Clone Name | rbasd2j15 |
---|---|
Clone Library Name | barley_pub |
>gb|AY781348.1| Triticum aestivum USP family protein mRNA, complete cds Length = 902 Score = 620 bits (313), Expect = e-174 Identities = 484/538 (89%), Gaps = 16/538 (2%) Strand = Plus / Minus Query: 43 atgcagcaaacagcagcacggactgactcacggtgcaaaagttaggctgaagagaagcac 102 ||||| |||||||||||||||||||||||| || ||||||| ||||||||||| |||||| Sbjct: 831 atgcaacaaacagcagcacggactgactcatggagcaaaagctaggctgaagataagcac 772 Query: 103 acaa---------acgtacacgacacatgcacagattacaca-acctgggaatcatccgc 152 |||| | ||||| ||||||||||||||||||||| ||||||||||||||| | Sbjct: 771 acaaatgtacaggatgtacaggacacatgcacagattacacacacctgggaatcatccac 712 Query: 153 gggctaattgtcaatcattattacaaacaacaacactgcatggttcaataagttgcagcc 212 |||||||||||||| ||||||||||| |||| ||| ||||||||||||||||| ||| Sbjct: 711 aggctaattgtcaattattattacaaataaca---ctggatggttcaataagttgcggcc 655 Query: 213 atgactggatatataggactcaa-caaactaaaccagatgaggatattttcgatgacgag 271 | |||||||||||||||||| ||||||||| || ||| ||| |||| |||||| ||| Sbjct: 654 a--actggatatataggactctggcaaactaaaacacatgtggacatttgcgatgatgag 597 Query: 272 atcaggcatgggtgctcgctggcttgacaacggtgaccgggcacgcggcgttgttcacga 331 ||||||||||| | ||||||||||||||||||||||| ||||| ||||| |||||||||| Sbjct: 596 atcaggcatggttactcgctggcttgacaacggtgacagggcaggcggcattgttcacga 537 Query: 332 cgtaatcgctgacactgcccaagagcaccctcttgagcttgccaaggcccctgctcccaa 391 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 536 cgtaatcgctgacgctgcccaagagcaccctcttgagcttgccaaggcccctgctcccaa 477 Query: 392 tgaccaggcagctgatgggcatgtcatggatggcttggcatagcttctcgcggggatctc 451 |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct: 476 tgaccagggagctgatgggcatgtcatggatggcttggcacagcttctcgcggggatctc 417 Query: 452 caaacaggactttggaaaccacggcaacctccttctgcttagctatggtgttgagcatgt 511 ||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||| Sbjct: 416 caaacaggacttttgaaaccacggagacctccttctgcttagctatagtgttgagcatgt 357 Query: 512 ccagtgtttcagcatcaggcttcaccccatatttctttgcgaccgaagggtgagagaa 569 |||| ||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 356 ccagcgtttcagcatcaggcttcaccccatatttctttgcagttgaagggtgagagaa 299
>ref|XM_475607.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 504 Score = 212 bits (107), Expect = 9e-52 Identities = 224/263 (85%) Strand = Plus / Minus Query: 289 gctggcttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactg 348 |||| ||||||||| ||||| ||||| | |||||||||||||||||| |||||||| || Sbjct: 494 gctgtcttgacaactgtgactgggcaagtggcgttgttcacgacgtagtcgctgacgcta 435 Query: 349 cccaagagcaccctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatg 408 || || |||||||||||||| |||||||| |||||||| ||||| |||| |||||| ||| Sbjct: 434 cctaacagcaccctcttgagtttgccaagacccctgcttccaataaccaagcagctcatg 375 Query: 409 ggcatgtcatggatggcttggcatagcttctcgcggggatctccaaacaggactttggaa 468 || || || | ||||||||||||||||||||| ||||||||||| | ||||||||| || Sbjct: 374 gggatttcgttgatggcttggcatagcttctcacggggatctccccaaaggactttgaaa 315 Query: 469 accacggcaacctccttctgcttagctatggtgttgagcatgtccagtgtttcagcatca 528 ||||| |||||||||||||| | || | || || |||||||||| |||||| |||||| Sbjct: 314 accaccacaacctccttctgcctggccacagtattaagcatgtccaatgtttcggcatca 255 Query: 529 ggcttcaccccatatttctttgc 551 ||||| | |||||||||||||| Sbjct: 254 ggctttgctccatatttctttgc 232
