ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2f19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 155 1e-34
2dbj|AP003635.2| Oryza sativa (japonica cultivar-group) genomic D... 155 1e-34
3dbj|AK072047.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
4dbj|AK064913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
5dbj|AK060805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
6gb|AY105892.1| Zea mays PCO103778 mRNA sequence 98 2e-17
7gb|AY639668.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 70 5e-09
8gb|AY639667.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 70 5e-09
9gb|AY639665.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 70 5e-09
10gb|AY639673.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 68 2e-08
11gb|AY639670.1| Hordeum vulgare subsp. spontaneum cultivar PI 282... 68 2e-08
12gb|AY639666.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 68 2e-08
13gb|AY639669.1| Hordeum vulgare subsp. spontaneum cultivar PI 420... 66 8e-08
14gb|AY639680.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 64 3e-07
15dbj|AP003569.3| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
16dbj|AP003509.3| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
17gb|AY639676.1| Hordeum vulgare subsp. spontaneum cultivar PI 227... 62 1e-06
18gb|AY639672.1| Hordeum vulgare subsp. spontaneum cultivar PI 254... 62 1e-06
19gb|AY639677.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 60 5e-06
20gb|AY639679.1| Hordeum vulgare subsp. spontaneum cultivar PI 220... 58 2e-05
21gb|AY639678.1| Hordeum vulgare subsp. spontaneum cultivar PI 560... 58 2e-05
22gb|AY639674.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 58 2e-05
23gb|AY639671.1| Hordeum vulgare subsp. spontaneum cultivar PI 466... 58 2e-05
24dbj|AK063733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 8e-05
25gb|AY639686.1| Triticum urartu cultivar IG45443 FtsH-like protei... 54 3e-04
26gb|AY639682.1| Aegilops tauschii cultivar KU2146 FtsH-like prote... 54 3e-04
27gb|AY639675.1| Hordeum vulgare subsp. spontaneum cultivar PI 420... 54 3e-04
28gb|AY639660.1| Lophopyrum elongatum FtsH-like protein gene, part... 54 3e-04
29gb|AY639690.1| Triticum monococcum cultivar G4913 FtsH-like prot... 52 0.001
30gb|AY639688.1| Triticum urartu cultivar IG113242 FtsH-like prote... 52 0.001
31gb|AY639683.1| Triticum urartu cultivar IG113243 FtsH-like prote... 52 0.001
32gb|AY639662.1| Aegilops tauschii cultivar KU2030 FtsH-like prote... 52 0.001
33gb|AY639693.1| Triticum urartu cultivar IG45487 FtsH-like protei... 50 0.005
34gb|AY639692.1| Aegilops tauschii cultivar KU2160 FtsH-like prote... 50 0.005
35gb|AY639691.1| Aegilops tauschii cultivar KU2065 FtsH-like prote... 50 0.005
36gb|AY639689.1| Triticum monococcum cultivar G2252 FtsH-like prot... 50 0.005
37gb|AY639684.1| Aegilops tauschii cultivar KU2801 FtsH-like prote... 50 0.005
38gb|AY639681.1| Triticum urartu cultivar IG45470 FtsH-like protei... 50 0.005
39gb|AY639663.1| Triticum monococcum cultivar G1974 FtsH-like prot... 50 0.005
40gb|AY639694.1| Aegilops tauschii cultivar KU2156 FtsH-like prote... 48 0.019
41gb|AY639685.1| Triticum monococcum cultivar G1725 FtsH-like prot... 48 0.019
42gb|AY639664.1| Triticum urartu cultivar IG45218 FtsH-like protei... 48 0.019
43gb|AY639687.1| Triticum urartu cultivar IG45633 FtsH-like protei... 46 0.074
44gb|AC121144.11| Mus musculus chromosome 3, clone RP24-202D19, co... 44 0.29
45gb|AY639661.1| Lophopyrum elongatum FtsH-like protein gene, part... 44 0.29
46emb|AL031289.1|HS739H11 Human DNA sequence from clone RP4-739H11... 44 0.29
47dbj|AB236774.1| Trifolium pratense RNA for putative zinc depende... 44 0.29
48emb|AL354740.29| Human DNA sequence from clone RP11-513I15 on ch... 42 1.2
49emb|BX649413.8| Mouse DNA sequence from clone RP23-193P21 on chr... 42 1.2
50dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.2
51gb|AC009343.9| Drosophila melanogaster clone BACR08L17, complete... 40 4.6
52gb|AC158803.11| Mus musculus 10 BAC RP24-186E11 (Roswell Park Ca... 40 4.6
53gb|AC122893.6| Mus musculus BAC clone RP23-67C3 from chromosome ... 40 4.6
54ref|XM_454238.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E06413g ... 40 4.6
55gb|AC113095.14| Mus musculus chromosome 9, clone RP23-311A1, com... 40 4.6
56ref|XM_390629.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 4.6
57gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, compl... 40 4.6
58ref|XM_815304.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 4.6
59gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 40 4.6
60gb|AC124195.4| Mus musculus BAC clone RP23-285G17 from 16, compl... 40 4.6
61gb|AC158340.9| Mus musculus chromosome 1, clone RP24-161N8, comp... 40 4.6
62gb|AC102781.5| Mus musculus chromosome 1, clone RP23-271G2, comp... 40 4.6
63gb|AC104323.27| Mus musculus strain C57BL/6J chromosome 17 clone... 40 4.6
64gb|AY143411.1| Buellia elegans internal transcribed spacer 1, pa... 40 4.6
65emb|AL354872.9| Human DNA sequence from clone RP11-42O15 on chro... 40 4.6
66gb|AY129673.1| Kluyveromyces lactis protein kinase C (PKC1) gene... 40 4.6
67gb|AC161410.3| Mus musculus chromosome 8, clone RP23-399J5, comp... 40 4.6
68emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 4.6
69emb|AL645913.12| Mouse DNA sequence from clone RP23-194G14 on ch... 40 4.6
70emb|AL132963.1|ATT21J18 Arabidopsis thaliana DNA chromosome 3, B... 40 4.6
71emb|AL589722.17| Mouse DNA sequence from clone RP23-169M24 on ch... 40 4.6
72gb|AC174824.3| Cavia porcellus clone CH234-33F4, complete sequence 40 4.6
73gb|AC099340.3| Homo sapiens BAC clone RP11-214O14 from 4, comple... 40 4.6
74dbj|AK046535.1| Mus musculus adult male adrenal gland cDNA, RIKE... 40 4.6
75gb|AC175674.2| Gallus gallus BAC clone CH261-137E22 from chromos... 40 4.6
76dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.6
77emb|AL844591.6| Mouse DNA sequence from clone RP23-414J11 on chr... 40 4.6
78gb|AC013406.7| Homo sapiens BAC clone RP11-341F20 from 2, comple... 40 4.6
79dbj|AP005567.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.6
80dbj|AP005314.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.6
81gb|AY542311.1| Sorghum bicolor clone SB20O07 b1-1, b1-2, putativ... 40 4.6
82gb|AY112063.1| Zea mays CL922_1 mRNA sequence 40 4.6
83gb|AC153593.4| Mus musculus 6 BAC RP23-131B11 (Roswell Park Canc... 40 4.6
84gb|AC156506.4| Mus musculus 6 BAC RP24-266P6 (Roswell Park Cance... 40 4.6
85gb|AE003828.4| Drosophila melanogaster chromosome 2R, section 22... 40 4.6
86emb|BX294124.8| Mouse DNA sequence from clone RP23-80H12 on chro... 40 4.6
87gb|AC154313.2| Mus musculus BAC clone RP23-354M21 from chromosom... 40 4.6
88gb|AC129214.5| Mus musculus BAC clone RP24-426N11 from 16, compl... 40 4.6
89emb|AL672089.17| Mouse DNA sequence from clone RP23-295D9 on chr... 40 4.6
90emb|AL806517.9| Mouse DNA sequence from clone RP23-20K17 on chro... 40 4.6
91emb|AL592450.8| Mouse DNA sequence from clone RP23-282N6 on chro... 40 4.6

