ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd1p08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_550614.1| Oryza sativa (japonica cultivar-group), mRNA 426 e-116
2dbj|AK120319.1| Oryza sativa (japonica cultivar-group) cDNA clon... 426 e-116
3dbj|AK106717.1| Oryza sativa (japonica cultivar-group) cDNA clon... 426 e-116
4dbj|AK062184.1| Oryza sativa (japonica cultivar-group) cDNA clon... 426 e-116
5dbj|D12632.1|RIC40SSRPC Oryza sativa (japonica cultivar-group) m... 426 e-116
6ref|NM_195069.1| Oryza sativa (japonica cultivar-group) putative... 254 3e-64
7dbj|AK121628.1| Oryza sativa (japonica cultivar-group) cDNA clon... 254 3e-64
8dbj|D10402.1|RICT47 Oryza sativa mRNA for ribosomal protein S22 ... 218 1e-53
9gb|AY106535.1| Zea mays PCO060763 mRNA sequence 216 6e-53
10dbj|AK062522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 214 2e-52
11dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
12dbj|AB124892.1| Oryza punctata EPSPs, rps20 genes for 5-enolpyru... 206 6e-50
13dbj|AB124889.1| Oryza meridionalis EPSPs, rps20 genes for 5-enol... 206 6e-50
14dbj|AB124884.1| Oryza rufipogon EPSPs, rps20 genes for 5-enolpyr... 206 6e-50
15dbj|AB124883.1| Oryza sativa (indica cultivar-group) EPSPs, rps2... 206 6e-50
16dbj|AB124882.1| Oryza sativa (japonica cultivar-group) EPSPs, rp... 206 6e-50
17dbj|AB124881.1| Oryza sativa (japonica cultivar-group) EPSPs, rp... 206 6e-50
18dbj|AP004234.3| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
19dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
20emb|AJ417525.1|OSA417525 Oryza sativa partial mRNA for putative ... 206 6e-50
21dbj|AB052962.1| Oryza sativa EPSPs, rps20 genes for 3-phosphoshi... 206 6e-50
22dbj|AB124893.1| Oryza officinalis EPSPs, rps20 genes for 5-enolp... 198 1e-47
23dbj|AB124891.1| Oryza longistaminata EPSPs, rps20 genes for 5-en... 198 1e-47
24dbj|AB124890.1| Oryza longistaminata EPSPs, rps20 genes for 5-en... 198 1e-47
25dbj|AB124888.1| Oryza glumipatula EPSPs, rps20 genes for 5-enolp... 198 1e-47
26dbj|AB124887.1| Oryza barthii EPSPs, rps20 genes for 5-enolpyruv... 198 1e-47
27dbj|AB124886.1| Oryza glaberrima EPSPs, rps20 genes for 5-enolpy... 198 1e-47
28dbj|AB124885.1| Oryza rufipogon EPSPs, rps20 genes for 5-enolpyr... 198 1e-47
29gb|AY104760.1| Zea mays PCO060764 mRNA sequence 188 1e-44
30gb|AY758353.1| Zea mays ribosomal protein S10p/S20e mRNA, comple... 180 3e-42
31gb|AY310806.1| Nicotiana benthamiana clone 12-105 unknown mRNA 125 2e-25
32gb|AC074355.6| Oryza sativa (japonica cultivar-group) chromosome... 105 2e-19
33dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
34gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 105 2e-19
35gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 92 2e-15
36dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 92 2e-15
37gb|AC134235.2| Oryza sativa (japonica cultivar-group) chromosome... 92 2e-15
38gb|M95062.1|MZEORFC Zea mays putative ribosomal protein S22 homo... 86 1e-13
39ref|NM_180334.1| Arabidopsis thaliana structural constituent of ... 84 6e-13
40ref|NM_114605.1| Arabidopsis thaliana structural constituent of ... 84 6e-13
41ref|NM_001035749.1| Arabidopsis thaliana structural constituent ... 84 6e-13
42gb|AY088633.1| Arabidopsis thaliana clone 8700 mRNA, complete se... 84 6e-13
43gb|BT003067.1| Arabidopsis thaliana At3g47370 gene, complete cds 84 6e-13
44ref|NM_114372.3| Arabidopsis thaliana structural constituent of ... 82 2e-12
45gb|AC144805.9| Medicago truncatula clone mth2-72a11, complete se... 82 2e-12
46gb|AY114024.1| Arabidopsis thaliana putative 40S ribsomomal prot... 82 2e-12
47gb|AY096646.1| Arabidopsis thaliana putative 40S ribsomomal prot... 82 2e-12
48emb|AL096860.1|ATT21L8 Arabidopsis thaliana DNA chromosome 3, BA... 80 9e-12
49gb|AC157891.3| Medicago truncatula chromosome 7 BAC clone mte1-1... 80 9e-12
50ref|XM_776941.1| PREDICTED: Strongylocentrotus purpuratus simila... 78 3e-11
51emb|AL353992.1|ATF14D17 Arabidopsis thaliana DNA chromosome 3, B... 74 5e-10
52gb|AY826138.1| Aedes albopictus clone AL_140 40S ribosomal prote... 70 8e-09
53emb|CR696597.2|CNS0G0G1 Tetraodon nigroviridis full-length cDNA 70 8e-09
54emb|CR691724.2|CNS0FWOO Tetraodon nigroviridis full-length cDNA 70 8e-09
55emb|CR643468.2|CNS0EVGY Tetraodon nigroviridis full-length cDNA 70 8e-09
56emb|CR639079.2|CNS0ES31 Tetraodon nigroviridis full-length cDNA 70 8e-09
57emb|AJ312336.1|OMY312336 Oncorhynchus mykiss partial mRNA for pu... 70 8e-09
58ref|NM_125624.2| Arabidopsis thaliana structural constituent of ... 68 3e-08
59ref|XM_968376.1| PREDICTED: Tribolium castaneum similar to CG156... 68 3e-08
60gb|BT000382.1| Arabidopsis thaliana 40S ribosomal protein S20 (A... 68 3e-08
61gb|AF325017.2|AF325017 Arabidopsis thaliana AT5g62300 (AT5g62300... 68 3e-08
62gb|AF370460.1|AF370460 Arabidopsis thaliana 40S ribosomal protei... 68 3e-08
63gb|AY085673.1| Arabidopsis thaliana clone 16926 mRNA, complete s... 68 3e-08
64ref|XM_954146.1| Neurospora crassa OR74A hypothetical protein (N... 66 1e-07
65ref|XM_327177.1| Neurospora crassa OR74A hypothetical protein (N... 66 1e-07
66emb|CR734985.2|CNS0GTW8 Tetraodon nigroviridis full-length cDNA 62 2e-06
67emb|CR734923.2|CNS0GTUI Tetraodon nigroviridis full-length cDNA 62 2e-06
68emb|CR734916.2|CNS0GTUB Tetraodon nigroviridis full-length cDNA 62 2e-06
69emb|CR734480.2|CNS0GTI7 Tetraodon nigroviridis full-length cDNA 62 2e-06
70emb|CR734398.2|CNS0GTFX Tetraodon nigroviridis full-length cDNA 62 2e-06
71emb|CR734036.2|CNS0GT5V Tetraodon nigroviridis full-length cDNA 62 2e-06
72emb|CR734019.2|CNS0GT5E Tetraodon nigroviridis full-length cDNA 62 2e-06
73emb|CR733996.2|CNS0GT4R Tetraodon nigroviridis full-length cDNA 62 2e-06
74emb|CR733749.2|CNS0GSXW Tetraodon nigroviridis full-length cDNA 62 2e-06
75emb|CR732672.2|CNS0GS9X Tetraodon nigroviridis full-length cDNA 62 2e-06
76emb|CR712324.2|CNS0GCKW Tetraodon nigroviridis full-length cDNA 62 2e-06
77emb|CR711720.2|CNS0GC44 Tetraodon nigroviridis full-length cDNA 62 2e-06
78emb|CR724810.2|CNS0GM7K Tetraodon nigroviridis full-length cDNA 62 2e-06
79emb|CR721461.2|CNS0GJMJ Tetraodon nigroviridis full-length cDNA 62 2e-06
80emb|CR721261.2|CNS0GJGZ Tetraodon nigroviridis full-length cDNA 62 2e-06
81emb|CR721152.2|CNS0GJDY Tetraodon nigroviridis full-length cDNA 62 2e-06
82emb|CR720850.2|CNS0GJ5K Tetraodon nigroviridis full-length cDNA 62 2e-06
83emb|CR719936.2|CNS0GIG6 Tetraodon nigroviridis full-length cDNA 62 2e-06
84emb|CR719195.2|CNS0GHVL Tetraodon nigroviridis full-length cDNA 62 2e-06
85emb|CR719155.2|CNS0GHUH Tetraodon nigroviridis full-length cDNA 62 2e-06
86emb|CR718908.2|CNS0GHNM Tetraodon nigroviridis full-length cDNA 62 2e-06
87emb|CR718540.2|CNS0GHDE Tetraodon nigroviridis full-length cDNA 62 2e-06
88emb|CR718516.2|CNS0GHCQ Tetraodon nigroviridis full-length cDNA 62 2e-06
89emb|CR718464.2|CNS0GHBA Tetraodon nigroviridis full-length cDNA 62 2e-06
90emb|CR718172.2|CNS0GH36 Tetraodon nigroviridis full-length cDNA 62 2e-06
91emb|CR718131.2|CNS0GH21 Tetraodon nigroviridis full-length cDNA 62 2e-06
92emb|CR718037.2|CNS0GGZF Tetraodon nigroviridis full-length cDNA 62 2e-06
93emb|CR717406.2|CNS0GGHW Tetraodon nigroviridis full-length cDNA 62 2e-06
94emb|CR717154.2|CNS0GGAZ Tetraodon nigroviridis full-length cDNA 62 2e-06
95emb|CR717127.2|CNS0GGA8 Tetraodon nigroviridis full-length cDNA 62 2e-06
96emb|CR716551.2|CNS0GFU8 Tetraodon nigroviridis full-length cDNA 62 2e-06
97emb|CR716346.2|CNS0GFOJ Tetraodon nigroviridis full-length cDNA 62 2e-06
98emb|CR716267.2|CNS0GFMC Tetraodon nigroviridis full-length cDNA 62 2e-06
99emb|CR716217.2|CNS0GFKY Tetraodon nigroviridis full-length cDNA 62 2e-06
100emb|CR716191.2|CNS0GFK8 Tetraodon nigroviridis full-length cDNA 62 2e-06
101emb|CR715963.2|CNS0GFDZ Tetraodon nigroviridis full-length cDNA 62 2e-06
102emb|CR715795.2|CNS0GF9B Tetraodon nigroviridis full-length cDNA 62 2e-06
103emb|CR715714.2|CNS0GF72 Tetraodon nigroviridis full-length cDNA 62 2e-06
104emb|CR715674.2|CNS0GF5Y Tetraodon nigroviridis full-length cDNA 62 2e-06
105emb|CR715611.2|CNS0GF47 Tetraodon nigroviridis full-length cDNA 62 2e-06
106emb|CR715336.2|CNS0GEWK Tetraodon nigroviridis full-length cDNA 62 2e-06
107emb|CR715001.2|CNS0GEN9 Tetraodon nigroviridis full-length cDNA 62 2e-06
108emb|CR714583.2|CNS0GEBN Tetraodon nigroviridis full-length cDNA 62 2e-06
109emb|CR714404.2|CNS0GE6O Tetraodon nigroviridis full-length cDNA 62 2e-06
110emb|CR714337.2|CNS0GE4T Tetraodon nigroviridis full-length cDNA 62 2e-06
111emb|CR714272.2|CNS0GE30 Tetraodon nigroviridis full-length cDNA 62 2e-06
112emb|CR714257.2|CNS0GE2L Tetraodon nigroviridis full-length cDNA 62 2e-06
113emb|CR713840.2|CNS0GDR0 Tetraodon nigroviridis full-length cDNA 62 2e-06
114emb|CR713771.2|CNS0GDP3 Tetraodon nigroviridis full-length cDNA 62 2e-06
115emb|CR713597.2|CNS0GDK9 Tetraodon nigroviridis full-length cDNA 62 2e-06
116emb|CR712819.2|CNS0GCYN Tetraodon nigroviridis full-length cDNA 62 2e-06
117emb|CR712806.2|CNS0GCYA Tetraodon nigroviridis full-length cDNA 62 2e-06
118emb|CR713255.2|CNS0GDAR Tetraodon nigroviridis full-length cDNA 62 2e-06
119emb|CR713181.2|CNS0GD8P Tetraodon nigroviridis full-length cDNA 62 2e-06
120emb|CR713175.2|CNS0GD8J Tetraodon nigroviridis full-length cDNA 62 2e-06
121emb|CR712632.2|CNS0GCTG Tetraodon nigroviridis full-length cDNA 62 2e-06
122emb|CR712139.2|CNS0GCFR Tetraodon nigroviridis full-length cDNA 62 2e-06
123emb|CR710802.2|CNS0GBEM Tetraodon nigroviridis full-length cDNA 62 2e-06
124emb|CR710639.2|CNS0GBA3 Tetraodon nigroviridis full-length cDNA 62 2e-06