>dbj|AK065771.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013041K03, full insert sequence Length = 777 Score = 212 bits (107), Expect = 9e-52 Identities = 224/263 (85%) Strand = Plus / Minus Query: 289 gctggcttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactg 348 |||| ||||||||| ||||| ||||| | |||||||||||||||||| |||||||| || Sbjct: 582 gctgtcttgacaactgtgactgggcaagtggcgttgttcacgacgtagtcgctgacgcta 523 Query: 349 cccaagagcaccctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatg 408 || || |||||||||||||| |||||||| |||||||| ||||| |||| |||||| ||| Sbjct: 522 cctaacagcaccctcttgagtttgccaagacccctgcttccaataaccaagcagctcatg 463 Query: 409 ggcatgtcatggatggcttggcatagcttctcgcggggatctccaaacaggactttggaa 468 || || || | ||||||||||||||||||||| ||||||||||| | ||||||||| || Sbjct: 462 gggatttcgttgatggcttggcatagcttctcacggggatctccccaaaggactttgaaa 403 Query: 469 accacggcaacctccttctgcttagctatggtgttgagcatgtccagtgtttcagcatca 528 ||||| |||||||||||||| | || | || || |||||||||| |||||| |||||| Sbjct: 402 accaccacaacctccttctgcctggccacagtattaagcatgtccaatgtttcggcatca 343 Query: 529 ggcttcaccccatatttctttgc 551 ||||| | |||||||||||||| Sbjct: 342 ggctttgctccatatttctttgc 320
>dbj|AK103075.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033118C16, full insert sequence Length = 780 Score = 204 bits (103), Expect = 2e-49 Identities = 223/263 (84%) Strand = Plus / Minus Query: 289 gctggcttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactg 348 |||| ||||||||| ||||| ||||| | |||||||||||||||||| |||||||| || Sbjct: 582 gctgtcttgacaactgtgactgggcaagtggcgttgttcacgacgtagtcgctgacgcta 523 Query: 349 cccaagagcaccctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatg 408 || || |||||||||||||| |||||||| |||||||| ||||| |||| |||||| ||| Sbjct: 522 cctaacagcaccctcttgagtttgccaagacccctgcttccaataaccaagcagctcatg 463 Query: 409 ggcatgtcatggatggcttggcatagcttctcgcggggatctccaaacaggactttggaa 468 || || || | ||||||||||||||| ||||| ||||||||||| | ||||||||| || Sbjct: 462 gggatttcgttgatggcttggcatagtttctcacggggatctccccaaaggactttgaaa 403 Query: 469 accacggcaacctccttctgcttagctatggtgttgagcatgtccagtgtttcagcatca 528 ||||| |||||||||||||| | || | || || |||||||||| |||||| |||||| Sbjct: 402 accaccacaacctccttctgcctggccacagtattaagcatgtccaatgtttcggcatca 343 Query: 529 ggcttcaccccatatttctttgc 551 ||||| | |||||||||||||| Sbjct: 342 ggctttgctccatatttctttgc 320
>gb|BT017342.1| Zea mays clone EL01N0323A01.c mRNA sequence Length = 525 Score = 149 bits (75), Expect = 1e-32 Identities = 147/171 (85%) Strand = Plus / Minus Query: 294 cttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactgcccaa 353 ||||||||||||||| ||||| | ||||||||||||||||||||||||||||| || || Sbjct: 329 cttgacaacggtgacagggcaggttgcgttgttcacgacgtaatcgctgacacttcctaa 270 Query: 354 gagcaccctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatgggcat 413 ||||||||||||||| ||||||||||||||||| || || |||| |||||| | || | Sbjct: 269 gagcaccctcttgagtttgccaaggcccctgcttcctataaccaagcagctcaacggggt 210 Query: 414 gtcatggatggcttggcatagcttctcgcggggatctccaaacaggacttt 464 ||||||||| |||| || |||||||| || |||||||| |||||||||| Sbjct: 209 gtcatggataacttgacagagcttctcacgcggatctccccacaggacttt 159
>gb|AY596596.1| Saccharum officinarum clone SCCCLR1072E04, complete sequence Length = 821 Score = 141 bits (71), Expect = 3e-30 Identities = 146/171 (85%) Strand = Plus / Minus Query: 294 cttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactgcccaa 353 |||||| |||||||| ||||| | |||||||||||||| || ||||||||||| ||||| Sbjct: 570 cttgacgacggtgacagggcaggttgcgttgttcacgacatagtcgctgacacttcccaa 511 Query: 354 gagcaccctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatgggcat 413 ||||||||||||||||||||||||||||||||| || || |||| |||||| | || | Sbjct: 510 gagcaccctcttgagcttgccaaggcccctgcttcctataaccaagcagctcaacggggt 451 Query: 414 gtcatggatggcttggcatagcttctcgcggggatctccaaacaggacttt 464 ||||||||| |||| || |||||||| || |||||||| |||||||||| Sbjct: 450 gtcatggataacttgacagagcttctcacgtggatctccccacaggacttt 400