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  155 bits (78), Expect = 1e-34
 Identities = 210/254 (82%)
 Strand = Plus / Plus

                                                                            
Query: 84       gggggcacccggttctcgacggggatctcggtgaactcggacaggatggcccggaactcg 143
                ||||| |||||||||||||| |||||||| ||||||||||| || || |||| |||||||
Sbjct: 27341131 gggggaacccggttctcgacagggatctccgtgaactcggagagaatcgccctgaactcg 27341190

                                                                            
Query: 144      tcgccgctcagcgtctccttctccaggagcacctccacgatcttgtccatggccacgcgg 203
                || || ||||  ||||||||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 27341191 tcaccactcaatgtctccttctcaaggagcacctccacgatcttgtccatggcctcccgg 27341250

                                                                            
Query: 204      ttctccctcacctgctgcagcgcgatctcgtatgcctggtccgacagctgcttcaccgcc 263
                ||   ||| | |||   ||  ||||||||||| ||||  || |||| | ||||||| || 
Sbjct: 27341251 ttgctcctgatctggctcaaagcgatctcgtaggcctcatcggacaaccgcttcacagcg 27341310

                                                                            
Query: 264      gagtcgatgtctagcgccagcttctccgacatggagttccgagccatcatccgcatgatc 323
                |  ||||||||   ||| ||||||||||||||||||||||  |||||||||| |||||| 
Sbjct: 27341311 gtatcgatgtcctccgcgagcttctccgacatggagttccttgccatcatcctcatgatg 27341370

                              
Query: 324      acgtccccgctctg 337
                || || ||||||||
Sbjct: 27341371 acatcgccgctctg 27341384



 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                           
Query: 123     gacaggatggcccggaactcgtcgccgctcagcgtctccttctccaggagcacctccacg 182
               |||| ||| |||| ||||||||||||||  |||||||||||||||| |||||| ||||| 
Sbjct: 6712294 gacaagatcgccctgaactcgtcgccgccgagcgtctccttctccatgagcacgtccacc 6712353

                                       
Query: 183     atcttgtccatggccacgcggttc 206
               | || ||| |||||  ||||||||
Sbjct: 6712354 agctggtcgatggcggcgcggttc 6712377



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 286     tctccgacatggagttccgagccatcatccgca 318
               |||||||||||||| |||| |||| ||||||||
Sbjct: 6712457 tctccgacatggagctccgggccagcatccgca 6712489



to top

>dbj|AP003635.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0686E06
          Length = 150474

 Score =  155 bits (78), Expect = 1e-34
 Identities = 210/254 (82%)
 Strand = Plus / Plus

                                                                         
Query: 84    gggggcacccggttctcgacggggatctcggtgaactcggacaggatggcccggaactcg 143
             ||||| |||||||||||||| |||||||| ||||||||||| || || |||| |||||||
Sbjct: 83958 gggggaacccggttctcgacagggatctccgtgaactcggagagaatcgccctgaactcg 84017

                                                                         
Query: 144   tcgccgctcagcgtctccttctccaggagcacctccacgatcttgtccatggccacgcgg 203
             || || ||||  ||||||||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 84018 tcaccactcaatgtctccttctcaaggagcacctccacgatcttgtccatggcctcccgg 84077

                                                                         
Query: 204   ttctccctcacctgctgcagcgcgatctcgtatgcctggtccgacagctgcttcaccgcc 263
             ||   ||| | |||   ||  ||||||||||| ||||  || |||| | ||||||| || 
Sbjct: 84078 ttgctcctgatctggctcaaagcgatctcgtaggcctcatcggacaaccgcttcacagcg 84137

