ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd2j12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_660916.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.40392) partial mRNA Length = 2388 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 tgttctatatattgatagcat 29 ||||||||||||||||||||| Sbjct: 1041 tgttctatatattgatagcat 1061
>ref|XM_625920.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd4_3440), partial mRNA Length = 2388 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 9 tgttctatatattgatagcat 29 ||||||||||||||||||||| Sbjct: 1041 tgttctatatattgatagcat 1061
>gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, complete sequence Length = 197686 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 104 agactaaggatctcttggag 123 |||||||||||||||||||| Sbjct: 19118 agactaaggatctcttggag 19137
>ref|XM_954242.1| Neurospora crassa OR74A hypothetical protein (NCU08245.1) partial mRNA Length = 1395 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 495 tgaaccaactcattctgccc 514 |||||||||||||||||||| Sbjct: 180 tgaaccaactcattctgccc 199
>ref|XM_328950.1| Neurospora crassa OR74A hypothetical protein (NCU08245.1) partial mRNA Length = 1395 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 495 tgaaccaactcattctgccc 514 |||||||||||||||||||| Sbjct: 180 tgaaccaactcattctgccc 199
>gb|AC114643.9| Mus musculus chromosome 6, clone RP24-127D6, complete sequence Length = 215696 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 104 agactaaggatctcttggag 123 |||||||||||||||||||| Sbjct: 60099 agactaaggatctcttggag 60080
>gb|CP000107.1| Ehrlichia canis str. Jake, complete genome Length = 1315030 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 396 tcctctaccaatatgtatac 415 |||||||||||||||||||| Sbjct: 1226685 tcctctaccaatatgtatac 1226704
>gb|AC084165.1|AC084165 Arabidopsis thaliana chromosome 1 BAC F3C3 genomic sequence, complete sequence Length = 90132 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 cataatgtttcactacaaac 156 |||||||||||||||||||| Sbjct: 52753 cataatgtttcactacaaac 52734 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,396,050 Number of Sequences: 3902068 Number of extensions: 4396050 Number of successful extensions: 70423 Number of sequences better than 10.0: 8 Number of HSP's better than 10.0 without gapping: 8 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 70408 Number of HSP's gapped (non-prelim): 15 length of query: 583 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 560 effective length of database: 17,143,297,704 effective search space: 9600246714240 effective search space used: 9600246714240 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
