ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2i22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX322614.3| Zebrafish DNA sequence from clone CH211-215G1 in... 44 0.48
2gb|AC147679.13| Canis Familiaris, clone XX-10F3, complete sequence 40 7.6
3gb|AC105256.7| Mus musculus BAC clone RP23-413O13 from chromosom... 40 7.6
4gb|AY150217.1| Ambystoma tigrinum stebbensi virus, complete genome 40 7.6
5gb|AY166971.1|AY166970S02 Homo sapiens carbamoylphosphate synthe... 40 7.6
6emb|BX294100.11| Zebrafish DNA sequence from clone DKEYP-2G11 in... 40 7.6
7emb|BX571714.7| Zebrafish DNA sequence from clone DKEY-16L2 in l... 40 7.6
8emb|BX511164.11| Zebrafish DNA sequence from clone DKEY-63J1 in ... 40 7.6
9gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Canc... 40 7.6
10dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
11dbj|AP003196.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.6
12emb|BX005142.4| Zebrafish DNA sequence from clone CH211-129K16 i... 40 7.6
13gb|AC024913.33| Mus musculus BAC Clone 402k12 RPCI-23, complete ... 40 7.6

>emb|BX322614.3| Zebrafish DNA sequence from clone CH211-215G1 in linkage group 16,
             complete sequence
          Length = 199783

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 72    tccatctacttactaatcaccatgac 97
             |||||||| |||||||||||||||||
Sbjct: 18559 tccatctatttactaatcaccatgac 18584



to top

>gb|AC147679.13| Canis Familiaris, clone XX-10F3, complete sequence
          Length = 193944

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 70    catccatctacttactaatcacca 93
             |||||||||||||||| |||||||
Sbjct: 64082 catccatctacttactcatcacca 64059



to top

>gb|AC105256.7| Mus musculus BAC clone RP23-413O13 from chromosome 8, complete sequence
          Length = 210086

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 101    tgcaaatacaaggtttacaa 120
              ||||||||||||||||||||
Sbjct: 112019 tgcaaatacaaggtttacaa 112000



to top

>gb|AY150217.1| Ambystoma tigrinum stebbensi virus, complete genome
          Length = 106332

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 146   aatggaagcggccttctcta 165
             ||||||||||||||||||||
Sbjct: 46458 aatggaagcggccttctcta 46477



to top

>gb|AY166971.1|AY166970S02 Homo sapiens carbamoylphosphate synthetase (CPSI) gene, exon 2;
           nuclear gene for mitochondrial product
          Length = 324

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 498 catgcaacgtgtttcttcag 517
           ||||||||||||||||||||
Sbjct: 95  catgcaacgtgtttcttcag 114



to top

>emb|BX294100.11| Zebrafish DNA sequence from clone DKEYP-2G11 in linkage group 12,
             complete sequence
          Length = 173405

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 336   tacacagccacttgccacac 355
             ||||||||||||||||||||
Sbjct: 49748 tacacagccacttgccacac 49767



to top

>emb|BX571714.7| Zebrafish DNA sequence from clone DKEY-16L2 in linkage group 3,
             complete sequence
          Length = 240105

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 376   ttgttgttgaatgactgtgaatac 399
             |||||||||||||| |||||||||
Sbjct: 63443 ttgttgttgaatgattgtgaatac 63420



to top

>emb|BX511164.11| Zebrafish DNA sequence from clone DKEY-63J1 in linkage group 19, complete
              sequence
          Length = 214001

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 499    atgcaacgtgtttcttcagt 518
              ||||||||||||||||||||
Sbjct: 141793 atgcaacgtgtttcttcagt 141812



 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 499    atgcaacgtgtttcttcagt 518
              ||||||||||||||||||||
Sbjct: 138008 atgcaacgtgtttcttcagt 138027



to top

>gb|AC153820.4| Mus musculus 6 BAC RP23-459L15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 180996

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 325    atcacaggacctacacagccactt 348
              ||||||||||||||| ||||||||
Sbjct: 130405 atcacaggacctacaaagccactt 130382



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 81      ttactaatcaccatgactca 100
               ||||||||||||||||||||
Sbjct: 7984767 ttactaatcaccatgactca 7984786



to top

>dbj|AP003196.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1008C01
          Length = 144141

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    ttactaatcaccatgactca 100
             ||||||||||||||||||||
Sbjct: 91079 ttactaatcaccatgactca 91098



to top

>emb|BX005142.4| Zebrafish DNA sequence from clone CH211-129K16 in linkage group 3,
              complete sequence
          Length = 170200

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    ttgttgttgaatgactgtgaatac 399
              |||||||||||||| |||||||||
Sbjct: 148013 ttgttgttgaatgattgtgaatac 147990



to top

>gb|AC024913.33| Mus musculus BAC Clone 402k12 RPCI-23, complete sequence
          Length = 197831

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 325   atcacaggacctacacagccactt 348
             ||||||||||||||| ||||||||
Sbjct: 12123 atcacaggacctacaaagccactt 12146


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,579,209
Number of Sequences: 3902068
Number of extensions: 4579209
Number of successful extensions: 69436
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69395
Number of HSP's gapped (non-prelim): 41
length of query: 558
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 535
effective length of database: 17,143,297,704
effective search space: 9171664271640
effective search space used: 9171664271640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top