                                                                         
Query: 264   gagtcgatgtctagcgccagcttctccgacatggagttccgagccatcatccgcatgatc 323
             |  ||||||||   ||| ||||||||||||||||||||||  |||||||||| |||||| 
Sbjct: 84138 gtatcgatgtcctccgcgagcttctccgacatggagttccttgccatcatcctcatgatg 84197

                           
Query: 324   acgtccccgctctg 337
             || || ||||||||
Sbjct: 84198 acatcgccgctctg 84211



to top

>dbj|AK072047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111G24, full
            insert sequence
          Length = 2183

 Score =  155 bits (78), Expect = 1e-34
 Identities = 210/254 (82%)
 Strand = Plus / Minus

                                                                        
Query: 84   gggggcacccggttctcgacggggatctcggtgaactcggacaggatggcccggaactcg 143
            ||||| |||||||||||||| |||||||| ||||||||||| || || |||| |||||||
Sbjct: 2009 gggggaacccggttctcgacagggatctccgtgaactcggagagaatcgccctgaactcg 1950

                                                                        
Query: 144  tcgccgctcagcgtctccttctccaggagcacctccacgatcttgtccatggccacgcgg 203
            || || ||||  ||||||||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 1949 tcaccactcaatgtctccttctcaaggagcacctccacgatcttgtccatggcctcccgg 1890

                                                                        
Query: 204  ttctccctcacctgctgcagcgcgatctcgtatgcctggtccgacagctgcttcaccgcc 263
            ||   ||| | |||   ||  ||||||||||| ||||  || |||| | ||||||| || 
Sbjct: 1889 ttgctcctgatctggctcaaagcgatctcgtaggcctcatcggacaaccgcttcacagcg 1830

                                                                        
Query: 264  gagtcgatgtctagcgccagcttctccgacatggagttccgagccatcatccgcatgatc 323
            |  ||||||||   ||| ||||||||||||||||||||||  |||||||||| |||||| 
Sbjct: 1829 gtatcgatgtcctccgcgagcttctccgacatggagttccttgccatcatcctcatgatg 1770

                          
Query: 324  acgtccccgctctg 337
            || || ||||||||
Sbjct: 1769 acatcgccgctctg 1756



to top

>dbj|AK064913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000M12, full
            insert sequence
          Length = 2433

 Score =  155 bits (78), Expect = 1e-34
 Identities = 210/254 (82%)
 Strand = Plus / Minus

                                                                        
Query: 84   gggggcacccggttctcgacggggatctcggtgaactcggacaggatggcccggaactcg 143
            ||||| |||||||||||||| |||||||| ||||||||||| || || |||| |||||||
Sbjct: 2259 gggggaacccggttctcgacagggatctccgtgaactcggagagaatcgccctgaactcg 2200

                                                                        
Query: 144  tcgccgctcagcgtctccttctccaggagcacctccacgatcttgtccatggccacgcgg 203
            || || ||||  ||||||||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 2199 tcaccactcaatgtctccttctcaaggagcacctccacgatcttgtccatggcctcccgg 2140

                                                                        
Query: 204  ttctccctcacctgctgcagcgcgatctcgtatgcctggtccgacagctgcttcaccgcc 263
            ||   ||| | |||   ||  ||||||||||| ||||  || |||| | ||||||| || 
Sbjct: 2139 ttgctcctgatctggctcaaagcgatctcgtaggcctcatcggacaaccgcttcacagcg 2080

                                                                        
Query: 264  gagtcgatgtctagcgccagcttctccgacatggagttccgagccatcatccgcatgatc 323
            |  ||||||||   ||| ||||||||||||||||||||||  |||||||||| |||||| 
Sbjct: 2079 gtatcgatgtcctccgcgagcttctccgacatggagttccttgccatcatcctcatgatg 2020

                          
Query: 324  acgtccccgctctg 337
            || || ||||||||
Sbjct: 2019 acatcgccgctctg 2006



to top

>dbj|AK060805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-F12, full
            insert sequence
          Length = 2276

 Score =  147 bits (74), Expect = 3e-32
 Identities = 209/254 (82%)
 Strand = Plus / Minus

                                                                        
Query: 84   gggggcacccggttctcgacggggatctcggtgaactcggacaggatggcccggaactcg 143
            ||||| |||||||||||||| |||||||| ||| ||||||| || || |||| |||||||
Sbjct: 2069 gggggaacccggttctcgacagggatctccgtggactcggagagaatcgccctgaactcg 2010

                                                                        
Query: 144  tcgccgctcagcgtctccttctccaggagcacctccacgatcttgtccatggccacgcgg 203
            || || ||||  ||||||||||| |||||||||||||||||||||||||||||| | |||
Sbjct: 2009 tcaccactcaatgtctccttctcaaggagcacctccacgatcttgtccatggcctcccgg 1950

                                                                        
Query: 204  ttctccctcacctgctgcagcgcgatctcgtatgcctggtccgacagctgcttcaccgcc 263
            ||   ||| | |||   ||  ||||||||||| ||||  || |||| | ||||||| || 
Sbjct: 1949 ttgctcctgatctggctcaaagcgatctcgtaggcctcatcggacaaccgcttcacagcg 1890

                                                                        
Query: 264  gagtcgatgtctagcgccagcttctccgacatggagttccgagccatcatccgcatgatc 323
            |  ||||||||   ||| ||||||||||||||||||||||  |||||||||| |||||| 
Sbjct: 1889 gtatcgatgtcctccgcgagcttctccgacatggagttccttgccatcatcctcatgatg 1830

                          
Query: 324  acgtccccgctctg 337
            || || ||||||||
Sbjct: 1829 acatcgccgctctg 1816



to top

>gb|AY105892.1| Zea mays PCO103778 mRNA sequence
          Length = 2203

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 169/209 (80%)
 Strand = Plus / Minus