125emb|CR710416.2|CNS0GB3W Tetraodon nigroviridis full-length cDNA 62 2e-06
126emb|CR710033.2|CNS0GAT9 Tetraodon nigroviridis full-length cDNA 62 2e-06
127emb|CR710027.2|CNS0GAT3 Tetraodon nigroviridis full-length cDNA 62 2e-06
128emb|CR709898.2|CNS0GAPI Tetraodon nigroviridis full-length cDNA 62 2e-06
129emb|CR709869.2|CNS0GAOP Tetraodon nigroviridis full-length cDNA 62 2e-06
130emb|CR709412.2|CNS0GAC0 Tetraodon nigroviridis full-length cDNA 62 2e-06
131emb|CR709314.2|CNS0GA9A Tetraodon nigroviridis full-length cDNA 62 2e-06
132emb|CR709295.2|CNS0GA8R Tetraodon nigroviridis full-length cDNA 62 2e-06
133emb|CR709499.2|CNS0GAEF Tetraodon nigroviridis full-length cDNA 62 2e-06
134emb|CR709495.2|CNS0GAEB Tetraodon nigroviridis full-length cDNA 62 2e-06
135emb|CR709450.2|CNS0GAD2 Tetraodon nigroviridis full-length cDNA 62 2e-06
136emb|CR709120.2|CNS0GA3W Tetraodon nigroviridis full-length cDNA 62 2e-06
137emb|CR708631.2|CNS0G9QB Tetraodon nigroviridis full-length cDNA 62 2e-06
138emb|CR708538.2|CNS0G9NQ Tetraodon nigroviridis full-length cDNA 62 2e-06
139emb|CR708410.2|CNS0G9K6 Tetraodon nigroviridis full-length cDNA 62 2e-06
140emb|CR708379.2|CNS0G9JB Tetraodon nigroviridis full-length cDNA 62 2e-06
141emb|CR708321.2|CNS0G9HP Tetraodon nigroviridis full-length cDNA 62 2e-06
142emb|CR708171.2|CNS0G9DJ Tetraodon nigroviridis full-length cDNA 62 2e-06
143emb|CR708123.2|CNS0G9C7 Tetraodon nigroviridis full-length cDNA 62 2e-06
144emb|CR708012.2|CNS0G994 Tetraodon nigroviridis full-length cDNA 62 2e-06
145emb|CR708008.2|CNS0G990 Tetraodon nigroviridis full-length cDNA 62 2e-06
146emb|CR707910.2|CNS0G96A Tetraodon nigroviridis full-length cDNA 62 2e-06
147emb|CR707834.2|CNS0G946 Tetraodon nigroviridis full-length cDNA 62 2e-06
148emb|CR707808.2|CNS0G93G Tetraodon nigroviridis full-length cDNA 62 2e-06
149emb|CR707754.2|CNS0G91Y Tetraodon nigroviridis full-length cDNA 62 2e-06
150emb|CR707592.2|CNS0G8XG Tetraodon nigroviridis full-length cDNA 62 2e-06
151emb|CR707579.2|CNS0G8X3 Tetraodon nigroviridis full-length cDNA 62 2e-06
152emb|CR707501.2|CNS0G8UX Tetraodon nigroviridis full-length cDNA 62 2e-06
153emb|CR707040.2|CNS0G8I4 Tetraodon nigroviridis full-length cDNA 62 2e-06
154emb|CR707031.2|CNS0G8HV Tetraodon nigroviridis full-length cDNA 62 2e-06
155emb|CR706992.2|CNS0G8GS Tetraodon nigroviridis full-length cDNA 62 2e-06
156emb|CR706858.2|CNS0G8D2 Tetraodon nigroviridis full-length cDNA 62 2e-06
157emb|CR706689.2|CNS0G88D Tetraodon nigroviridis full-length cDNA 62 2e-06
158emb|CR706588.2|CNS0G85K Tetraodon nigroviridis full-length cDNA 62 2e-06
159emb|CR705833.2|CNS0G7KL Tetraodon nigroviridis full-length cDNA 62 2e-06
160emb|CR705619.2|CNS0G7EN Tetraodon nigroviridis full-length cDNA 62 2e-06
161emb|CR705466.2|CNS0G7AE Tetraodon nigroviridis full-length cDNA 62 2e-06
162emb|CR705260.2|CNS0G74O Tetraodon nigroviridis full-length cDNA 62 2e-06
163emb|CR705163.2|CNS0G71Z Tetraodon nigroviridis full-length cDNA 62 2e-06
164emb|CR704309.2|CNS0G6E9 Tetraodon nigroviridis full-length cDNA 62 2e-06
165emb|CR703983.2|CNS0G657 Tetraodon nigroviridis full-length cDNA 62 2e-06
166emb|CR703602.2|CNS0G5UM Tetraodon nigroviridis full-length cDNA 62 2e-06
167emb|CR703006.2|CNS0G5E2 Tetraodon nigroviridis full-length cDNA 62 2e-06
168emb|CR702686.2|CNS0G556 Tetraodon nigroviridis full-length cDNA 62 2e-06
169emb|CR702627.2|CNS0G53J Tetraodon nigroviridis full-length cDNA 62 2e-06
170emb|CR701679.2|CNS0G4D7 Tetraodon nigroviridis full-length cDNA 62 2e-06
171emb|CR701426.2|CNS0G466 Tetraodon nigroviridis full-length cDNA 62 2e-06
172emb|CR701135.2|CNS0G3Y3 Tetraodon nigroviridis full-length cDNA 62 2e-06
173emb|CR700712.2|CNS0G3MC Tetraodon nigroviridis full-length cDNA 62 2e-06
174emb|CR700557.2|CNS0G3I1 Tetraodon nigroviridis full-length cDNA 62 2e-06
175emb|CR700518.2|CNS0G3GY Tetraodon nigroviridis full-length cDNA 62 2e-06
176emb|CR699589.2|CNS0G2R5 Tetraodon nigroviridis full-length cDNA 62 2e-06
177emb|CR699449.2|CNS0G2N9 Tetraodon nigroviridis full-length cDNA 62 2e-06
178emb|CR699079.2|CNS0G2CZ Tetraodon nigroviridis full-length cDNA 62 2e-06
179emb|CR698748.2|CNS0G23S Tetraodon nigroviridis full-length cDNA 62 2e-06
180emb|CR698720.2|CNS0G230 Tetraodon nigroviridis full-length cDNA 62 2e-06
181emb|CR698421.2|CNS0G1UP Tetraodon nigroviridis full-length cDNA 62 2e-06
182emb|CR697786.2|CNS0G1D2 Tetraodon nigroviridis full-length cDNA 62 2e-06
183emb|CR697270.2|CNS0G0YQ Tetraodon nigroviridis full-length cDNA 62 2e-06
184emb|CR697262.2|CNS0G0YI Tetraodon nigroviridis full-length cDNA 62 2e-06
185emb|CR696193.2|CNS0G04T Tetraodon nigroviridis full-length cDNA 62 2e-06
186emb|CR695640.2|CNS0FZPG Tetraodon nigroviridis full-length cDNA 62 2e-06
187emb|CR695493.2|CNS0FZLD Tetraodon nigroviridis full-length cDNA 62 2e-06
188emb|CR695463.2|CNS0FZKJ Tetraodon nigroviridis full-length cDNA 62 2e-06
189emb|CR695015.2|CNS0FZ83 Tetraodon nigroviridis full-length cDNA 62 2e-06
190emb|CR694872.2|CNS0FZ44 Tetraodon nigroviridis full-length cDNA 62 2e-06
191emb|CR694861.2|CNS0FZ3T Tetraodon nigroviridis full-length cDNA 62 2e-06
192emb|CR694479.2|CNS0FYT7 Tetraodon nigroviridis full-length cDNA 62 2e-06
193emb|CR694108.2|CNS0FYIW Tetraodon nigroviridis full-length cDNA 62 2e-06
194emb|CR694015.2|CNS0FYGB Tetraodon nigroviridis full-length cDNA 62 2e-06
195emb|CR693929.2|CNS0FYDX Tetraodon nigroviridis full-length cDNA 62 2e-06
196emb|CR693035.2|CNS0FXP3 Tetraodon nigroviridis full-length cDNA 62 2e-06
197emb|CR691940.2|CNS0FWUO Tetraodon nigroviridis full-length cDNA 62 2e-06
198emb|CR691809.2|CNS0FWR1 Tetraodon nigroviridis full-length cDNA 62 2e-06
199emb|CR691794.2|CNS0FWQM Tetraodon nigroviridis full-length cDNA 62 2e-06
200emb|CR691075.2|CNS0FW6N Tetraodon nigroviridis full-length cDNA 62 2e-06
201emb|CR691044.2|CNS0FW5S Tetraodon nigroviridis full-length cDNA 62 2e-06
202emb|CR691010.2|CNS0FW4U Tetraodon nigroviridis full-length cDNA 62 2e-06
203emb|CR685887.2|CNS0FS6J Tetraodon nigroviridis full-length cDNA 62 2e-06
204emb|CR690503.2|CNS0FVQR Tetraodon nigroviridis full-length cDNA 62 2e-06
205emb|CR688491.2|CNS0FU6V Tetraodon nigroviridis full-length cDNA 62 2e-06
206emb|CR688438.2|CNS0FU5E Tetraodon nigroviridis full-length cDNA 62 2e-06
207emb|CR689843.2|CNS0FV8F Tetraodon nigroviridis full-length cDNA 62 2e-06
208emb|CR688641.2|CNS0FUB1 Tetraodon nigroviridis full-length cDNA 62 2e-06
209emb|CR688563.2|CNS0FU8V Tetraodon nigroviridis full-length cDNA 62 2e-06
210emb|CR688548.2|CNS0FU8G Tetraodon nigroviridis full-length cDNA 62 2e-06
211emb|CR688536.2|CNS0FU84 Tetraodon nigroviridis full-length cDNA 62 2e-06
212emb|CR688163.2|CNS0FTXR Tetraodon nigroviridis full-length cDNA 62 2e-06
213emb|CR687772.2|CNS0FTMW Tetraodon nigroviridis full-length cDNA 62 2e-06
214emb|CR687758.2|CNS0FTMI Tetraodon nigroviridis full-length cDNA 62 2e-06
215emb|CR686961.2|CNS0FT0D Tetraodon nigroviridis full-length cDNA 62 2e-06
216emb|CR686931.2|CNS0FSZJ Tetraodon nigroviridis full-length cDNA 62 2e-06
217emb|CR686539.2|CNS0FSON Tetraodon nigroviridis full-length cDNA 62 2e-06
218emb|CR686507.2|CNS0FSNR Tetraodon nigroviridis full-length cDNA 62 2e-06
219emb|CR686353.2|CNS0FSJH Tetraodon nigroviridis full-length cDNA 62 2e-06
220emb|CR686159.2|CNS0FSE3 Tetraodon nigroviridis full-length cDNA 62 2e-06
221emb|CR685723.2|CNS0FS1Z Tetraodon nigroviridis full-length cDNA 62 2e-06
222emb|CR685330.2|CNS0FRR2 Tetraodon nigroviridis full-length cDNA 62 2e-06
223emb|CR685244.2|CNS0FROO Tetraodon nigroviridis full-length cDNA 62 2e-06
224emb|CR681903.2|CNS0FP3V Tetraodon nigroviridis full-length cDNA 62 2e-06
225emb|CR681885.2|CNS0FP3D Tetraodon nigroviridis full-length cDNA 62 2e-06
226emb|CR683945.2|CNS0FQOL Tetraodon nigroviridis full-length cDNA 62 2e-06
227emb|CR683745.2|CNS0FQJ1 Tetraodon nigroviridis full-length cDNA 62 2e-06
228emb|CR683522.2|CNS0FQCU Tetraodon nigroviridis full-length cDNA 62 2e-06
229emb|CR683015.2|CNS0FPYR Tetraodon nigroviridis full-length cDNA 62 2e-06
230emb|CR682721.2|CNS0FPQL Tetraodon nigroviridis full-length cDNA 62 2e-06
231emb|CR681830.2|CNS0FP1U Tetraodon nigroviridis full-length cDNA 62 2e-06
232emb|CR681632.2|CNS0FOWC Tetraodon nigroviridis full-length cDNA 62 2e-06
233emb|CR680781.2|CNS0FO8P Tetraodon nigroviridis full-length cDNA 62 2e-06
234emb|CR679799.2|CNS0FNHF Tetraodon nigroviridis full-length cDNA 62 2e-06
235emb|CR678834.2|CNS0FMQM Tetraodon nigroviridis full-length cDNA 62 2e-06
236emb|CR678707.2|CNS0FMN3 Tetraodon nigroviridis full-length cDNA 62 2e-06
237emb|CR676461.2|CNS0FKX5 Tetraodon nigroviridis full-length cDNA 62 2e-06
238emb|CR675972.2|CNS0FKJU Tetraodon nigroviridis full-length cDNA 62 2e-06
239emb|CR674657.2|CNS0FJJB Tetraodon nigroviridis full-length cDNA 62 2e-06
240emb|CR671739.2|CNS0FHA9 Tetraodon nigroviridis full-length cDNA 62 2e-06
241emb|CR669071.2|CNS0FF85 Tetraodon nigroviridis full-length cDNA 62 2e-06
242emb|CR669052.2|CNS0FF7M Tetraodon nigroviridis full-length cDNA 62 2e-06
243emb|CR668178.2|CNS0FEJC Tetraodon nigroviridis full-length cDNA 62 2e-06
244emb|CR667682.2|CNS0FE5K Tetraodon nigroviridis full-length cDNA 62 2e-06
245emb|CR666786.2|CNS0FDGO Tetraodon nigroviridis full-length cDNA 62 2e-06
246emb|CR666686.2|CNS0FDDW Tetraodon nigroviridis full-length cDNA 62 2e-06
247emb|CR666050.2|CNS0FCW8 Tetraodon nigroviridis full-length cDNA 62 2e-06
248emb|CR665272.2|CNS0FCAM Tetraodon nigroviridis full-length cDNA 62 2e-06
249emb|CR664210.2|CNS0FBH4 Tetraodon nigroviridis full-length cDNA 62 2e-06
250emb|CR663451.2|CNS0FAW1 Tetraodon nigroviridis full-length cDNA 62 2e-06