>gb|AY107821.1| Zea mays PCO148543 mRNA sequence Length = 910 Score = 109 bits (55), Expect = 1e-20 Identities = 97/111 (87%) Strand = Plus / Minus Query: 294 cttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactgcccaa 353 |||||| |||||||| ||||| | || |||||||| || || ||||||||||| ||||| Sbjct: 651 cttgacgacggtgacagggcaggttgcattgttcacaacatagtcgctgacacttcccaa 592 Query: 354 gagcaccctcttgagcttgccaaggcccctgctcccaatgaccaggcagct 404 ||||||||||||||||||||||||||||||||| || || |||| |||||| Sbjct: 591 gagcaccctcttgagcttgccaaggcccctgcttcctataaccaagcagct 541
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 107 bits (54), Expect = 4e-20 Identities = 99/114 (86%) Strand = Plus / Plus Query: 360 cctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatgggcatgtcatg 419 ||||||||| |||||||| |||||||| ||||| |||| |||||| ||||| || || | Sbjct: 3285098 cctcttgagtttgccaagacccctgcttccaataaccaagcagctcatggggatttcgtt 3285157 Query: 420 gatggcttggcatagcttctcgcggggatctccaaacaggactttggaaaccac 473 ||||||||||||||||||||| ||||||||||| | ||||||||| ||||||| Sbjct: 3285158 gatggcttggcatagcttctcacggggatctccccaaaggactttgaaaaccac 3285211 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 289 gctggcttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactg 348 |||| ||||||||| ||||| ||||| | |||||||||||||||||| |||||||| || Sbjct: 3284931 gctgtcttgacaactgtgactgggcaagtggcgttgttcacgacgtagtcgctgacgcta 3284990 Query: 349 cccaagagcaccct 362 || || |||||||| Sbjct: 3284991 cctaacagcaccct 3285004 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 505 agcatgtccagtgtttcagcatcaggcttcaccccatatttctttgc 551 |||||||||| |||||| ||||||||||| | |||||||||||||| Sbjct: 3285325 agcatgtccaatgtttcggcatcaggctttgctccatatttctttgc 3285371
>gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete sequence Length = 167317 Score = 107 bits (54), Expect = 4e-20 Identities = 99/114 (86%) Strand = Plus / Plus Query: 360 cctcttgagcttgccaaggcccctgctcccaatgaccaggcagctgatgggcatgtcatg 419 ||||||||| |||||||| |||||||| ||||| |||| |||||| ||||| || || | Sbjct: 78922 cctcttgagtttgccaagacccctgcttccaataaccaagcagctcatggggatttcgtt 78981 Query: 420 gatggcttggcatagcttctcgcggggatctccaaacaggactttggaaaccac 473 ||||||||||||||||||||| ||||||||||| | ||||||||| ||||||| Sbjct: 78982 gatggcttggcatagcttctcacggggatctccccaaaggactttgaaaaccac 79035 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 289 gctggcttgacaacggtgaccgggcacgcggcgttgttcacgacgtaatcgctgacactg 348 |||| ||||||||| ||||| ||||| | |||||||||||||||||| |||||||| || Sbjct: 78755 gctgtcttgacaactgtgactgggcaagtggcgttgttcacgacgtagtcgctgacgcta 78814 Query: 349 cccaagagcaccct 362 || || |||||||| Sbjct: 78815 cctaacagcaccct 78828 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 505 agcatgtccagtgtttcagcatcaggcttcaccccatatttctttgc 551 |||||||||| |||||| ||||||||||| | |||||||||||||| Sbjct: 79149 agcatgtccaatgtttcggcatcaggctttgctccatatttctttgc 79195
>gb|BT019453.1| Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|BT019452.1| Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AE009171.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 197 of 256 of the complete sequence Length = 11237 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 245 ccagatgaggatattttcgatgacg 269 ||||||||||||||| ||||||||| Sbjct: 4507 ccagatgaggatattgtcgatgacg 4483
>gb|BC017314.2| Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 1 (avian), mRNA (cDNA clone MGC:29755 IMAGE:3946751), complete cds Length = 2154 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 749 ttagctatggtattgagcatgcccagtgt 777
>emb|AL590550.8| Human DNA sequence from clone RP11-398B19 on chromosome 6, complete sequence Length = 60406 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 221 atatataggactcaacaaact 241 ||||||||||||||||||||| Sbjct: 4273 atatataggactcaacaaact 4253
>emb|BX640634.1|HSM806680 Homo sapiens mRNA; cDNA DKFZp686D0662 (from clone DKFZp686D0662); complete cds Length = 5182 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 696 ttagctatggtattgagcatgcccagtgt 724