                                                                        
Query: 132  gcccggaactcgtcgccgctcagcgtctccttctccaggagcacctccacgatcttgtcc 191
            |||||||||||||| |||  ||| ||||||||||| | ||||||||| ||||| ||||| 
Sbjct: 1865 gcccggaactcgtctccggccagtgtctccttctcaatgagcacctcaacgattttgtcg 1806

                                                                        
Query: 192  atggccacgcggttctccctcacctgctgcagcgcgatctcgtatgcctggtccgacagc 251
            |||||| | | ||| |  || |  |||  ||  ||||||||||| ||||  || |||| |
Sbjct: 1805 atggcctccctgttgtttctaatgtgcctcaatgcgatctcgtaggcctcatctgacaac 1746

                                                                        
Query: 252  tgcttcaccgccgagtcgatgtctagcgccagcttctccgacatggagttccgagccatc 311
            |||||||| ||||| || |||||   ||| |||||||| |||||||||||||  ||||||
Sbjct: 1745 tgcttcactgccgaatcaatgtcctccgcaagcttctctgacatggagttccttgccatc 1686

                                         
Query: 312  atccgcatgatcacgtccccgctctgtgc 340
            || |||||||| |||||||| ||||||||
Sbjct: 1685 attcgcatgatgacgtccccactctgtgc 1657



to top

>gb|AY639668.1| Hordeum vulgare subsp. spontaneum cultivar PI 466529 FtsH-like
           protein gene, partial cds
          Length = 356

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 310 tcatccgcatgatcacgtccccgctctgtgcggcg 344
           |||||||||||||||||||||||||||||||||||
Sbjct: 356 tcatccgcatgatcacgtccccgctctgtgcggcg 322



to top

>gb|AY639667.1| Hordeum vulgare subsp. spontaneum cultivar PI 466625 FtsH-like
           protein gene, partial cds
          Length = 356

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 310 tcatccgcatgatcacgtccccgctctgtgcggcg 344
           |||||||||||||||||||||||||||||||||||
Sbjct: 356 tcatccgcatgatcacgtccccgctctgtgcggcg 322



to top

>gb|AY639665.1| Hordeum vulgare subsp. spontaneum cultivar PI 466252 FtsH-like
           protein gene, partial cds
          Length = 355

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 310 tcatccgcatgatcacgtccccgctctgtgcggcg 344
           |||||||||||||||||||||||||||||||||||
Sbjct: 355 tcatccgcatgatcacgtccccgctctgtgcggcg 321



to top

>gb|AY639673.1| Hordeum vulgare subsp. spontaneum cultivar PI 466631 FtsH-like
           protein gene, partial cds
          Length = 358

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                             
Query: 311 catccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||||||||||||||||||||
Sbjct: 358 catccgcatgatcacgtccccgctctgtgcggcg 325



to top

>gb|AY639670.1| Hordeum vulgare subsp. spontaneum cultivar PI 282591 FtsH-like
           protein gene, partial cds
          Length = 355

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                             
Query: 311 catccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||||||||||||||||||||
Sbjct: 355 catccgcatgatcacgtccccgctctgtgcggcg 322



to top

>gb|AY639666.1| Hordeum vulgare subsp. spontaneum cultivar PI 466684 FtsH-like
           protein gene, partial cds
          Length = 341

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                             
Query: 311 catccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||||||||||||||||||||
Sbjct: 341 catccgcatgatcacgtccccgctctgtgcggcg 308



to top

>gb|AY639669.1| Hordeum vulgare subsp. spontaneum cultivar PI 420914 FtsH-like
           protein gene, partial cds
          Length = 355

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                            
Query: 312 atccgcatgatcacgtccccgctctgtgcggcg 344
           |||||||||||||||||||||||||||||||||
Sbjct: 355 atccgcatgatcacgtccccgctctgtgcggcg 323



to top

>gb|AY639680.1| Hordeum vulgare subsp. spontaneum cultivar PI 560558 FtsH-like
           protein gene, partial cds
          Length = 354

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 313 tccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||||||||||||||||||
Sbjct: 354 tccgcatgatcacgtccccgctctgtgcggcg 323



to top

>dbj|AP003569.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0425F05
          Length = 162858

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                          
Query: 123    gacaggatggcccggaactcgtcgccgctcagcgtctccttctccaggagcacctccacg 182
              |||| ||| |||| ||||||||||||||  |||||||||||||||| |||||| ||||| 
Sbjct: 146420 gacaagatcgccctgaactcgtcgccgccgagcgtctccttctccatgagcacgtccacc 146479

                                      
Query: 183    atcttgtccatggccacgcggttc 206
              | || ||| |||||  ||||||||
Sbjct: 146480 agctggtcgatggcggcgcggttc 146503



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 286    tctccgacatggagttccgagccatcatccgca 318
              |||||||||||||| |||| |||| ||||||||
Sbjct: 146583 tctccgacatggagctccgggccagcatccgca 146615



to top

>dbj|AP003509.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0525F01
          Length = 151668

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                         
Query: 123   gacaggatggcccggaactcgtcgccgctcagcgtctccttctccaggagcacctccacg 182
             |||| ||| |||| ||||||||||||||  |||||||||||||||| |||||| ||||| 
Sbjct: 41973 gacaagatcgccctgaactcgtcgccgccgagcgtctccttctccatgagcacgtccacc 42032

                                     
Query: 183   atcttgtccatggccacgcggttc 206
             | || ||| |||||  ||||||||
Sbjct: 42033 agctggtcgatggcggcgcggttc 42056



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 286   tctccgacatggagttccgagccatcatccgca 318
             |||||||||||||| |||| |||| ||||||||
Sbjct: 42136 tctccgacatggagctccgggccagcatccgca 42168



to top

>gb|AY639676.1| Hordeum vulgare subsp. spontaneum cultivar PI 227301 FtsH-like
           protein gene, partial cds
          Length = 357