251emb|CR663412.2|CNS0FAUY Tetraodon nigroviridis full-length cDNA 62 2e-06
252emb|CR663300.2|CNS0FARU Tetraodon nigroviridis full-length cDNA 62 2e-06
253emb|CR663226.2|CNS0FAPS Tetraodon nigroviridis full-length cDNA 62 2e-06
254emb|CR662446.2|CNS0FA44 Tetraodon nigroviridis full-length cDNA 62 2e-06
255emb|CR660304.2|CNS0F8GM Tetraodon nigroviridis full-length cDNA 62 2e-06
256emb|CR659888.2|CNS0F852 Tetraodon nigroviridis full-length cDNA 62 2e-06
257emb|CR659286.2|CNS0F7OC Tetraodon nigroviridis full-length cDNA 62 2e-06
258emb|CR657636.2|CNS0F6EI Tetraodon nigroviridis full-length cDNA 62 2e-06
259emb|CR657607.2|CNS0F6DP Tetraodon nigroviridis full-length cDNA 62 2e-06
260emb|CR656770.2|CNS0F5QG Tetraodon nigroviridis full-length cDNA 62 2e-06
261emb|CR656752.2|CNS0F5PY Tetraodon nigroviridis full-length cDNA 62 2e-06
262emb|CR656634.2|CNS0F5MO Tetraodon nigroviridis full-length cDNA 62 2e-06
263emb|CR655307.2|CNS0F4LT Tetraodon nigroviridis full-length cDNA 62 2e-06
264emb|CR655244.2|CNS0F4K2 Tetraodon nigroviridis full-length cDNA 62 2e-06
265emb|CR656289.2|CNS0F5D3 Tetraodon nigroviridis full-length cDNA 62 2e-06
266emb|CR655866.2|CNS0F51C Tetraodon nigroviridis full-length cDNA 62 2e-06
267emb|CR655446.2|CNS0F4PO Tetraodon nigroviridis full-length cDNA 62 2e-06
268emb|CR655424.2|CNS0F4P2 Tetraodon nigroviridis full-length cDNA 62 2e-06
269emb|CR655100.2|CNS0F4G2 Tetraodon nigroviridis full-length cDNA 62 2e-06
270emb|CR655066.2|CNS0F4F4 Tetraodon nigroviridis full-length cDNA 62 2e-06
271emb|CR653291.2|CNS0F31T Tetraodon nigroviridis full-length cDNA 62 2e-06
272emb|CR653254.2|CNS0F30S Tetraodon nigroviridis full-length cDNA 62 2e-06
273emb|CR653214.2|CNS0F2ZO Tetraodon nigroviridis full-length cDNA 62 2e-06
274emb|CR654918.2|CNS0F4B0 Tetraodon nigroviridis full-length cDNA 62 2e-06
275emb|CR654789.2|CNS0F47F Tetraodon nigroviridis full-length cDNA 62 2e-06
276emb|CR654597.2|CNS0F423 Tetraodon nigroviridis full-length cDNA 62 2e-06
277emb|CR654408.2|CNS0F3WU Tetraodon nigroviridis full-length cDNA 62 2e-06
278emb|CR654401.2|CNS0F3WN Tetraodon nigroviridis full-length cDNA 62 2e-06
279emb|CR654347.2|CNS0F3V5 Tetraodon nigroviridis full-length cDNA 62 2e-06
280emb|CR653772.2|CNS0F3F6 Tetraodon nigroviridis full-length cDNA 62 2e-06
281emb|CR653615.2|CNS0F3AT Tetraodon nigroviridis full-length cDNA 62 2e-06
282emb|CR653372.2|CNS0F342 Tetraodon nigroviridis full-length cDNA 62 2e-06
283emb|CR652996.2|CNS0F2TM Tetraodon nigroviridis full-length cDNA 62 2e-06
284emb|CR652942.2|CNS0F2S4 Tetraodon nigroviridis full-length cDNA 62 2e-06
285emb|CR652940.2|CNS0F2S2 Tetraodon nigroviridis full-length cDNA 62 2e-06
286emb|CR652936.2|CNS0F2RY Tetraodon nigroviridis full-length cDNA 62 2e-06
287emb|CR652389.2|CNS0F2CR Tetraodon nigroviridis full-length cDNA 62 2e-06
288emb|CR652852.2|CNS0F2PM Tetraodon nigroviridis full-length cDNA 62 2e-06
289emb|CR652177.2|CNS0F26V Tetraodon nigroviridis full-length cDNA 62 2e-06
290emb|CR652117.2|CNS0F257 Tetraodon nigroviridis full-length cDNA 62 2e-06
291emb|CR652582.2|CNS0F2I4 Tetraodon nigroviridis full-length cDNA 62 2e-06
292emb|CR652537.2|CNS0F2GV Tetraodon nigroviridis full-length cDNA 62 2e-06
293emb|CR652068.2|CNS0F23U Tetraodon nigroviridis full-length cDNA 62 2e-06
294emb|CR652023.2|CNS0F22L Tetraodon nigroviridis full-length cDNA 62 2e-06
295emb|CR651842.2|CNS0F1XK Tetraodon nigroviridis full-length cDNA 62 2e-06
296emb|CR651532.2|CNS0F1OY Tetraodon nigroviridis full-length cDNA 62 2e-06
297emb|CR651507.2|CNS0F1O9 Tetraodon nigroviridis full-length cDNA 62 2e-06
298emb|CR651466.2|CNS0F1N4 Tetraodon nigroviridis full-length cDNA 62 2e-06
299emb|CR651455.2|CNS0F1MT Tetraodon nigroviridis full-length cDNA 62 2e-06
300emb|CR651436.2|CNS0F1MA Tetraodon nigroviridis full-length cDNA 62 2e-06
301emb|CR650833.2|CNS0F15J Tetraodon nigroviridis full-length cDNA 62 2e-06
302emb|CR650717.2|CNS0F12B Tetraodon nigroviridis full-length cDNA 62 2e-06
303emb|CR650713.2|CNS0F127 Tetraodon nigroviridis full-length cDNA 62 2e-06
304emb|CR651076.2|CNS0F1CA Tetraodon nigroviridis full-length cDNA 62 2e-06
305emb|CR650925.2|CNS0F183 Tetraodon nigroviridis full-length cDNA 62 2e-06
306emb|CR650908.2|CNS0F17M Tetraodon nigroviridis full-length cDNA 62 2e-06
307emb|CR650881.2|CNS0F16V Tetraodon nigroviridis full-length cDNA 62 2e-06
308emb|CR650543.2|CNS0F0XH Tetraodon nigroviridis full-length cDNA 62 2e-06
309emb|CR650033.2|CNS0F0JB Tetraodon nigroviridis full-length cDNA 62 2e-06
310emb|CR649984.2|CNS0F0HY Tetraodon nigroviridis full-length cDNA 62 2e-06
311emb|CR649926.2|CNS0F0GC Tetraodon nigroviridis full-length cDNA 62 2e-06
312emb|CR650132.2|CNS0F0M2 Tetraodon nigroviridis full-length cDNA 62 2e-06
313emb|CR650127.2|CNS0F0LX Tetraodon nigroviridis full-length cDNA 62 2e-06
314emb|CR650098.2|CNS0F0L4 Tetraodon nigroviridis full-length cDNA 62 2e-06
315emb|CR649822.2|CNS0F0DG Tetraodon nigroviridis full-length cDNA 62 2e-06
316emb|CR649573.2|CNS0F06J Tetraodon nigroviridis full-length cDNA 62 2e-06
317emb|CR649420.2|CNS0F02A Tetraodon nigroviridis full-length cDNA 62 2e-06
318emb|CR649417.2|CNS0F027 Tetraodon nigroviridis full-length cDNA 62 2e-06
319emb|CR649336.2|CNS0EZZY Tetraodon nigroviridis full-length cDNA 62 2e-06
320emb|CR649253.2|CNS0EZXN Tetraodon nigroviridis full-length cDNA 62 2e-06
321emb|CR649214.2|CNS0EZWK Tetraodon nigroviridis full-length cDNA 62 2e-06
322emb|CR649061.2|CNS0EZSB Tetraodon nigroviridis full-length cDNA 62 2e-06
323emb|CR649046.2|CNS0EZRW Tetraodon nigroviridis full-length cDNA 62 2e-06
324emb|CR649002.2|CNS0EZQO Tetraodon nigroviridis full-length cDNA 62 2e-06
325emb|CR648985.2|CNS0EZQ7 Tetraodon nigroviridis full-length cDNA 62 2e-06
326emb|CR648402.2|CNS0EZA0 Tetraodon nigroviridis full-length cDNA 62 2e-06
327emb|CR648291.2|CNS0EZ6X Tetraodon nigroviridis full-length cDNA 62 2e-06
328emb|CR647016.2|CNS0EY7I Tetraodon nigroviridis full-length cDNA 62 2e-06
329emb|CR647927.2|CNS0EYWT Tetraodon nigroviridis full-length cDNA 62 2e-06
330emb|CR647823.2|CNS0EYTX Tetraodon nigroviridis full-length cDNA 62 2e-06
331emb|CR647784.2|CNS0EYSU Tetraodon nigroviridis full-length cDNA 62 2e-06
332emb|CR647745.2|CNS0EYRR Tetraodon nigroviridis full-length cDNA 62 2e-06
333emb|CR647639.2|CNS0EYOT Tetraodon nigroviridis full-length cDNA 62 2e-06
334emb|CR647617.2|CNS0EYO7 Tetraodon nigroviridis full-length cDNA 62 2e-06
335emb|CR647584.2|CNS0EYNA Tetraodon nigroviridis full-length cDNA 62 2e-06
336emb|CR647582.2|CNS0EYN8 Tetraodon nigroviridis full-length cDNA 62 2e-06
337emb|CR647577.2|CNS0EYN3 Tetraodon nigroviridis full-length cDNA 62 2e-06
338emb|CR647513.2|CNS0EYLB Tetraodon nigroviridis full-length cDNA 62 2e-06
339emb|CR647493.2|CNS0EYKR Tetraodon nigroviridis full-length cDNA 62 2e-06
340emb|CR647160.2|CNS0EYBI Tetraodon nigroviridis full-length cDNA 62 2e-06
341emb|CR646819.2|CNS0EY21 Tetraodon nigroviridis full-length cDNA 62 2e-06
342emb|CR646798.2|CNS0EY1G Tetraodon nigroviridis full-length cDNA 62 2e-06
343emb|CR643273.2|CNS0EVBJ Tetraodon nigroviridis full-length cDNA 62 2e-06
344emb|CR643246.2|CNS0EVAS Tetraodon nigroviridis full-length cDNA 62 2e-06
345emb|CR643160.2|CNS0EV8E Tetraodon nigroviridis full-length cDNA 62 2e-06
346emb|CR643145.2|CNS0EV7Z Tetraodon nigroviridis full-length cDNA 62 2e-06
347emb|CR646343.2|CNS0EXOT Tetraodon nigroviridis full-length cDNA 62 2e-06
348emb|CR646239.2|CNS0EXLX Tetraodon nigroviridis full-length cDNA 62 2e-06
349emb|CR646108.2|CNS0EXIA Tetraodon nigroviridis full-length cDNA 62 2e-06
350emb|CR646091.2|CNS0EXHT Tetraodon nigroviridis full-length cDNA 62 2e-06
351emb|CR645778.2|CNS0EX94 Tetraodon nigroviridis full-length cDNA 62 2e-06
352emb|CR645387.2|CNS0EWY9 Tetraodon nigroviridis full-length cDNA 62 2e-06
353emb|CR645572.2|CNS0EX3E Tetraodon nigroviridis full-length cDNA 62 2e-06
354emb|CR645010.2|CNS0EWNS Tetraodon nigroviridis full-length cDNA 62 2e-06
355emb|CR644790.2|CNS0EWHO Tetraodon nigroviridis full-length cDNA 62 2e-06
356emb|CR644423.2|CNS0EW7H Tetraodon nigroviridis full-length cDNA 62 2e-06
357emb|CR644416.2|CNS0EW7A Tetraodon nigroviridis full-length cDNA 62 2e-06
358emb|CR644340.2|CNS0EW56 Tetraodon nigroviridis full-length cDNA 62 2e-06
359emb|CR644214.2|CNS0EW1O Tetraodon nigroviridis full-length cDNA 62 2e-06
360emb|CR644063.2|CNS0EVXH Tetraodon nigroviridis full-length cDNA 62 2e-06
361emb|CR643980.2|CNS0EVV6 Tetraodon nigroviridis full-length cDNA 62 2e-06
362emb|CR643499.2|CNS0EVHT Tetraodon nigroviridis full-length cDNA 62 2e-06
363emb|CR643895.2|CNS0EVST Tetraodon nigroviridis full-length cDNA 62 2e-06
364emb|CR643823.2|CNS0EVQT Tetraodon nigroviridis full-length cDNA 62 2e-06
365emb|CR642697.2|CNS0EUVJ Tetraodon nigroviridis full-length cDNA 62 2e-06
366emb|CR642038.2|CNS0EUD8 Tetraodon nigroviridis full-length cDNA 62 2e-06
367emb|CR642406.2|CNS0EUNG Tetraodon nigroviridis full-length cDNA 62 2e-06
368emb|CR641600.2|CNS0EU12 Tetraodon nigroviridis full-length cDNA 62 2e-06
369emb|CR641583.2|CNS0EU0L Tetraodon nigroviridis full-length cDNA 62 2e-06
370emb|CR641874.2|CNS0EU8O Tetraodon nigroviridis full-length cDNA 62 2e-06
371emb|CR641789.2|CNS0EU6B Tetraodon nigroviridis full-length cDNA 62 2e-06
372emb|CR641689.2|CNS0EU3J Tetraodon nigroviridis full-length cDNA 62 2e-06
373emb|CR641309.2|CNS0ETSZ Tetraodon nigroviridis full-length cDNA 62 2e-06
374emb|CR640966.2|CNS0ETJG Tetraodon nigroviridis full-length cDNA 62 2e-06
375emb|CR640836.2|CNS0ETFU Tetraodon nigroviridis full-length cDNA 62 2e-06