>ref|NM_005238.2| Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), mRNA Length = 5228 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 751 ttagctatggtattgagcatgcccagtgt 779
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 245 ccagatgaggatattttcgatgacg 269 ||||||||||||||| ||||||||| Sbjct: 2184179 ccagatgaggatattgtcgatgacg 2184155
>emb|CR542254.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0726D for gene ETS1, v-ets erythroblastosis virus E26 oncogene homolog 1 (avian); complete cds, incl. stopcodon Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY890388.1| Synthetic construct Homo sapiens clone FLH018852.01X v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY888523.1| Synthetic construct Homo sapiens clone FLH008825.01X v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY888522.1| Synthetic construct Homo sapiens clone FLH008824.01X v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY893897.1| Synthetic construct Homo sapiens clone FLH127901.01L v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, partial cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY893450.1| Synthetic construct Homo sapiens clone FLH127819.01X v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY893377.1| Synthetic construct Homo sapiens clone FLH131104.01X v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, complete cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|AY892857.1| Synthetic construct Homo sapiens clone FLH018848.01L v-ets erythroblastosis virus E26 oncogene-like 1 (ETS1) mRNA, partial cds Length = 1326 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 479 ttagctatggtattgagcatgcccagtgt 507
>gb|J04101.1|HUMETS1A Human erythroblastosis virus oncogene homolog 1 (ets-1) mRNA, complete cds Length = 1450 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 598 ttagctatggtattgagcatgcccagtgt 626
>emb|X14798.1|HSCETS1 Human DNA for c-ets-1 proto-oncogene Length = 1604 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 490 ttagctatggtgttgagcatgtccagtgt 518 ||||||||||| ||||||||| ||||||| Sbjct: 757 ttagctatggtattgagcatgcccagtgt 785
>gb|AC154009.1| Mus musculus 6 NOVECTOR RP24-544G1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 140214 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 atatataggactcaacaaac 240 |||||||||||||||||||| Sbjct: 9205 atatataggactcaacaaac 9186
>gb|AC152185.1| Medicago truncatula chromosome 2 BAC clone mth2-97e5, complete sequence Length = 132467 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 325 ttcacgacgtaatcgctgacactgccca 352 ||||| ||||||| |||||||||||||| Sbjct: 108557 ttcactacgtaattgctgacactgccca 108530
>gb|AY242824.1| Afipia felis strain B-91-007352 RNA polymerase beta subunit (rpoB) gene, complete cds Length = 4137 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 36 atcacgcatgcagcaaacagcagc 59 ||||||| |||||||||||||||| Sbjct: 557 atcacgcgtgcagcaaacagcagc 534
>gb|AC149542.1| Populus trichocarpa clone Pop1-2C5, complete sequence Length = 146274 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 517 gtttcagcatcaggcttcaccccatatttctt 548 ||||||| ||||||||||| ||| |||||||| Sbjct: 39891 gtttcaggatcaggcttcaacccgtatttctt 39922
>gb|AC125330.5| Mus musculus BAC clone RP23-217A6 from chromosome 6, complete sequence Length = 182355 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 atatataggactcaacaaac 240 |||||||||||||||||||| Sbjct: 120679 atatataggactcaacaaac 120660
>gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 8 of 11 of the complete sequence Length = 250029 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 249 atgaggatattttcgatgac 268 |||||||||||||||||||| Sbjct: 56907 atgaggatattttcgatgac 56926