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 310 tcatccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||||| |||||||||||||||
Sbjct: 357 tcatccgcatgatcacgtctccgctctgtgcggcg 323



to top

>gb|AY639672.1| Hordeum vulgare subsp. spontaneum cultivar PI 254894 FtsH-like
           protein gene, partial cds
          Length = 358

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                          
Query: 310 tcatccgcatgatcacgtccccgctctgtgc 340
           |||||||||||||||||||||||||||||||
Sbjct: 358 tcatccgcatgatcacgtccccgctctgtgc 328



to top

>gb|AY639677.1| Hordeum vulgare subsp. spontaneum cultivar PI 560560 FtsH-like
           protein gene, partial cds
          Length = 357

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 311 catccgcatgatcacgtccccgctctgtgc 340
           ||||||||||||||||||||||||||||||
Sbjct: 357 catccgcatgatcacgtccccgctctgtgc 328



to top

>gb|AY639679.1| Hordeum vulgare subsp. spontaneum cultivar PI 220341 FtsH-like
           protein gene, partial cds
          Length = 356

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 312 atccgcatgatcacgtccccgctctgtgc 340
           |||||||||||||||||||||||||||||
Sbjct: 356 atccgcatgatcacgtccccgctctgtgc 328



to top

>gb|AY639678.1| Hordeum vulgare subsp. spontaneum cultivar PI 560560 FtsH-like
           protein gene, partial cds
          Length = 355

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 312 atccgcatgatcacgtccccgctctgtgc 340
           |||||||||||||||||||||||||||||
Sbjct: 355 atccgcatgatcacgtccccgctctgtgc 327



to top

>gb|AY639674.1| Hordeum vulgare subsp. spontaneum cultivar PI 466233 FtsH-like
           protein gene, partial cds
          Length = 352

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 312 atccgcatgatcacgtccccgctctgtgc 340
           |||||||||||||||||||||||||||||
Sbjct: 352 atccgcatgatcacgtccccgctctgtgc 324



to top

>gb|AY639671.1| Hordeum vulgare subsp. spontaneum cultivar PI 466265 FtsH-like
           protein gene, partial cds
          Length = 353

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 312 atccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||| |||||||||||||||
Sbjct: 353 atccgcatgatcacgtctccgctctgtgcggcg 321



to top

>dbj|AK063733.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-E10, full
           insert sequence
          Length = 694

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 123 gacaggatggcccggaactcgtcgccgctcagcgtctccttctccaggagcacctccacg 182
           |||| ||| |||| ||||||||||||||  |||||||||| ||||| |||||| ||||| 
Sbjct: 497 gacaagatcgccctgaactcgtcgccgccgagcgtctcctcctccatgagcacgtccacc 438

                                   
Query: 183 atcttgtccatggccacgcggttc 206
           | || ||| |||||  ||||||||
Sbjct: 437 agctggtcgatggcggcgcggttc 414



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 286 tctccgacatggagttccgagccatcatccgca 318
           |||||||||||||| |||| |||| ||||||||
Sbjct: 334 tctccgacatggagctccgggccagcatccgca 302



to top

>gb|AY639686.1| Triticum urartu cultivar IG45443 FtsH-like protein gene, partial
           cds
          Length = 324

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 311 catccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||||
Sbjct: 324 catccgcatgatcacgtccccgctctg 298



to top

>gb|AY639682.1| Aegilops tauschii cultivar KU2146 FtsH-like protein gene, partial
           cds
          Length = 338

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 311 catccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||||
Sbjct: 338 catccgcatgatcacgtccccgctctg 312



to top

>gb|AY639675.1| Hordeum vulgare subsp. spontaneum cultivar PI 420915 FtsH-like
           protein gene, partial cds
          Length = 352

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                          
Query: 314 ccgcatgatcacgtccccgctctgtgcggcg 344
           ||||||||||||||||||||| |||||||||
Sbjct: 352 ccgcatgatcacgtccccgctttgtgcggcg 322



to top

>gb|AY639660.1| Lophopyrum elongatum FtsH-like protein gene, partial cds
          Length = 337

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 311 catccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||||
Sbjct: 337 catccgcatgatcacgtccccgctctg 311



to top

>gb|AY639690.1| Triticum monococcum cultivar G4913 FtsH-like protein gene, partial
           cds
          Length = 337

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 312 atccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||||
Sbjct: 337 atccgcatgatcacgtccccgctctg 312



to top

>gb|AY639688.1| Triticum urartu cultivar IG113242 FtsH-like protein gene, partial
           cds
          Length = 334

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 312 atccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||||
Sbjct: 334 atccgcatgatcacgtccccgctctg 309



to top

>gb|AY639683.1| Triticum urartu cultivar IG113243 FtsH-like protein gene, partial
           cds
          Length = 334

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 312 atccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||||
Sbjct: 334 atccgcatgatcacgtccccgctctg 309



to top

>gb|AY639662.1| Aegilops tauschii cultivar KU2030 FtsH-like protein gene, partial
           cds
          Length = 337

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 312 atccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||||
Sbjct: 337 atccgcatgatcacgtccccgctctg 312



to top

>gb|AY639693.1| Triticum urartu cultivar IG45487 FtsH-like protein gene, partial
           cds
          Length = 333

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 333 tccgcatgatcacgtccccgctctg 309



to top

>gb|AY639692.1| Aegilops tauschii cultivar KU2160 FtsH-like protein gene, partial
           cds
          Length = 335

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 335 tccgcatgatcacgtccccgctctg 311



to top

>gb|AY639691.1| Aegilops tauschii cultivar KU2065 FtsH-like protein gene, partial
           cds
          Length = 336

