of the
             ADAM15 gene for a disintegrin and metalloproteinase domain
             15 (metargidin), and two CpG islands, complete sequence
          Length = 182166

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   gtggtgaggatggggggaag 266
             ||||||||||||||||||||
Sbjct: 87674 gtggtgaggatggggggaag 87655

>emb|CR860452.1| Pongo pygmaeus mRNA; cDNA DKFZp459G041 (from clone DKFZp459G041)
          Length = 3222

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 247  gtggtgaggatggggggaag 266
            ||||||||||||||||||||
Sbjct: 993  gtggtgaggatggggggaag 1012

>emb|CR624320.1| full-length cDNA clone CS0DL007YH03 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 2734

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 540 gtggtgaggatggggggaag 559

>dbj|AK095899.1| Homo sapiens cDNA FLJ38580 fis, clone HCHON2008582, highly similar
           to FERRITIN HEAVY CHAIN
          Length = 2034

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 810 gtggtgaggatggggggaag 829

>dbj|AK092389.1| Homo sapiens cDNA FLJ35070 fis, clone PLACE5000139
          Length = 3128

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 919 gtggtgaggatggggggaag 938

>dbj|AK090545.1| Homo sapiens cDNA FLJ33226 fis, clone ASTRO2001029
          Length = 2497

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 288 gtggtgaggatggggggaag 307

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 39      taaagtatccaagtctcatattac 62
               |||| |||||||||||||||||||
Sbjct: 2285010 taaactatccaagtctcatattac 2284987

>gb|AF457208.1| Homo sapiens pygopus 2 (PYGO2) mRNA, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 764 gtggtgaggatggggggaag 783

>gb|AF289598.1|AF289598 Homo sapiens clone pp7910 unknown mRNA
          Length = 2977

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 720 gtggtgaggatggggggaag 739

>gb|BC006132.1| Homo sapiens pygopus homolog 2 (Drosophila), mRNA (cDNA clone
           MGC:13050 IMAGE:3627860), complete cds
          Length = 3193

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 247 gtggtgaggatggggggaag 266
           ||||||||||||||||||||
Sbjct: 936 gtggtgaggatggggggaag 955

>emb|BX908754.8| Zebrafish DNA sequence from clone DKEY-196D8 in linkage group 18,
             complete sequence
          Length = 94961

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 151   ctataacaacctgctattttctga 174
             |||||||| |||||||||||||||
Sbjct: 39144 ctataacaccctgctattttctga 39167

>gb|AY294150.1| Platyamoeba placida small subunit ribosomal RNA gene, partial
           sequence
          Length = 1893

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 186 tgaatcaccaaaggaaccac 205
           ||||||||||||||||||||
Sbjct: 238 tgaatcaccaaaggaaccac 219


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,262,209
Number of Sequences: 3902068
Number of extensions: 2262209
Number of successful extensions: 51666
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51605
Number of HSP's gapped (non-prelim): 61
length of query: 300
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 278
effective length of database: 17,147,199,772
effective search space: 4766921536616
effective search space used: 4766921536616
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)