376emb|CR640596.2|CNS0ET96 Tetraodon nigroviridis full-length cDNA 62 2e-06
377emb|CR640340.2|CNS0ET22 Tetraodon nigroviridis full-length cDNA 62 2e-06
378emb|CR640279.2|CNS0ET0D Tetraodon nigroviridis full-length cDNA 62 2e-06
379emb|CR640184.2|CNS0ESXQ Tetraodon nigroviridis full-length cDNA 62 2e-06
380emb|CR639742.2|CNS0ESLG Tetraodon nigroviridis full-length cDNA 62 2e-06
381emb|CR639544.2|CNS0ESFY Tetraodon nigroviridis full-length cDNA 62 2e-06
382emb|CR639485.2|CNS0ESEB Tetraodon nigroviridis full-length cDNA 62 2e-06
383emb|CR639482.2|CNS0ESE8 Tetraodon nigroviridis full-length cDNA 62 2e-06
384emb|CR639055.2|CNS0ES2D Tetraodon nigroviridis full-length cDNA 62 2e-06
385emb|CR638835.2|CNS0ERW9 Tetraodon nigroviridis full-length cDNA 62 2e-06
386emb|CR638827.2|CNS0ERW1 Tetraodon nigroviridis full-length cDNA 62 2e-06
387emb|CR638821.2|CNS0ERVV Tetraodon nigroviridis full-length cDNA 62 2e-06
388emb|CR638727.2|CNS0ERT9 Tetraodon nigroviridis full-length cDNA 62 2e-06
389emb|CR638666.2|CNS0ERRK Tetraodon nigroviridis full-length cDNA 62 2e-06
390emb|CR638074.2|CNS0ERB4 Tetraodon nigroviridis full-length cDNA 62 2e-06
391emb|CR638064.2|CNS0ERAU Tetraodon nigroviridis full-length cDNA 62 2e-06
392emb|CR637868.2|CNS0ER5E Tetraodon nigroviridis full-length cDNA 62 2e-06
393emb|CR637766.2|CNS0ER2K Tetraodon nigroviridis full-length cDNA 62 2e-06
394emb|CR637232.2|CNS0EQNQ Tetraodon nigroviridis full-length cDNA 62 2e-06
395emb|CR637187.2|CNS0EQMH Tetraodon nigroviridis full-length cDNA 62 2e-06
396emb|CR637180.2|CNS0EQMA Tetraodon nigroviridis full-length cDNA 62 2e-06
397emb|CR637070.2|CNS0EQJ8 Tetraodon nigroviridis full-length cDNA 62 2e-06
398emb|CR636670.2|CNS0EQ84 Tetraodon nigroviridis full-length cDNA 62 2e-06
399emb|CR636599.2|CNS0EQ65 Tetraodon nigroviridis full-length cDNA 62 2e-06
400emb|CR636809.2|CNS0EQBZ Tetraodon nigroviridis full-length cDNA 62 2e-06
401emb|CR636807.2|CNS0EQBX Tetraodon nigroviridis full-length cDNA 62 2e-06
402emb|CR636731.2|CNS0EQ9T Tetraodon nigroviridis full-length cDNA 62 2e-06
403emb|CR636704.2|CNS0EQ92 Tetraodon nigroviridis full-length cDNA 62 2e-06
404emb|CR636432.2|CNS0EQ1I Tetraodon nigroviridis full-length cDNA 62 2e-06
405emb|CR636416.2|CNS0EQ12 Tetraodon nigroviridis full-length cDNA 62 2e-06
406emb|CR636357.2|CNS0EPZF Tetraodon nigroviridis full-length cDNA 62 2e-06
407emb|CR636157.2|CNS0EPTV Tetraodon nigroviridis full-length cDNA 62 2e-06
408emb|CR636128.2|CNS0EPT2 Tetraodon nigroviridis full-length cDNA 62 2e-06
409emb|CR636099.2|CNS0EPS9 Tetraodon nigroviridis full-length cDNA 62 2e-06
410emb|CR635405.2|CNS0EP8Z Tetraodon nigroviridis full-length cDNA 62 2e-06
411emb|CR635380.2|CNS0EP8A Tetraodon nigroviridis full-length cDNA 62 2e-06
412emb|CR635748.2|CNS0EPII Tetraodon nigroviridis full-length cDNA 62 2e-06
413emb|CR635713.2|CNS0EPHJ Tetraodon nigroviridis full-length cDNA 62 2e-06
414emb|CR634969.2|CNS0EOWV Tetraodon nigroviridis full-length cDNA 62 2e-06
415emb|CR634939.2|CNS0EOW1 Tetraodon nigroviridis full-length cDNA 62 2e-06
416emb|CR634899.2|CNS0EOUX Tetraodon nigroviridis full-length cDNA 62 2e-06
417emb|CR634873.2|CNS0EOU7 Tetraodon nigroviridis full-length cDNA 62 2e-06
418emb|CR634247.2|CNS0EOCT Tetraodon nigroviridis full-length cDNA 62 2e-06
419emb|CR634824.2|CNS0EOSU Tetraodon nigroviridis full-length cDNA 62 2e-06
420emb|CR634569.2|CNS0EOLR Tetraodon nigroviridis full-length cDNA 62 2e-06
421emb|CR634553.2|CNS0EOLB Tetraodon nigroviridis full-length cDNA 62 2e-06
422emb|CR634434.2|CNS0EOI0 Tetraodon nigroviridis full-length cDNA 62 2e-06
423emb|CR632900.2|CNS0ENBE Tetraodon nigroviridis full-length cDNA 62 2e-06
424emb|CR632894.2|CNS0ENB8 Tetraodon nigroviridis full-length cDNA 62 2e-06
425emb|CR632891.2|CNS0ENB5 Tetraodon nigroviridis full-length cDNA 62 2e-06
426emb|CR632861.2|CNS0ENAB Tetraodon nigroviridis full-length cDNA 62 2e-06
427emb|CR632696.2|CNS0EN5Q Tetraodon nigroviridis full-length cDNA 62 2e-06
428emb|CR634036.2|CNS0EO6Y Tetraodon nigroviridis full-length cDNA 62 2e-06
429emb|CR633748.2|CNS0ENYY Tetraodon nigroviridis full-length cDNA 62 2e-06
430emb|CR633642.2|CNS0ENW0 Tetraodon nigroviridis full-length cDNA 62 2e-06
431emb|CR633617.2|CNS0ENVB Tetraodon nigroviridis full-length cDNA 62 2e-06
432emb|CR633595.2|CNS0ENUP Tetraodon nigroviridis full-length cDNA 62 2e-06
433emb|CR633568.2|CNS0ENTY Tetraodon nigroviridis full-length cDNA 62 2e-06
434emb|CR633448.2|CNS0ENQM Tetraodon nigroviridis full-length cDNA 62 2e-06
435emb|CR633353.2|CNS0ENNZ Tetraodon nigroviridis full-length cDNA 62 2e-06
436emb|CR633352.2|CNS0ENNY Tetraodon nigroviridis full-length cDNA 62 2e-06
437emb|CR633336.2|CNS0ENNI Tetraodon nigroviridis full-length cDNA 62 2e-06
438emb|CR633333.2|CNS0ENNF Tetraodon nigroviridis full-length cDNA 62 2e-06
439emb|CR633156.2|CNS0ENII Tetraodon nigroviridis full-length cDNA 62 2e-06
440emb|CR633133.2|CNS0ENHV Tetraodon nigroviridis full-length cDNA 62 2e-06
441emb|CR633128.2|CNS0ENHQ Tetraodon nigroviridis full-length cDNA 62 2e-06
442emb|CR633100.2|CNS0ENGY Tetraodon nigroviridis full-length cDNA 62 2e-06
443emb|CR633088.2|CNS0ENGM Tetraodon nigroviridis full-length cDNA 62 2e-06
444emb|CR633060.2|CNS0ENFU Tetraodon nigroviridis full-length cDNA 62 2e-06
445emb|CR631278.2|CNS0EM2B Tetraodon nigroviridis full-length cDNA 62 2e-06
446emb|CR631168.2|CNS0ELZ9 Tetraodon nigroviridis full-length cDNA 62 2e-06
447emb|CR631146.2|CNS0ELYN Tetraodon nigroviridis full-length cDNA 62 2e-06
448emb|CR632420.2|CNS0EMY2 Tetraodon nigroviridis full-length cDNA 62 2e-06
449emb|CR632361.2|CNS0EMWF Tetraodon nigroviridis full-length cDNA 62 2e-06
450emb|CR632348.2|CNS0EMW2 Tetraodon nigroviridis full-length cDNA 62 2e-06
451emb|CR632272.2|CNS0EMTY Tetraodon nigroviridis full-length cDNA 62 2e-06
452emb|CR632237.2|CNS0EMSZ Tetraodon nigroviridis full-length cDNA 62 2e-06
453emb|CR632232.2|CNS0EMSU Tetraodon nigroviridis full-length cDNA 62 2e-06
454emb|CR632209.2|CNS0EMS7 Tetraodon nigroviridis full-length cDNA 62 2e-06
455emb|CR632194.2|CNS0EMRS Tetraodon nigroviridis full-length cDNA 62 2e-06
456emb|CR632167.2|CNS0EMR1 Tetraodon nigroviridis full-length cDNA 62 2e-06
457emb|CR632126.2|CNS0EMPW Tetraodon nigroviridis full-length cDNA 62 2e-06
458emb|CR632076.2|CNS0EMOI Tetraodon nigroviridis full-length cDNA 62 2e-06
459emb|CR631999.2|CNS0EMMD Tetraodon nigroviridis full-length cDNA 62 2e-06
460emb|CR631949.2|CNS0EMKZ Tetraodon nigroviridis full-length cDNA 62 2e-06
461emb|CR631922.2|CNS0EMK8 Tetraodon nigroviridis full-length cDNA 62 2e-06
462emb|CR631853.2|CNS0EMIB Tetraodon nigroviridis full-length cDNA 62 2e-06
463emb|CR631823.2|CNS0EMHH Tetraodon nigroviridis full-length cDNA 62 2e-06
464emb|CR631772.2|CNS0EMG2 Tetraodon nigroviridis full-length cDNA 62 2e-06
465emb|CR631391.2|CNS0EM5G Tetraodon nigroviridis full-length cDNA 62 2e-06
466emb|CR631310.2|CNS0EM37 Tetraodon nigroviridis full-length cDNA 62 2e-06
467emb|CR631757.2|CNS0EMFN Tetraodon nigroviridis full-length cDNA 62 2e-06
468emb|CR631669.2|CNS0EMD7 Tetraodon nigroviridis full-length cDNA 62 2e-06
469gb|DQ066205.1| Ixodes scapularis isolate ISUFL49 ribosomal prote... 62 2e-06
470gb|AF400217.1| Spodoptera frugiperda ribosomal protein S20 mRNA,... 62 2e-06
471dbj|AK108091.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 2e-06
472emb|AJ563463.1|CGI563463 Crassostrea gigas mRNA for ribosomal pr... 60 8e-06
473dbj|AB019235.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 60 8e-06
474emb|CR707743.2|CNS0G91N Tetraodon nigroviridis full-length cDNA 58 3e-05
475emb|CR692874.2|CNS0FXKM Tetraodon nigroviridis full-length cDNA 58 3e-05
476dbj|AK062490.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
477gb|AY769336.1| Bombyx mori ribosomal protein S20 (RpS20) mRNA, c... 54 5e-04
478gb|DQ440015.1| Aedes aegypti clone AE-217 40S ribosomal protein ... 54 5e-04
479emb|AM048978.1| Georissus sp. APV-2005 partial mRNA for ribosoma... 54 5e-04
480emb|CR716197.2|CNS0GFKE Tetraodon nigroviridis full-length cDNA 54 5e-04
481emb|CR713831.2|CNS0GDQR Tetraodon nigroviridis full-length cDNA 54 5e-04
482emb|CR713795.2|CNS0GDPR Tetraodon nigroviridis full-length cDNA 54 5e-04
483emb|CR707884.2|CNS0G95K Tetraodon nigroviridis full-length cDNA 54 5e-04
484emb|CR689471.2|CNS0FUY3 Tetraodon nigroviridis full-length cDNA 54 5e-04
485emb|CR666908.2|CNS0FDK2 Tetraodon nigroviridis full-length cDNA 54 5e-04
486emb|CR660796.2|CNS0F8UA Tetraodon nigroviridis full-length cDNA 54 5e-04
487emb|CR655801.2|CNS0F4ZJ Tetraodon nigroviridis full-length cDNA 54 5e-04
488emb|CR643243.2|CNS0EVAP Tetraodon nigroviridis full-length cDNA 54 5e-04
489emb|CR636239.2|CNS0EPW5 Tetraodon nigroviridis full-length cDNA 54 5e-04
490emb|CR634208.2|CNS0EOBQ Tetraodon nigroviridis full-length cDNA 54 5e-04
491emb|CR631603.2|CNS0EMBD Tetraodon nigroviridis full-length cDNA 54 5e-04
492gb|AF526250.1| Chlamys farreri clone iolscfcl363ct379cn399 ribos... 54 5e-04
493gb|AF503586.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 54 5e-04
494gb|DQ311314.1| Bombyx mori signal sequence receptor beta subunit... 54 5e-04
495gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 52 0.002
496ref|XM_535079.2| PREDICTED: Canis familiaris similar to 40S ribo... 52 0.002
497ref|XM_569465.1| Cryptococcus neoformans var. neoformans JEC21 r... 52 0.002
498emb|CR647329.2|CNS0EYG7 Tetraodon nigroviridis full-length cDNA 52 0.002
499gb|AY432914.1| Aedes aegypti ASAP ID: 34329 cytosolic small ribo... 50 0.008
500ref|XM_504193.1| Yarrowia lipolytica CLIB122, YALI0E20581g predi... 50 0.008