>gb|AC144539.7| Medicago truncatula clone mth2-11o10, complete sequence Length = 113167 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 325 ttcacgacgtaatcgctgacactgccca 352 ||||| ||||||| |||||||||||||| Sbjct: 7772 ttcactacgtaattgctgacactgccca 7745
>emb|AL732414.17| Human DNA sequence from clone RP11-423F24 on chromosome 1 Contains the 3' end of the gene for the likely ortholog of yeast ARV1 (ARV1), the gene for a novel protein, a ring finger protein 4 (RNF4) pseudogene and a CpG island, complete sequence Length = 105642 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 catgcagcaaacagcagcac 61 |||||||||||||||||||| Sbjct: 60685 catgcagcaaacagcagcac 60704 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 catgcagcaaacagcagcac 61 |||||||||||||||||||| Sbjct: 58699 catgcagcaaacagcagcac 58718
>emb|AL356461.15| Human DNA sequence from clone RP11-180D15 on chromosome Xq13.2-21.2 Contains a purinergic receptor P2Y G-protein coupled 10 (P2RY10) pseudogene, complete sequence Length = 127615 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 409 ggcatgtcatggatggcttg 428 |||||||||||||||||||| Sbjct: 9807 ggcatgtcatggatggcttg 9826
>gb|AC117489.3| Homo sapiens 3 BAC CTD-2006M22 (CalTech BAC Library D) complete sequence Length = 145729 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 116 acacatgcacagattacaca 135 |||||||||||||||||||| Sbjct: 17593 acacatgcacagattacaca 17574
>gb|AC119731.3| Homo sapiens 3 BAC RP11-135O2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 44700 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 116 acacatgcacagattacaca 135 |||||||||||||||||||| Sbjct: 8542 acacatgcacagattacaca 8561
>ref|XM_687926.1| PREDICTED: Danio rerio similar to polyA polymerase alpha (LOC564596), partial mRNA Length = 1180 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 aatgaccaggcagctgatgg 409 |||||||||||||||||||| Sbjct: 223 aatgaccaggcagctgatgg 242
>gb|AC008195.6|AC008195 Drosophila melanogaster, chromosome 3R, region 93F-93F, BAC clone BACR42I20, complete sequence Length = 164944 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 163 tcaatcattattacaaacaa 182 |||||||||||||||||||| Sbjct: 79857 tcaatcattattacaaacaa 79838
>gb|AE003736.3| Drosophila melanogaster chromosome 3R, section 74 of 118 of the complete sequence Length = 235928 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 163 tcaatcattattacaaacaa 182 |||||||||||||||||||| Sbjct: 105865 tcaatcattattacaaacaa 105846
>gb|AC120132.11| Mus musculus chromosome 6, clone RP23-105D1, complete sequence Length = 203185 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 221 atatataggactcaacaaac 240 |||||||||||||||||||| Sbjct: 130970 atatataggactcaacaaac 130951
>gb|L07144.3| Caenorhabditis elegans cosmid R05D3, complete sequence Length = 44910 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 235 acaaactaaaccagatgaggatat 258 ||||||||||| |||||||||||| Sbjct: 12867 acaaactaaacaagatgaggatat 12890
>emb|AL626783.16| Mouse DNA sequence from clone RP23-406B13 on chromosome 4, complete sequence Length = 179370 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 cattattacaaacaacaaca 187 |||||||||||||||||||| Sbjct: 70766 cattattacaaacaacaaca 70747 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,789,948 Number of Sequences: 3902068 Number of extensions: 4789948 Number of successful extensions: 84164 Number of sequences better than 10.0: 44 Number of HSP's better than 10.0 without gapping: 44 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 84052 Number of HSP's gapped (non-prelim): 104 length of query: 569 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 546 effective length of database: 17,143,297,704 effective search space: 9360240546384 effective search space used: 9360240546384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)