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 336 tccgcatgatcacgtccccgctctg 312



to top

>gb|AY639689.1| Triticum monococcum cultivar G2252 FtsH-like protein gene, partial
           cds
          Length = 336

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 336 tccgcatgatcacgtccccgctctg 312



to top

>gb|AY639684.1| Aegilops tauschii cultivar KU2801 FtsH-like protein gene, partial
           cds
          Length = 337

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 337 tccgcatgatcacgtccccgctctg 313



to top

>gb|AY639681.1| Triticum urartu cultivar IG45470 FtsH-like protein gene, partial
           cds
          Length = 334

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 334 tccgcatgatcacgtccccgctctg 310



to top

>gb|AY639663.1| Triticum monococcum cultivar G1974 FtsH-like protein gene, partial
           cds
          Length = 335

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 313 tccgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||||
Sbjct: 335 tccgcatgatcacgtccccgctctg 311



to top

>gb|AY639694.1| Aegilops tauschii cultivar KU2156 FtsH-like protein gene, partial
           cds
          Length = 334

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 314 ccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||
Sbjct: 334 ccgcatgatcacgtccccgctctg 311



to top

>gb|AY639685.1| Triticum monococcum cultivar G1725 FtsH-like protein gene, partial
           cds
          Length = 320

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 314 ccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||
Sbjct: 320 ccgcatgatcacgtccccgctctg 297



to top

>gb|AY639664.1| Triticum urartu cultivar IG45218 FtsH-like protein gene, partial
           cds
          Length = 331

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 314 ccgcatgatcacgtccccgctctg 337
           ||||||||||||||||||||||||
Sbjct: 331 ccgcatgatcacgtccccgctctg 308



to top

>gb|AY639687.1| Triticum urartu cultivar IG45633 FtsH-like protein gene, partial
           cds
          Length = 334

 Score = 46.1 bits (23), Expect = 0.074
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 315 cgcatgatcacgtccccgctctg 337
           |||||||||||||||||||||||
Sbjct: 334 cgcatgatcacgtccccgctctg 312



to top

>gb|AC121144.11| Mus musculus chromosome 3, clone RP24-202D19, complete sequence
          Length = 161989

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 5     acaagagcagcaacaacaaaaa 26
             ||||||||||||||||||||||
Sbjct: 41632 acaagagcagcaacaacaaaaa 41611



to top

>gb|AY639661.1| Lophopyrum elongatum FtsH-like protein gene, partial cds
          Length = 337

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 312 atccgcatgatcacgtccccgctctg 337
           |||||||||||||| |||||||||||
Sbjct: 337 atccgcatgatcacatccccgctctg 312



to top

>emb|AL031289.1|HS739H11 Human DNA sequence from clone RP4-739H11 on chromosome 1p33-34.2 Contains
              the RIMS3 gene for regulating synaptic membrane exocytosis
              3, a general transcription factor IIF, polypeptide 2, 30kDa
              (GTF2F2) pseudogene, a novel gene and the 5' end of the
              NFYC gene for nuclear transcription factor Y, gamma,
              complete sequence
          Length = 129950

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 158    ctccttctccaggagcacctcc 179
              ||||||||||||||||||||||
Sbjct: 127047 ctccttctccaggagcacctcc 127068



to top

>dbj|AB236774.1| Trifolium pratense RNA for putative zinc dependent protease, complete
            cds, clone: C1597
          Length = 2290

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 156  gtctccttctccaggagcacctccacgatcttgtccatggcc 197
            |||||||||||||| || || ||||||||||| || ||||||
Sbjct: 1992 gtctccttctccagtaggacttccacgatcttatcgatggcc 1951



to top

>emb|AL354740.29| Human DNA sequence from clone RP11-513I15 on chromosome 6 Contains the 5'
              end of the GRM4 gene for glutamate receptor metabotropic 4,
              keratin 18 pseudogene 1 (KRT18P1), a cytochrome c, somatic
              (CYCS) pseudogene, the HMGA1 gene for high mobility group
              AT-hook 1, a ribosomal protein L35 (RPL35) pseudogene, part
              of a novel gene and CpG islands, complete sequence
          Length = 151828

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 15     caacaacaaaaaactttccaa 35
              |||||||||||||||||||||
Sbjct: 118862 caacaacaaaaaactttccaa 118882



to top

>emb|BX649413.8| Mouse DNA sequence from clone RP23-193P21 on chromosome 4 Contains the
             5' end of the Dbccr1 gene for deleted in bladder cancer 1,
             complete sequence
          Length = 186197

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 5     acaagagcagcaacaacaaaa 25
             |||||||||||||||||||||
Sbjct: 92768 acaagagcagcaacaacaaaa 92788



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 149     gctcagcgtctccttctccag 169
               |||||||||||||||||||||
Sbjct: 5692709 gctcagcgtctccttctccag 5692689



to top

>gb|AC009343.9| Drosophila melanogaster clone BACR08L17, complete sequence
          Length = 182492

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     acaagagcagcaacaacaaa 24
             ||||||||||||||||||||
Sbjct: 49803 acaagagcagcaacaacaaa 49784



to top

>gb|AC158803.11| Mus musculus 10 BAC RP24-186E11 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 168941

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 200   gcggttctccctcacctgct 219
             ||||||||||||||||||||
Sbjct: 88027 gcggttctccctcacctgct 88008



to top

>gb|AC122893.6| Mus musculus BAC clone RP23-67C3 from chromosome 17, complete sequence
          Length = 206456

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 5      acaagagcagcaacaacaaaaaac 28
              |||| |||||||||||||||||||
Sbjct: 123523 acaacagcagcaacaacaaaaaac 123546



to top

>ref|XM_454238.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E06413g predicted mRNA
          Length = 3486