>ref|XM_550614.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 680

 Score =  426 bits (215), Expect = e-116
 Identities = 334/371 (90%), Gaps = 2/371 (0%)
 Strand = Plus / Minus

                                                                       
Query: 122 tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
           ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 476 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 417

                                                                       
Query: 182 tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
           |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 416 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 357

                                                                       
Query: 242 aaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagc 301
           ||||||||||||||||||||||||||||| || || || |||||||||||||||| ||||
Sbjct: 356 aaccgatcccaggtgttggtaccttctccacaaggagacttcctggtggtgatgtggagc 297

                                                                       
Query: 302 accttggtgggcatcctgacggggcccttgacctt-gagctgcttctccttggccccctt 360
           ||||||||||||||||  ||||||||||| |||||  |||| ||| |||||||| |||||
Sbjct: 296 accttggtgggcatccgcacggggcccttcaccttcaagct-cttgtccttggctccctt 238

                                                                       
Query: 361 caccagatccgagcacaccttctcgaggttcttgacggacttggaggagagggtgatgcg 420
           |||||||||   ||| || ||||||||||||||||||  |||||||||||||||||||||
Sbjct: 237 caccagatcaccgcagactttctcgaggttcttgacgctcttggaggagagggtgatgcg 178

                                                                       
Query: 421 gatgcggtgctgcacctcctgcgtgccctcgaagccgagcttgcccgacttcatcggcgg 480
           ||| | ||||||||||||||||| || ||||||||||| |||||| ||||||||||||||
Sbjct: 177 gatcctgtgctgcacctcctgcgagctctcgaagccgatcttgccggacttcatcggcgg 118

                      
Query: 481 cgcgtaggcca 491
           |||||| ||||
Sbjct: 117 cgcgtacgcca 107



to top

>dbj|AK120319.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013056N13, full
           insert sequence
          Length = 680

 Score =  426 bits (215), Expect = e-116
 Identities = 334/371 (90%), Gaps = 2/371 (0%)
 Strand = Plus / Minus

                                                                       
Query: 122 tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
           ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 476 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 417

                                                                       
Query: 182 tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
           |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 416 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 357

                                                                       
Query: 242 aaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagc 301
           ||||||||||||||||||||||||||||| || || || |||||||||||||||| ||||
Sbjct: 356 aaccgatcccaggtgttggtaccttctccacaaggagacttcctggtggtgatgtggagc 297

                                                                       
Query: 302 accttggtgggcatcctgacggggcccttgacctt-gagctgcttctccttggccccctt 360
           ||||||||||||||||  ||||||||||| |||||  |||| ||| |||||||| |||||
Sbjct: 296 accttggtgggcatccgcacggggcccttcaccttcaagct-cttgtccttggctccctt 238

                                                                       
Query: 361 caccagatccgagcacaccttctcgaggttcttgacggacttggaggagagggtgatgcg 420
           |||||||||   ||| || ||||||||||||||||||  |||||||||||||||||||||
Sbjct: 237 caccagatcaccgcagactttctcgaggttcttgacgctcttggaggagagggtgatgcg 178

                                                                       
Query: 421 gatgcggtgctgcacctcctgcgtgccctcgaagccgagcttgcccgacttcatcggcgg 480
           ||| | ||||||||||||||||| || ||||||||||| |||||| ||||||||||||||
Sbjct: 177 gatcctgtgctgcacctcctgcgagctctcgaagccgatcttgccggacttcatcggcgg 118

                      
Query: 481 cgcgtaggcca 491
           |||||| ||||
Sbjct: 117 cgcgtacgcca 107



to top

>dbj|AK106717.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-G01, full
           insert sequence
          Length = 2114

 Score =  426 bits (215), Expect = e-116
 Identities = 334/371 (90%), Gaps = 2/371 (0%)
 Strand = Plus / Minus

                                                                       
Query: 122 tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
           ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 912 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 853

                                                                       
Query: 182 tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
           |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 852 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 793

                                                                       
Query: 242 aaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagc 301
           ||||||||||||||||||||||||||||| || || || |||||||||||||||| ||||
Sbjct: 792 aaccgatcccaggtgttggtaccttctccacaaggagacttcctggtggtgatgtggagc 733

                                                                       
Query: 302 accttggtgggcatcctgacggggcccttgacctt-gagctgcttctccttggccccctt 360
           ||||||||||||||||  ||||||||||| |||||  |||| ||| |||||||| |||||
Sbjct: 732 accttggtgggcatccgcacggggcccttcaccttcaagct-cttgtccttggctccctt 674

                                                                       
Query: 361 caccagatccgagcacaccttctcgaggttcttgacggacttggaggagagggtgatgcg 420
           |||||||||   ||| || ||||||||||||||||||  |||||||||||||||||||||
Sbjct: 673 caccagatcaccgcagactttctcgaggttcttgacgctcttggaggagagggtgatgcg 614

                                                                       
Query: 421 gatgcggtgctgcacctcctgcgtgccctcgaagccgagcttgcccgacttcatcggcgg 480
           ||| | ||||||||||||||||| || ||||||||||| |||||| ||||||||||||||
Sbjct: 613 gatcctgtgctgcacctcctgcgagctctcgaagccgatcttgccggacttcatcggcgg 554

                      
Query: 481 cgcgtaggcca 491
           |||||| ||||
Sbjct: 553 cgcgtacgcca 543



to top

>dbj|AK062184.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-E02, full
           insert sequence
          Length = 695

 Score =  426 bits (215), Expect = e-116
 Identities = 334/371 (90%), Gaps = 2/371 (0%)
 Strand = Plus / Minus

                                                                       
Query: 122 tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
           ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 483 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 424

                                                                       
Query: 182 tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
           |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 423 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 364

                                                                       
Query: 242 aaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagc 301
           ||||||||||||||||||||||||||||| || || || |||||||||||||||| ||||
Sbjct: 363 aaccgatcccaggtgttggtaccttctccacaaggagacttcctggtggtgatgtggagc 304

                                                                       
Query: 302 accttggtgggcatcctgacggggcccttgacctt-gagctgcttctccttggccccctt 360
           ||||||||||||||||  ||||||||||| |||||  |||| ||| |||||||| |||||
Sbjct: 303 accttggtgggcatccgcacggggcccttcaccttcaagct-cttgtccttggctccctt 245

                                                                       
Query: 361 caccagatccgagcacaccttctcgaggttcttgacggacttggaggagagggtgatgcg 420
           |||||||||   ||| || ||||||||||||||||||  |||||||||||||||||||||
Sbjct: 244 caccagatcaccgcagactttctcgaggttcttgacgctcttggaggagagggtgatgcg 185

                                                                       
Query: 421 gatgcggtgctgcacctcctgcgtgccctcgaagccgagcttgcccgacttcatcggcgg 480
           ||| | ||||||||||||||||| || ||||||||||| |||||| ||||||||||||||
Sbjct: 184 gatcctgtgctgcacctcctgcgagctctcgaagccgatcttgccggacttcatcggcgg 125

                      
Query: 481 cgcgtaggcca 491
           |||||| ||||
Sbjct: 124 cgcgtacgcca 114



to top

>dbj|D12632.1|RIC40SSRPC Oryza sativa (japonica cultivar-group) mRNA for 40S subunit
           ribosomal protein, complete cds
          Length = 661

 Score =  426 bits (215), Expect = e-116
 Identities = 334/371 (90%), Gaps = 2/371 (0%)
 Strand = Plus / Minus

                                                                       
Query: 122 tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
           ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 449 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 390

                                                                       
Query: 182 tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
           |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 389 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 330

                                                                       
Query: 242 aaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagc 301
           ||||||||||||||||||||||||||||| || || || |||||||||||||||| ||||
Sbjct: 329 aaccgatcccaggtgttggtaccttctccacaaggagacttcctggtggtgatgtggagc 270

                                                                       
Query: 302 accttggtgggcatcctgacggggcccttgacctt-gagctgcttctccttggccccctt 360
           ||||||||||||||||  ||||||||||| |||||  |||| ||| |||||||| |||||
Sbjct: 269 accttggtgggcatccgcacggggcccttcaccttcaagct-cttgtccttggctccctt 211

                                                                       
Query: 361 caccagatccgagcacaccttctcgaggttcttgacggacttggaggagagggtgatgcg 420
           |||||||||   ||| || ||||||||||||||||||  |||||||||||||||||||||
Sbjct: 210 caccagatcaccgcagactttctcgaggttcttgacgctcttggaggagagggtgatgcg 151

                                                                       
Query: 421 gatgcggtgctgcacctcctgcgtgccctcgaagccgagcttgcccgacttcatcggcgg 480
           ||| | ||||||||||||||||| || ||||||||||| |||||| ||||||||||||||
Sbjct: 150 gatcctgtgctgcacctcctgcgagctctcgaagccgatcttgccggacttcatcggcgg 91

                      
Query: 481 cgcgtaggcca 491
           |||||| ||||
Sbjct: 90  cgcgtacgcca 80



to top

>ref|NM_195069.1| Oryza sativa (japonica cultivar-group) putative ribosomal protein
           S10p/S20e (OSJNBa0071I20.6), mRNA
          Length = 393

 Score =  254 bits (128), Expect = 3e-64
 Identities = 251/292 (85%)
 Strand = Plus / Minus

                                                                       
Query: 137 gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
           ||||| || ||||||||||| ||||| |||||||| |||||||||||||| || || |||
Sbjct: 377 gtcacctcgacctcgacaccaggctcgatggtgatggaggtgatctgcttcacaacatct 318

                                                                       
Query: 197 ggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtg 256
           |||||||||| ||| || ||||||| |||||| |  || | ||| || |||||||| |||
Sbjct: 317 ggggagctgatgagatcgatcacccgcttgtggatgcggaactcgaaacgatcccatgtg 258

                                                                       
Query: 257 ttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatc 316
           || || ||||| ||||| || || || | ||||||||||| ||||||||||||||| |||
Sbjct: 257 tttgttccttcaccgcacggcgacttgcgggtggtgatgtggagcaccttggtggggatc 198

                                                                       
Query: 317 ctgacggggcccttgaccttgagctgcttctccttggcccccttcaccagatccgagcac 376
           |||||||||||||||||    |||||||| |||||||| |||||||||||||| | ||| 
Sbjct: 197 ctgacggggcccttgacgcgcagctgcttgtccttggcgcccttcaccagatcagcgcaa 138

                                                               
Query: 377 accttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
           |||||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 137 accttctcgaggttcttgacgttcttggaggagagggtgatgcggatgcggt 86



to top

>dbj|AK121628.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033050C15, full
           insert sequence
          Length = 710

 Score =  254 bits (128), Expect = 3e-64
 Identities = 251/292 (85%)
 Strand = Plus / Minus

                                                                       
Query: 137 gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
           ||||| || ||||||||||| ||||| |||||||| |||||||||||||| || || |||
Sbjct: 483 gtcacctcgacctcgacaccaggctcgatggtgatggaggtgatctgcttcacaacatct 424

                                                                       
Query: 197 ggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtg 256
           |||||||||| ||| || ||||||| |||||| |  || | ||| || |||||||| |||
Sbjct: 423 ggggagctgatgagatcgatcacccgcttgtggatgcggaactcgaaacgatcccatgtg 364

                                                                       
Query: 257 ttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatc 316
           || || ||||| ||||| || || || | ||||||||||| ||||||||||||||| |||
Sbjct: 363 tttgttccttcaccgcacggcgacttgcgggtggtgatgtggagcaccttggtggggatc 304

                                                                       
Query: 317 ctgacggggcccttgaccttgagctgcttctccttggcccccttcaccagatccgagcac 376
           |||||||||||||||||    |||||||| |||||||| |||||||||||||| | ||| 
Sbjct: 303 ctgacggggcccttgacgcgcagctgcttgtccttggcgcccttcaccagatcagcgcaa 244

                                                               
Query: 377 accttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
           |||||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 243 accttctcgaggttcttgacgttcttggaggagagggtgatgcggatgcggt 192



to top

>dbj|D10402.1|RICT47 Oryza sativa mRNA for ribosomal protein S22 (T47 gene), partial
           sequence
          Length = 321

 Score =  218 bits (110), Expect = 1e-53
 Identities = 207/236 (87%), Gaps = 3/236 (1%)
 Strand = Plus / Minus

                                                                       
Query: 245 cgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcacc 304
           |||||||||||||||||||||||||| || || || |||||||||||||||| |||||||
Sbjct: 321 cgatcccaggtgttggtaccttctccacaaggagacttcctggtggtgatgtggagcacc 262

                                                                       
Query: 305 ttggtgggcatcctgacggggcccttgaccttga-gctgcttctccttggcccccttcac 363
           |||||||  ||||  ||||||||||| ||||| | ||| ||| |||||||| ||||||||
Sbjct: 261 ttggtggn-atccgcacggggcccttcaccttcaagct-cttgtccttggctcccttcac 204