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 5    acaagagcagcaacaacaaa 24
            ||||||||||||||||||||
Sbjct: 2205 acaagagcagcaacaacaaa 2224



to top

>gb|AC113095.14| Mus musculus chromosome 9, clone RP23-311A1, complete sequence
          Length = 205429

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 5      acaagagcagcaacaacaaaaaac 28
              ||||||||| ||||||||||||||
Sbjct: 163435 acaagagcaacaacaacaaaaaac 163458



to top

>ref|XM_390629.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG10453.1)
           partial mRNA
          Length = 645

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 282 agcttctccgacatggagttccgagcca 309
           ||||||||||||| ||| ||||||||||
Sbjct: 409 agcttctccgacacggatttccgagcca 436



to top

>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence
          Length = 166421

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   ccttctccaggagcacctcc 179
             ||||||||||||||||||||
Sbjct: 65745 ccttctccaggagcacctcc 65726



to top

>ref|XM_815304.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506459.270) partial mRNA
          Length = 3111

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 4    tacaagagcagcaacaacaa 23
            ||||||||||||||||||||
Sbjct: 2336 tacaagagcagcaacaacaa 2355



to top

>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   ccttctccaggagcacctcc 179
             ||||||||||||||||||||
Sbjct: 95869 ccttctccaggagcacctcc 95850



to top

>gb|AC124195.4| Mus musculus BAC clone RP23-285G17 from 16, complete sequence
          Length = 196102

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 5     acaagagcagcaacaacaaaaaac 28
             |||| |||||||||||||||||||
Sbjct: 73128 acaacagcagcaacaacaaaaaac 73151



to top

>gb|AC158340.9| Mus musculus chromosome 1, clone RP24-161N8, complete sequence
          Length = 163123

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     aagagcagcaacaacaaaaa 26
             ||||||||||||||||||||
Sbjct: 54031 aagagcagcaacaacaaaaa 54012



to top

>gb|AC102781.5| Mus musculus chromosome 1, clone RP23-271G2, complete sequence
          Length = 198393

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      aagagcagcaacaacaaaaa 26
              ||||||||||||||||||||
Sbjct: 195517 aagagcagcaacaacaaaaa 195536



to top

>gb|AC104323.27| Mus musculus strain C57BL/6J chromosome 17 clone rp23-114o8 map 17,
             complete sequence
          Length = 202430

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 5     acaagagcagcaacaacaaaaaac 28
             |||| |||||||||||||||||||
Sbjct: 56088 acaacagcagcaacaacaaaaaac 56111



to top

>gb|AY143411.1| Buellia elegans internal transcribed spacer 1, partial sequence;
           5.8S ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2; partial sequence
          Length = 514

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 9   gagcagcaacaacaaaaaactttc 32
           ||||||||||||| ||||||||||
Sbjct: 182 gagcagcaacaacgaaaaactttc 205



to top

>emb|AL354872.9| Human DNA sequence from clone RP11-42O15 on chromosome 1 Contains the
             CTH gene for cystathionase (cystathionine gamma-lyase) and
             a cysteine and histidine-rich domain (CHORD)-containing
             zinc binding protein 1 (CHORDC1) pseudogene, complete
             sequence
          Length = 151777

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     aagagcagcaacaacaaaaa 26
             ||||||||||||||||||||
Sbjct: 52534 aagagcagcaacaacaaaaa 52515



to top

>gb|AY129673.1| Kluyveromyces lactis protein kinase C (PKC1) gene, complete cds
          Length = 4301

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 5    acaagagcagcaacaacaaa 24
            ||||||||||||||||||||
Sbjct: 2811 acaagagcagcaacaacaaa 2830



to top

>gb|AC161410.3| Mus musculus chromosome 8, clone RP23-399J5, complete sequence
          Length = 196119

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 5     acaagagcagcaacaacaaaaaac 28
             |||| |||||||||||||||||||
Sbjct: 49815 acaacagcagcaacaacaaaaaac 49838



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2234072

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      acaagagcagcaacaacaaa 24
              ||||||||||||||||||||
Sbjct: 578950 acaagagcagcaacaacaaa 578931



to top

>emb|AL645913.12| Mouse DNA sequence from clone RP23-194G14 on chromosome 11 Contains the
             3' end of gene 9130006A14Rik, the 5' end of the Rnf130
             gene for ring finger protein 130 and a CpG island,
             complete sequence
          Length = 131007

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    agcagcaacaacaaaaaact 29
             ||||||||||||||||||||
Sbjct: 39136 agcagcaacaacaaaaaact 39155



to top

>emb|AL132963.1|ATT21J18 Arabidopsis thaliana DNA chromosome 3, BAC clone T21J18
          Length = 82912

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     agagcagcaacaacaaaaaa 27
             ||||||||||||||||||||
Sbjct: 56111 agagcagcaacaacaaaaaa 56092



to top

>emb|AL589722.17| Mouse DNA sequence from clone RP23-169M24 on chromosome 13 Contains the
             gene for a novel protein similar to ribosomal protein S8
             (Rps8) and a CpG island, complete sequence
          Length = 200125

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    cagcaacaacaaaaaacttt 31
             ||||||||||||||||||||
Sbjct: 50071 cagcaacaacaaaaaacttt 50090



to top

>gb|AC174824.3| Cavia porcellus clone CH234-33F4, complete sequence
          Length = 176892

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 5     acaagagcagcaacaacaaaaaac 28
             |||| |||||||||||||||||||
Sbjct: 43422 acaatagcagcaacaacaaaaaac 43445



to top

>gb|AC099340.3| Homo sapiens BAC clone RP11-214O14 from 4, complete sequence
          Length = 164958

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 15   caacaacaaaaaactttcca 34
            ||||||||||||||||||||
Sbjct: 2046 caacaacaaaaaactttcca 2027



to top

>dbj|AK046535.1| Mus musculus adult male adrenal gland cDNA, RIKEN full-length
            enriched library, clone:B330017C21
            product:phosphodiesterase 10A, full insert sequence
          Length = 3676