                                                                       
Query: 364 cagatccgagcacaccttctcgaggttcttgacggacttggaggagagggtgatgcggat 423
           ||||||   ||| || |||||||||||||||| |  ||||||||||||||||||||||||
Sbjct: 203 cagatcaccgcagactttctcgaggttcttgangctcttggaggagagggtgatgcggat 144

                                                                   
Query: 424 gcggtgctgcacctcctgcgtgccctcgaagccgagcttgcccgacttcatcggcg 479
            | ||||||||||||||||| || ||||||||||| |||||| |||||||||||||
Sbjct: 143 cctgtgctgcacctcctgcgagctctcgaagccgatcttgccggacttcatcggcg 88



to top

>gb|AY106535.1| Zea mays PCO060763 mRNA sequence
          Length = 741

 Score =  216 bits (109), Expect = 6e-53
 Identities = 247/293 (84%)
 Strand = Plus / Minus

                                                                       
Query: 134 atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacg 193
           |||||||| || ||||| ||||| ||||||||||||||||||||||||||||| || |||
Sbjct: 433 atggtcacctcgacctcaacacccggctcaatggtgatagaggtgatctgcttcaccacg 374

                                                                       
Query: 194 tctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccag 253
           |||||||||||||  ||||| ||||||||||| || |  || | ||||||||| ||||| 
Sbjct: 373 tctggggagctgatcaggtcgatcaccctcttatggatgcggaactcaaaccggtcccat 314

                                                                       
Query: 254 gtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggc 313
           ||||| || ||||| ||||| |||||||| | ||||||||||| ||| ||||| || || 
Sbjct: 313 gtgtttgttccttcaccgcaaggggatttgcgggtggtgatgtggagaaccttagtaggg 254

                                                                       
Query: 314 atcctgacggggcccttgaccttgagctgcttctccttggcccccttcaccagatccgag 373
           |||||||| || ||||| ||| | || ||||| |||||||| ||||| |||| |||||  
Sbjct: 253 atcctgacaggccccttaaccctcagatgcttatccttggctccctttaccaaatccgca 194

                                                                
Query: 374 cacaccttctcgaggttcttgacggacttggaggagagggtgatgcggatgcg 426
           || || ||||| ||||||||||||  |||||| ||||||||||||||||||||
Sbjct: 193 caaactttctccaggttcttgacgttcttggatgagagggtgatgcggatgcg 141



to top

>dbj|AK062522.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-D06, full
           insert sequence
          Length = 707

 Score =  214 bits (108), Expect = 2e-52
 Identities = 246/292 (84%)
 Strand = Plus / Minus

                                                                       
Query: 137 gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
           ||||| |||||||| ||||| || ||||| || || ||||| |||||||| || || || 
Sbjct: 429 gtcacctcaacctcaacaccaggttcaattgttatggaggttatctgcttcaccacatca 370

                                                                       
Query: 197 ggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtg 256
           ||||||||||  |||||||||||||||||||| |  || | |||||||||||||||||||
Sbjct: 369 ggggagctgataaggtcaatcaccctcttgtggatgcggaactcaaaccgatcccaggtg 310

                                                                       
Query: 257 ttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatc 316
           || || ||||| || ||||| || || | ||| ||||||| ||||||||||||||| |||
Sbjct: 309 tttgttccttcaccacagggagacttgcgggtagtgatgtggagcaccttggtggggatc 250

                                                                       
Query: 317 ctgacggggcccttgaccttgagctgcttctccttggcccccttcaccagatccgagcac 376
           || || || ||||| ||| | |||||||| ||||||||||||||||| |||||||  || 
Sbjct: 249 ctaactggcccctttaccctaagctgcttgtccttggcccccttcactagatccgcacaa 190

                                                               
Query: 377 accttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
           || ||||||||||| ||||||  |||||| ||||||||||||||||||||||
Sbjct: 189 actttctcgaggtttttgacgttcttggacgagagggtgatgcggatgcggt 138



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                           
Query: 122     tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
               ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1819317 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1819376

                                                                           
Query: 182     tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
               |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1819377 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1819436

                                       
Query: 242     aaccgatcccaggtgttggtacct 265
               ||||||||||||||||||||||||
Sbjct: 1819437 aaccgatcccaggtgttggtacct 1819460



 Score =  151 bits (76), Expect = 3e-33
 Identities = 103/112 (91%)
 Strand = Plus / Plus

                                                                           
Query: 380     ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggtgctgcacctcc 439
               ||||||||||||||||||  |||||||||||||||||||||||| | |||||||||||||
Sbjct: 1820796 ttctcgaggttcttgacgctcttggaggagagggtgatgcggatcctgtgctgcacctcc 1820855

                                                                   
Query: 440     tgcgtgccctcgaagccgagcttgcccgacttcatcggcggcgcgtaggcca 491
               |||| || ||||||||||| |||||| |||||||||||||||||||| ||||
Sbjct: 1820856 tgcgagctctcgaagccgatcttgccggacttcatcggcggcgcgtacgcca 1820907



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                           
Query: 262     accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
               ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 1820576 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 1820635

                                                                
Query: 322     ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
               ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 1820636 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 1820683



to top

>dbj|AB124892.1| Oryza punctata EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W1514
          Length = 3220

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            |||||||||||||||||||| |||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1574 tactggtcgctgatggtcacctcaacctccacacctggctcaatggtgatcgaggtgatc 1633

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 1634 tgcttgacaacatctgcagagctgacgagatcaatcacccttttgtgcacccgcatctca 1693

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1694 aaccgatcccaggtgttggtacct 1717



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 79/90 (87%), Gaps = 2/90 (2%)
 Strand = Plus / Plus

                                                                        
Query: 281  ttcctggtggtgatgttgagcaccttggtgggcatcctgacggggcccttgacctt-gag 339
            ||||||||||||||||  |||||||||||||||||||  || |||||||| |||||  ||
Sbjct: 3008 ttcctggtggtgatgtgaagcaccttggtgggcatccgcacagggcccttcaccttcaag 3067

                                          
Query: 340  ctgcttctccttggcccccttcaccagatc 369
            || |||||||||||| |||||||| |||||
Sbjct: 3068 ct-cttctccttggctcccttcacgagatc 3096



to top

>dbj|AB124889.1| Oryza meridionalis EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences
          Length = 2902

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1421 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1480

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1481 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1540

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1541 aaccgatcccaggtgttggtacct 1564



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2685 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2744

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2745 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2792



to top

>dbj|AB124884.1| Oryza rufipogon EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W107
          Length = 2901

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1424 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1483

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1484 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1543

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1544 aaccgatcccaggtgttggtacct 1567



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2684 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2743

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2744 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2791



to top

>dbj|AB124883.1| Oryza sativa (indica cultivar-group) EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:PTB10
          Length = 2903

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1424 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1483

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1484 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1543

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1544 aaccgatcccaggtgttggtacct 1567



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2686 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2745

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2746 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2793



to top

>dbj|AB124882.1| Oryza sativa (japonica cultivar-group) EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:T65wx
          Length = 2899

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1421 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1480

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1481 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1540

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1541 aaccgatcccaggtgttggtacct 1564



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2682 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2741

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2742 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2789



to top

>dbj|AB124881.1| Oryza sativa (japonica cultivar-group) EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:Shimokita
          Length = 2899

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1421 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1480

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1481 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1540

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1541 aaccgatcccaggtgttggtacct 1564



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2682 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2741

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2742 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2789



to top

>dbj|AP004234.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0001H02
          Length = 147160

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                         
Query: 122   tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
             ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 19795 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 19854

                                                                         
Query: 182   tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
             |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 19855 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 19914

                                     
Query: 242   aaccgatcccaggtgttggtacct 265
             ||||||||||||||||||||||||
Sbjct: 19915 aaccgatcccaggtgttggtacct 19938



 Score =  151 bits (76), Expect = 3e-33
 Identities = 103/112 (91%)
 Strand = Plus / Plus

                                                                         
Query: 380   ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggtgctgcacctcc 439
             ||||||||||||||||||  |||||||||||||||||||||||| | |||||||||||||
Sbjct: 21274 ttctcgaggttcttgacgctcttggaggagagggtgatgcggatcctgtgctgcacctcc 21333

                                                                 
Query: 440   tgcgtgccctcgaagccgagcttgcccgacttcatcggcggcgcgtaggcca 491
             |||| || ||||||||||| |||||| |||||||||||||||||||| ||||
Sbjct: 21334 tgcgagctctcgaagccgatcttgccggacttcatcggcggcgcgtacgcca 21385



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                         
Query: 262   accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
             ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 21054 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 21113

                                                              
Query: 322   ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
             ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 21114 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 21161



to top

>dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0679C08
          Length = 156266

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                          
Query: 122    tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
              ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 144466 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 144525

                                                                          
Query: 182    tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
              |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 144526 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 144585

                                      
Query: 242    aaccgatcccaggtgttggtacct 265
              ||||||||||||||||||||||||
Sbjct: 144586 aaccgatcccaggtgttggtacct 144609



 Score =  151 bits (76), Expect = 3e-33
 Identities = 103/112 (91%)
 Strand = Plus / Plus

                                                                          
Query: 380    ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggtgctgcacctcc 439
              ||||||||||||||||||  |||||||||||||||||||||||| | |||||||||||||
Sbjct: 145945 ttctcgaggttcttgacgctcttggaggagagggtgatgcggatcctgtgctgcacctcc 146004

                                                                  
Query: 440    tgcgtgccctcgaagccgagcttgcccgacttcatcggcggcgcgtaggcca 491
              |||| || ||||||||||| |||||| |||||||||||||||||||| ||||
Sbjct: 146005 tgcgagctctcgaagccgatcttgccggacttcatcggcggcgcgtacgcca 146056



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                          
Query: 262    accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
              ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 145725 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 145784

                                                               
Query: 322    ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
              ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 145785 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 145832



to top

>emb|AJ417525.1|OSA417525 Oryza sativa partial mRNA for putative ribosomal protein S20 (xd13
           gene)
          Length = 433

 Score =  206 bits (104), Expect = 6e-50
 Identities = 177/196 (90%), Gaps = 4/196 (2%)
 Strand = Plus / Minus

                                                                       
Query: 122 tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
           ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 197 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 138

                                                                       
Query: 182 tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
           |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 137 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 78

                                                                       
Query: 242 aaccgatcccaggtgtt-ggtaccttctccgcagggggatttcctggtggtgat-gttga 299
           ||||||| ||||||||| |||||||||| | || || || |||||||||||||| || ||
Sbjct: 77  aaccgat-ccaggtgttgggtaccttct-cacaaggagacttcctggtggtgatggtgga 20

                           
Query: 300 gcaccttggtgggcat 315
           ||||||||||||||||
Sbjct: 19  gcaccttggtgggcat 4



to top

>dbj|AB052962.1| Oryza sativa EPSPs, rps20 genes for 3-phosphoshikimate
            1-carboxyvinyltransferase, 40S ribosomal protein S20,
            complete cds
          Length = 10601

 Score =  206 bits (104), Expect = 6e-50
 Identities = 134/144 (93%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 7416 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 7475

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 7476 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 7535

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 7536 aaccgatcccaggtgttggtacct 7559



 Score =  151 bits (76), Expect = 3e-33
 Identities = 103/112 (91%)
 Strand = Plus / Plus

                                                                        
Query: 380  ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggtgctgcacctcc 439
            ||||||||||||||||||  |||||||||||||||||||||||| | |||||||||||||
Sbjct: 8895 ttctcgaggttcttgacgctcttggaggagagggtgatgcggatcctgtgctgcacctcc 8954

                                                                
Query: 440  tgcgtgccctcgaagccgagcttgcccgacttcatcggcggcgcgtaggcca 491
            |||| || ||||||||||| |||||| |||||||||||||||||||| ||||
Sbjct: 8955 tgcgagctctcgaagccgatcttgccggacttcatcggcggcgcgtacgcca 9006



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 8675 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 8734

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 8735 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 8782



to top

>dbj|AB124893.1| Oryza officinalis EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W1272
          Length = 3069

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            |||||||||||||||||||| |||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1409 tactggtcgctgatggtcacctcaacctccacacctggctcaatggtgatcgaggtgatc 1468

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  ||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 1469 tgcttgacaacatctgcagagctgacgagatcaatcacccttttgtgcacccgcatctca 1528

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            |||||||||||||| |||||||||
Sbjct: 1529 aaccgatcccaggtattggtacct 1552



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 281  ttcctggtggtgatgttgagcaccttggtgggcatcctgacggggcccttgaccttgagc 340
            ||||||||||||||||  |||||||||||||||||||  || |||||||| ||||| |  
Sbjct: 2849 ttcctggtggtgatgtgaagcaccttggtgggcatccgcacagggcccttcaccttcaaa 2908

                                         
Query: 341  tgcttctccttggcccccttcaccagatc 369
              |||||||||||| |||||||| |||||
Sbjct: 2909 ctcttctccttggctcccttcacaagatc 2937



to top

>dbj|AB124891.1| Oryza longistaminata EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W1422
          Length = 3045

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1499 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1558

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1559 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1618

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            || |||||||||||||||||||||
Sbjct: 1619 aagcgatcccaggtgttggtacct 1642



 Score =  105 bits (53), Expect = 2e-19
 Identities = 97/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||| ||
Sbjct: 2828 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatcctcac 2887

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2888 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2935



to top

>dbj|AB124890.1| Oryza longistaminata EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W1034
          Length = 2888

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1392 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1451

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1452 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1511

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            || |||||||||||||||||||||
Sbjct: 1512 aagcgatcccaggtgttggtacct 1535



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2671 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2730

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2731 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2778



to top

>dbj|AB124888.1| Oryza glumipatula EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W1185
          Length = 3003

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            |||||||||||||||||||| |||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1478 tactggtcgctgatggtcacctcaacctcaacacctggctcaatggtgattgaggtgatc 1537

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1538 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1597

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1598 aaccgatcccaggtgttggtacct 1621



 Score =  105 bits (53), Expect = 2e-19
 Identities = 97/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||| ||
Sbjct: 2785 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatcctcac 2844

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2845 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2892



to top

>dbj|AB124887.1| Oryza barthii EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W159b-2
          Length = 2960

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            |||||||||||||||||||| |||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1439 tactggtcgctgatggtcacctcaacctcaacacctggctcaatggtgattgaggtgatc 1498

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1499 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1558

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1559 aaccgatcccaggtgttggtacct 1582



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 95/109 (87%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| |||||||||||| |||||||  ||
Sbjct: 2749 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtaggcatccgcac 2808

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2809 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2856



to top

>dbj|AB124886.1| Oryza glaberrima EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W025
          Length = 2961

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            |||||||||||||||||||| |||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1439 tactggtcgctgatggtcacctcaacctcaacacctggctcaatggtgattgaggtgatc 1498

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1499 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1558

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            ||||||||||||||||||||||||
Sbjct: 1559 aaccgatcccaggtgttggtacct 1582



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 95/109 (87%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| |||||||||||| |||||||  ||
Sbjct: 2750 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtaggcatccgcac 2809

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2810 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2857



to top

>dbj|AB124885.1| Oryza rufipogon EPSPs, rps20 genes for
            5-enolpyruvylshikimate-3-phosphate synthase, ribosomal
            protein small subunit 20, partial sequences,
            cultivar:W1945
          Length = 2906

 Score =  198 bits (100), Expect = 1e-47
 Identities = 133/144 (92%)
 Strand = Plus / Plus

                                                                        
Query: 122  tactggtcgctgatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatc 181
            ||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||
Sbjct: 1428 tactggtcgctgatggtcacttcaacctccacacctggctcaatggtgattgaggtgatc 1487

                                                                        
Query: 182  tgcttgacgacgtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctca 241
            |||||||| || ||||  |||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 1488 tgcttgacaacatctgcagagctgacaagatcaatcacccttttgtgcacccgcatctca 1547

                                    
Query: 242  aaccgatcccaggtgttggtacct 265
            || |||||||||||||||||||||
Sbjct: 1548 aagcgatcccaggtgttggtacct 1571



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 96/109 (88%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                        
Query: 262  accttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgac 321
            ||||||||| || || || |||||||||||||||| ||||||||||||||||||||  ||
Sbjct: 2689 accttctccacaaggagacttcctggtggtgatgtggagcaccttggtgggcatccgcac 2748

                                                             
Query: 322  ggggcccttgacctt-gagctgcttctccttggcccccttcaccagatc 369
            ||||||||| |||||  |||| ||| |||||||| ||||||||||||||
Sbjct: 2749 ggggcccttcaccttcaagct-cttgtccttggctcccttcaccagatc 2796



to top

>gb|AY104760.1| Zea mays PCO060764 mRNA sequence
          Length = 726

 Score =  188 bits (95), Expect = 1e-44
 Identities = 245/295 (83%)
 Strand = Plus / Minus

                                                                       
Query: 134 atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacg 193
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||||| || || 
Sbjct: 442 atggtcacctcaacctcaacaccgggctcaattgtgatggaggtgatctgcttcaccaca 383

                                                                       
Query: 194 tctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccag 253
           || ||||||||||  |||||||||||||||||||| |  || | ||||||||||||||| 
Sbjct: 382 tcaggggagctgattaggtcaatcaccctcttgtgaatgcggaactcaaaccgatcccat 323

                                                                       
Query: 254 gtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggc 313
           ||||| || ||||| ||||| ||||| || |  |||||||||| ||| ||||| || || 
Sbjct: 322 gtgtttgttccttcaccgcaaggggacttgcgagtggtgatgtggagaaccttagtaggg 263

                                                                       
Query: 314 atcctgacggggcccttgaccttgagctgcttctccttggcccccttcaccagatccgag 373
           |||||||| || ||||| ||| | |  ||||| |||||||| ||||| |||| |||||  
Sbjct: 262 atcctgacaggtcccttaaccctcaaatgcttgtccttggctccctttaccaaatccgca 203

                                                                  
Query: 374 cacaccttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
           || || ||||| | ||||||||||  |||||| ||||| ||||||||||||||||
Sbjct: 202 caaactttctccaagttcttgacgttcttggatgagagtgtgatgcggatgcggt 148



to top

>gb|AY758353.1| Zea mays ribosomal protein S10p/S20e mRNA, complete cds
          Length = 457

 Score =  180 bits (91), Expect = 3e-42
 Identities = 244/295 (82%)
 Strand = Plus / Minus

                                                                       
Query: 134 atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacg 193
           |||||||| |||||||| |||||||||||||| ||||| |||||||||||||| || || 
Sbjct: 435 atggtcacctcaacctcaacaccgggctcaattgtgatggaggtgatctgcttcaccaca 376

                                                                       
Query: 194 tctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccag 253
           || ||| ||||||  |||||||||||||||||||| |  || | ||||||||||||||| 
Sbjct: 375 tcagggaagctgattaggtcaatcaccctcttgtgaatgcggaactcaaaccgatcccat 316

                                                                       
Query: 254 gtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggc 313
           ||||| || ||||| ||||| ||||| || |  |||||||||| ||| ||||| || || 
Sbjct: 315 gtgtttgttccttcaccgcaaggggacttgcgagtggtgatgtggagaaccttagtaggg 256

                                                                       
Query: 314 atcctgacggggcccttgaccttgagctgcttctccttggcccccttcaccagatccgag 373
           |||||||| || ||||| ||| | |  ||||| |||||||| ||||| |||| |||||  
Sbjct: 255 atcctgacaggtcccttaaccctcaaatgcttgtccttggctccctttaccaaatccgca 196

                                                                  
Query: 374 cacaccttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
           || || ||||| | ||||||||||  |||||| ||||| ||||||||||||||||
Sbjct: 195 caaactttctccaagttcttgacgttcttggatgagagtgtgatgcggatgcggt 141



to top

>gb|AY310806.1| Nicotiana benthamiana clone 12-105 unknown mRNA
          Length = 504

 Score =  125 bits (63), Expect = 2e-25
 Identities = 153/184 (83%)
 Strand = Plus / Minus

                                                                       
Query: 134 atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacg 193
           ||||| || |||||||| |||||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 296 atggtgacctcaacctcaacaccgggttcaatggtgattgaggtgatctgcttgacaaca 237

                                                                       
Query: 194 tctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccag 253
           |||| ||| ||||  ||||||||||| | ||||||||||| ||  |||||||  ||||| 
Sbjct: 236 tctgcggaactgaaaaggtcaatcacacgcttgtgcacccncagntcaaacctgtcccat 177

                                                                       
Query: 254 gtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggc 313
           || || || |||||||| ||||| || ||  | ||||| |||||||| ||||| ||||||
Sbjct: 176 gtatttgtgccttctccacagggagactttntagtggtaatgttgagaaccttagtgggc 117

               
Query: 314 atcc 317
           ||||
Sbjct: 116 atcc 113



to top

>gb|AC074355.6| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNBa0071I20, complete sequence
          Length = 145510

 Score =  105 bits (53), Expect = 2e-19
 Identities = 95/109 (87%)
 Strand = Plus / Minus

                                                                         
Query: 261   taccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctga 320
             ||||||| ||||| || || || | ||||||||||| ||||||||||||||| |||||||
Sbjct: 30590 taccttcaccgcacggcgacttgcgggtggtgatgtggagcaccttggtggggatcctga 30531

                                                              
Query: 321   cggggcccttgaccttgagctgcttctccttggcccccttcaccagatc 369
             |||||||||||||    |||||||| |||||||| ||||||||||||||
Sbjct: 30530 cggggcccttgacgcgcagctgcttgtccttggcgcccttcaccagatc 30482



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                         
Query: 137   gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
             ||||| || ||||||||||| ||||| |||||||| |||||||||||||| || || |||
Sbjct: 32861 gtcacctcgacctcgacaccaggctcgatggtgatggaggtgatctgcttcacaacatct 32802

                                             
Query: 197   ggggagctgacgaggtcaatcaccctcttgtg 228
             |||||||||| ||| || ||||||| ||||||
Sbjct: 32801 ggggagctgatgagatcgatcacccgcttgtg 32770



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                
Query: 378   ccttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
             ||||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 30351 ccttctcgaggttcttgacgttcttggaggagagggtgatgcggatgcggt 30301



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score =  105 bits (53), Expect = 2e-19
 Identities = 95/109 (87%)
 Strand = Plus / Minus

                                                                           
Query: 261     taccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctga 320
               ||||||| ||||| || || || | ||||||||||| ||||||||||||||| |||||||
Sbjct: 4483227 taccttcaccgcacggcgacttgcgggtggtgatgtggagcaccttggtggggatcctga 4483168

                                                                
Query: 321     cggggcccttgaccttgagctgcttctccttggcccccttcaccagatc 369
               |||||||||||||    |||||||| |||||||| ||||||||||||||
Sbjct: 4483167 cggggcccttgacgcgcagctgcttgtccttggcgcccttcaccagatc 4483119



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                           
Query: 137     gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
               ||||| || ||||||||||| ||||| |||||||| |||||||||||||| || || |||
Sbjct: 4485498 gtcacctcgacctcgacaccaggctcgatggtgatggaggtgatctgcttcacaacatct 4485439

                                               
Query: 197     ggggagctgacgaggtcaatcaccctcttgtg 228
               |||||||||| ||| || ||||||| ||||||
Sbjct: 4485438 ggggagctgatgagatcgatcacccgcttgtg 4485407



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                  
Query: 378     ccttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
               ||||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 4482988 ccttctcgaggttcttgacgttcttggaggagagggtgatgcggatgcggt 4482938



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 236     atctcaaaccgatcccaggtgttg 259
               |||||||||| |||||||||||||
Sbjct: 8394194 atctcaaaccaatcccaggtgttg 8394171



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  105 bits (53), Expect = 2e-19
 Identities = 95/109 (87%)
 Strand = Plus / Minus

                                                                           
Query: 261     taccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctga 320
               ||||||| ||||| || || || | ||||||||||| ||||||||||||||| |||||||
Sbjct: 4484048 taccttcaccgcacggcgacttgcgggtggtgatgtggagcaccttggtggggatcctga 4483989

                                                                
Query: 321     cggggcccttgaccttgagctgcttctccttggcccccttcaccagatc 369
               |||||||||||||    |||||||| |||||||| ||||||||||||||
Sbjct: 4483988 cggggcccttgacgcgcagctgcttgtccttggcgcccttcaccagatc 4483940



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                           
Query: 137     gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
               ||||| || ||||||||||| ||||| |||||||| |||||||||||||| || || |||
Sbjct: 4486319 gtcacctcgacctcgacaccaggctcgatggtgatggaggtgatctgcttcacaacatct 4486260

                                               
Query: 197     ggggagctgacgaggtcaatcaccctcttgtg 228
               |||||||||| ||| || ||||||| ||||||
Sbjct: 4486259 ggggagctgatgagatcgatcacccgcttgtg 4486228



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 49/51 (96%)
 Strand = Plus / Minus

                                                                  
Query: 378     ccttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
               ||||||||||||||||||||  |||||||||||||||||||||||||||||
Sbjct: 4483809 ccttctcgaggttcttgacgttcttggaggagagggtgatgcggatgcggt 4483759



 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 236     atctcaaaccgatcccaggtgttg 259
               |||||||||| |||||||||||||
Sbjct: 8399293 atctcaaaccaatcccaggtgttg 8399270



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                           
Query: 137     gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
               ||||| |||||||| ||||| || ||||| || || ||||| |||||||| || || || 
Sbjct: 7857443 gtcacctcaacctcaacaccaggttcaattgttatggaggttatctgcttcaccacatca 7857384

                                                                           
Query: 197     ggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtg 256
               ||||||||||  |||||||||||||||||||| |  || | |||||||||||||||||||
Sbjct: 7857383 ggggagctgataaggtcaatcaccctcttgtggatgcggaactcaaaccgatcccaggtg 7857324

                 
Query: 257     tt 258
               ||
Sbjct: 7857323 tt 7857322



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                           
Query: 261     taccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctga 320
               ||||||| || ||||| || || | ||| ||||||| ||||||||||||||| ||||| |
Sbjct: 7856789 taccttcaccacagggagacttgcgggtagtgatgtggagcaccttggtggggatcctaa 7856730

                                                                  
Query: 321     cggggcccttgaccttgagctgcttctccttggcccccttcaccagatccg 371
               | || ||||| ||| | |||||||| ||||||||||||||||| |||||||
Sbjct: 7856729 ctggcccctttaccctaagctgcttgtccttggcccccttcactagatccg 7856679



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 380     ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
               ||||||||||| ||||||  |||||| ||||||||||||||||||||||
Sbjct: 7855935 ttctcgaggtttttgacgttcttggacgagagggtgatgcggatgcggt 7855887



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                           
Query: 137     gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
               ||||| |||||||| ||||| || ||||| || || ||||| |||||||| || || || 
Sbjct: 7855278 gtcacctcaacctcaacaccaggttcaattgttatggaggttatctgcttcaccacatca 7855219

                                                                           
Query: 197     ggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtg 256
               ||||||||||  |||||||||||||||||||| |  || | |||||||||||||||||||
Sbjct: 7855218 ggggagctgataaggtcaatcaccctcttgtggatgcggaactcaaaccgatcccaggtg 7855159