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 5    acaagagcagcaacaacaaaaaac 28
            |||| |||||||||||||||||||
Sbjct: 3650 acaacagcagcaacaacaaaaaac 3673



to top

>gb|AC175674.2| Gallus gallus BAC clone CH261-137E22 from chromosome ul, complete
              sequence
          Length = 216348

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 146    gccgctcagcgtctccttct 165
              ||||||||||||||||||||
Sbjct: 173609 gccgctcagcgtctccttct 173628



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 206      ctccctcacctgctgcagcg 225
                ||||||||||||||||||||
Sbjct: 20571688 ctccctcacctgctgcagcg 20571707



to top

>emb|AL844591.6| Mouse DNA sequence from clone RP23-414J11 on chromosome 2, complete
              sequence
          Length = 215003

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 10     agcagcaacaacaaaaaact 29
              ||||||||||||||||||||
Sbjct: 129973 agcagcaacaacaaaaaact 129954



to top

>gb|AC013406.7| Homo sapiens BAC clone RP11-341F20 from 2, complete sequence
          Length = 190018

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     caacaacaaaaaactttcca 34
              ||||||||||||||||||||
Sbjct: 166017 caacaacaaaaaactttcca 166036



to top

>dbj|AP005567.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1254_E07
          Length = 124028

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   ctccctcacctgctgcagcg 225
             ||||||||||||||||||||
Sbjct: 89335 ctccctcacctgctgcagcg 89354



to top

>dbj|AP005314.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0515E01
          Length = 140063

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   ctccctcacctgctgcagcg 225
             ||||||||||||||||||||
Sbjct: 37346 ctccctcacctgctgcagcg 37365



to top

>gb|AY542311.1| Sorghum bicolor clone SB20O07 b1-1, b1-2, putative genetic modifier,
             hypothetical protein, putative NAM protein, putative
             cis-zeatin O-glucosyltransferases, putative small nuclear
             ribonucleoprotein, putative cis-zeatin
             O-glucosyltransferase, putative glutathione peroxidase,
             putative copper-exporting ATPases, putative
             serine/threonine dehydratase, and putative actin
             depolymerizing factor genes, complete cds; and
             hypothetical protein gene, partial cds
          Length = 157237

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   ctcggtgaactcggacagga 129
             ||||||||||||||||||||
Sbjct: 96283 ctcggtgaactcggacagga 96264



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 110   ctcggtgaactcggacagga 129
             ||||||||||||||||||||
Sbjct: 69455 ctcggtgaactcggacagga 69436



to top

>gb|AY112063.1| Zea mays CL922_1 mRNA sequence
          Length = 860

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 gtccgacagctgcttcaccgccga 265
           |||||||||||||| |||||||||
Sbjct: 321 gtccgacagctgctccaccgccga 298



to top

>gb|AC153593.4| Mus musculus 6 BAC RP23-131B11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205164

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      aagagcagcaacaacaaaaa 26
              ||||||||||||||||||||
Sbjct: 190975 aagagcagcaacaacaaaaa 190956



to top

>gb|AC156506.4| Mus musculus 6 BAC RP24-266P6 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 164284

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      aagagcagcaacaacaaaaa 26
              ||||||||||||||||||||
Sbjct: 138294 aagagcagcaacaacaaaaa 138313



to top

>gb|AE003828.4| Drosophila melanogaster chromosome 2R, section 22 of 73 of the complete
             sequence
          Length = 257907

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     acaagagcagcaacaacaaa 24
             ||||||||||||||||||||
Sbjct: 41717 acaagagcagcaacaacaaa 41698



to top

>emb|BX294124.8| Mouse DNA sequence from clone RP23-80H12 on chromosome X, complete
             sequence
          Length = 181854

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     aagagcagcaacaacaaaaa 26
             ||||||||||||||||||||
Sbjct: 33622 aagagcagcaacaacaaaaa 33641



to top

>gb|AC154313.2| Mus musculus BAC clone RP23-354M21 from chromosome 12, complete
             sequence
          Length = 220909

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     aagagcagcaacaacaaaaa 26
             ||||||||||||||||||||
Sbjct: 62249 aagagcagcaacaacaaaaa 62268



to top

>gb|AC129214.5| Mus musculus BAC clone RP24-426N11 from 16, complete sequence
          Length = 191966

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     acaagagcagcaacaacaaa 24
             ||||||||||||||||||||
Sbjct: 98446 acaagagcagcaacaacaaa 98427



to top

>emb|AL672089.17| Mouse DNA sequence from clone RP23-295D9 on chromosome X, complete
             sequence
          Length = 215390

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     agagcagcaacaacaaaaaa 27
             ||||||||||||||||||||
Sbjct: 34331 agagcagcaacaacaaaaaa 34312



to top

>emb|AL806517.9| Mouse DNA sequence from clone RP23-20K17 on chromosome 4, complete
             sequence
          Length = 192432

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    agcagcaacaacaaaaaact 29
             ||||||||||||||||||||
Sbjct: 30644 agcagcaacaacaaaaaact 30625



to top

>emb|AL592450.8| Mouse DNA sequence from clone RP23-282N6 on chromosome 1, complete
             sequence
          Length = 132639

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    agcagcaacaacaaaaaact 29
             ||||||||||||||||||||
Sbjct: 24716 agcagcaacaacaaaaaact 24735


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,699,322
Number of Sequences: 3902068
Number of extensions: 2699322
Number of successful extensions: 89842
Number of sequences better than 10.0: 91
Number of HSP's better than 10.0 without gapping: 92
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89585
Number of HSP's gapped (non-prelim): 257
length of query: 344
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 322
effective length of database: 17,147,199,772
effective search space: 5521398326584
effective search space used: 5521398326584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top