                 
Query: 257     tt 258
               ||
Sbjct: 7855158 tt 7855157



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                           
Query: 261     taccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctga 320
               ||||||| || ||||| || || | ||| ||||||| ||||||||||||||| ||||| |
Sbjct: 7854624 taccttcaccacagggagacttgcgggtagtgatgtggagcaccttggtggggatcctaa 7854565

                                                                  
Query: 321     cggggcccttgaccttgagctgcttctccttggcccccttcaccagatccg 371
               | || ||||| ||| | |||||||| ||||||||||||||||| |||||||
Sbjct: 7854564 ctggcccctttaccctaagctgcttgtccttggcccccttcactagatccg 7854514



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                
Query: 380     ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
               ||||||||||| ||||||  |||||| ||||||||||||||||||||||
Sbjct: 7853770 ttctcgaggtttttgacgttcttggacgagagggtgatgcggatgcggt 7853722



to top

>gb|AC134235.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0030J04, complete sequence
          Length = 153431

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 103/122 (84%)
 Strand = Plus / Minus

                                                                         
Query: 137   gtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtct 196
             ||||| |||||||| ||||| || ||||| || || ||||| |||||||| || || || 
Sbjct: 43041 gtcacctcaacctcaacaccaggttcaattgttatggaggttatctgcttcaccacatca 42982

                                                                         
Query: 197   ggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtg 256
             ||||||||||  |||||||||||||||||||| |  || | |||||||||||||||||||
Sbjct: 42981 ggggagctgataaggtcaatcaccctcttgtggatgcggaactcaaaccgatcccaggtg 42922

               
Query: 257   tt 258
             ||
Sbjct: 42921 tt 42920



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                         
Query: 261   taccttctccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctga 320
             ||||||| || ||||| || || | ||| ||||||| ||||||||||||||| ||||| |
Sbjct: 42387 taccttcaccacagggagacttgcgggtagtgatgtggagcaccttggtggggatcctaa 42328

                                                                
Query: 321   cggggcccttgaccttgagctgcttctccttggcccccttcaccagatccg 371
             | || ||||| ||| | |||||||| ||||||||||||||||| |||||||
Sbjct: 42327 ctggcccctttaccctaagctgcttgtccttggcccccttcactagatccg 42277



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 380   ttctcgaggttcttgacggacttggaggagagggtgatgcggatgcggt 428
             ||||||||||| ||||||  |||||| ||||||||||||||||||||||
Sbjct: 41533 ttctcgaggtttttgacgttcttggacgagagggtgatgcggatgcggt 41485



to top

>gb|M95062.1|MZEORFC Zea mays putative ribosomal protein S22 homolog mRNA, partial cds
          Length = 184

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 133/163 (81%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtaccttct 268
           |||||||||||||||||||| |  || | ||||||||||||||| ||||| || ||||| 
Sbjct: 178 aggtcaatcaccctcttgtgaatgcggaactcaaaccgatcccatgtgtttgttccttca 119

                                                                       
Query: 269 ccgcagggggatttcctggtggtgatgttgagcaccttggtgggcatcctgacggggccc 328
           ||||| ||||| || |  |||||||||| ||| ||||| || || |||||||| || |||
Sbjct: 118 ccgcaaggggacttgcgagtggtgatgtggagaaccttagtagggatcctgacaggtccc 59

                                                      
Query: 329 ttgaccttgagctgcttctccttggcccccttcaccagatccg 371
           || ||| | |  ||||| |||||||| ||||| |||| |||||
Sbjct: 58  ttaaccctcaaatgcttgtccttggctccctttaccaaatccg 16



to top

>ref|NM_180334.1| Arabidopsis thaliana structural constituent of ribosome AT3G47370
           transcript variant AT3G47370.2 mRNA, complete cds
          Length = 576

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 acctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtctggggagctg 205
           ||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 402 acctcaacaccgggctcaatggtgatagacgtgatttgcttaacaacgtcaggggagctg 343

                                                                       
Query: 206 acgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtacct 265
           | ||| || || || | |||||| ||||  | ||||||||  ||||| || |||||||||
Sbjct: 342 aagagatcgatgacacgcttgtgaaccctgagctcaaacctgtcccaagtattggtacct 283

             
Query: 266 tc 267
           ||
Sbjct: 282 tc 281



to top

>ref|NM_114605.1| Arabidopsis thaliana structural constituent of ribosome AT3G47370
           transcript variant AT3G47370.1 mRNA, complete cds
          Length = 613

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 acctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtctggggagctg 205
           ||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 431 acctcaacaccgggctcaatggtgatagacgtgatttgcttaacaacgtcaggggagctg 372

                                                                       
Query: 206 acgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtacct 265
           | ||| || || || | |||||| ||||  | ||||||||  ||||| || |||||||||
Sbjct: 371 aagagatcgatgacacgcttgtgaaccctgagctcaaacctgtcccaagtattggtacct 312

             
Query: 266 tc 267
           ||
Sbjct: 311 tc 310



to top

>ref|NM_001035749.1| Arabidopsis thaliana structural constituent of ribosome AT3G47370
           transcript variant AT3G47370.3 mRNA, complete cds
          Length = 636

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 acctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtctggggagctg 205
           ||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 418 acctcaacaccgggctcaatggtgatagacgtgatttgcttaacaacgtcaggggagctg 359

                                                                       
Query: 206 acgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtacct 265
           | ||| || || || | |||||| ||||  | ||||||||  ||||| || |||||||||
Sbjct: 358 aagagatcgatgacacgcttgtgaaccctgagctcaaacctgtcccaagtattggtacct 299

             
Query: 266 tc 267
           ||
Sbjct: 298 tc 297



to top

>gb|AY088633.1| Arabidopsis thaliana clone 8700 mRNA, complete sequence
          Length = 614

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 acctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtctggggagctg 205
           ||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 432 acctcaacaccgggctcaatggtgatagacgtgatttgcttaacaacgtcaggggagctg 373

                                                                       
Query: 206 acgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtacct 265
           | ||| || || || | |||||| ||||  | ||||||||  ||||| || |||||||||
Sbjct: 372 aagagatcgatgacacgcttgtgaaccctgagctcaaacctgtcccaagtattggtacct 313

             
Query: 266 tc 267
           ||
Sbjct: 312 tc 311



to top

>gb|BT003067.1| Arabidopsis thaliana At3g47370 gene, complete cds
          Length = 369

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 146 acctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtctggggagctg 205
           ||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 344 acctcaacaccgggctcaatggtgatagacgtgatttgcttaacaacgtcaggggagctg 285

                                                                       
Query: 206 acgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtacct 265
           | ||| || || || | |||||| ||||  | ||||||||  ||||| || |||||||||
Sbjct: 284 aagagatcgatgacacgcttgtgaaccctgagctcaaacctgtcccaagtattggtacct 225

             
Query: 266 tc 267
           ||
Sbjct: 224 tc 223



to top

>ref|NM_114372.3| Arabidopsis thaliana structural constituent of ribosome AT3G45030
           mRNA, complete cds
          Length = 609

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 161/201 (80%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || |||||||| ||||| || ||||||||||| || ||||| |||||||| ||
Sbjct: 433 gatggtgacctcaacctcaacaccaggttcaatggtgatggatgtgatttgcttgaccac 374

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || ||||||| ||| |||||||| | |||||||||||  |  ||||| |  |||||
Sbjct: 373 atcaggagagctgaagagatcaatcactcgcttgtgcaccctaagttcaaatctgtccca 314

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            || ||||| ||||| || ||||| | ||| | ||| ||||| ||||| ||||| |||||
Sbjct: 313 tgtattggttccttcaccacagggagcttttcgggtagtgatcttgagaaccttagtggg 254

                                
Query: 313 catcctgacggggcccttgac 333
           ||| || || || ||||||||
Sbjct: 253 cattctcactggtcccttgac 233



to top

>gb|AC144805.9| Medicago truncatula clone mth2-72a11, complete sequence
          Length = 78128

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 110/133 (82%)
 Strand = Plus / Minus

                                                                         
Query: 134   atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacg 193
             ||||| || ||||| ||||||||||| ||||| ||||| ||||| ||||||||||| || 
Sbjct: 49080 atggtgacctcaacttcgacaccgggttcaattgtgattgaggtaatctgcttgacaaca 49021

                                                                         
Query: 194   tctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccag 253
             || || || |||  ||||||||| || ||||||||||| |||| |||||| |  ||||| 
Sbjct: 49020 tcgggtgaactgtagaggtcaatgactctcttgtgcacacgcagctcaaatctgtcccat 48961

                          
Query: 254   gtgttggtacctt 266
             ||||| |||||||
Sbjct: 48960 gtgtttgtacctt 48948



to top

>gb|AY114024.1| Arabidopsis thaliana putative 40S ribsomomal protein (At3g45030)
           mRNA, complete cds
          Length = 406

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 161/201 (80%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || |||||||| ||||| || ||||||||||| || ||||| |||||||| ||
Sbjct: 363 gatggtgacctcaacctcaacaccaggttcaatggtgatggatgtgatttgcttgaccac 304

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || ||||||| ||| |||||||| | |||||||||||  |  ||||| |  |||||
Sbjct: 303 atcaggagagctgaagagatcaatcactcgcttgtgcaccctaagttcaaatctgtccca 244

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            || ||||| ||||| || ||||| | ||| | ||| ||||| ||||| ||||| |||||
Sbjct: 243 tgtattggttccttcaccacagggagcttttcgggtagtgatcttgagaaccttagtggg 184

                                
Query: 313 catcctgacggggcccttgac 333
           ||| || || || ||||||||
Sbjct: 183 cattctcactggtcccttgac 163



to top

>gb|AY096646.1| Arabidopsis thaliana putative 40S ribsomomal protein (At3g45030)
           mRNA, complete cds
          Length = 615

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 161/201 (80%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || |||||||| ||||| || ||||||||||| || ||||| |||||||| ||
Sbjct: 433 gatggtgacctcaacctcaacaccaggttcaatggtgatggatgtgatttgcttgaccac 374

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || ||||||| ||| |||||||| | |||||||||||  |  ||||| |  |||||
Sbjct: 373 atcaggagagctgaagagatcaatcactcgcttgtgcaccctaagttcaaatctgtccca 314

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            || ||||| ||||| || ||||| | ||| | ||| ||||| ||||| ||||| |||||
Sbjct: 313 tgtattggttccttcaccacagggagcttttcgggtagtgatcttgagaaccttagtggg 254

                                
Query: 313 catcctgacggggcccttgac 333
           ||| || || || ||||||||
Sbjct: 253 cattctcactggtcccttgac 233



to top

>emb|AL096860.1|ATT21L8 Arabidopsis thaliana DNA chromosome 3, BAC clone T21L8
          Length = 87224

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 100/120 (83%)
 Strand = Plus / Plus

                                                                         
Query: 146   acctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacgtctggggagctg 205
             ||||| ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||
Sbjct: 53117 acctcaacaccgggctcaatggtgatagacgtgatttgcttaacaacgtcaggggagctg 53176

                                                                         
Query: 206   acgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccaggtgttggtacct 265
             | ||| || || || | |||||| ||||  | ||||||||  ||||| || |||||||||
Sbjct: 53177 aagagatcgatgacacgcttgtgaaccctgagctcaaacctgtcccaagtattggtacct 53236



to top

>gb|AC157891.3| Medicago truncatula chromosome 7 BAC clone mte1-1i2, complete sequence
          Length = 154095

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 109/132 (82%)
 Strand = Plus / Plus

                                                                          
Query: 134    atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgacg 193
              ||||| || ||||||||||| || || || |||||||||||||| ||||| || || || 
Sbjct: 124116 atggtaacctcaacctcgacgccaggttcgatggtgatagaggtaatctgtttaacaaca 124175

                                                                          
Query: 194    tctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatcccag 253
              |||||||| |||  |||||| || || ||||||||||| || |  ||||| | |||||||
Sbjct: 124176 tctggggaactgtagaggtcgatgactctcttgtgcacacggagttcaaatctatcccag 124235

                          
Query: 254    gtgttggtacct 265
              ||||||||||||
Sbjct: 124236 gtgttggtacct 124247



to top

>ref|XM_776941.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S20 (LOC576658), mRNA
          Length = 673

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           |||||| || |||||||||||||| ||||| ||| ||||||||||||||||||||||||
Sbjct: 441 gatggtgacctcaacctcgacaccaggctcgatgctgatagaggtgatctgcttgacga 383



to top

>emb|AL353992.1|ATF14D17 Arabidopsis thaliana DNA chromosome 3, BAC clone F14D17
          Length = 89214

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                         
Query: 133   gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
             |||||| || |||||||| ||||| || ||||||||||| || ||||| |||||||| ||
Sbjct: 63333 gatggtgacctcaacctcaacaccaggttcaatggtgatggatgtgatttgcttgaccac 63392

                                                      
Query: 193   gtctggggagctgacgaggtcaatcaccctcttgtgcaccc 233
              || || ||||||| ||| |||||||| | |||||||||||
Sbjct: 63393 atcaggagagctgaagagatcaatcactcgcttgtgcaccc 63433



to top

>gb|AY826138.1| Aedes albopictus clone AL_140 40S ribosomal protein S20 mRNA,
           complete cds
          Length = 363

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| |||||||| |||||||| || ||| |||| |||||||||||||||||||
Sbjct: 351 gatggtcacctcaacctctacaccgggttcgatgttgatcgaggtgatctgcttgacga 293



to top

>emb|CR696597.2|CNS0G0G1 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| ||||||||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatagaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR691724.2|CNS0FWOO Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| ||||||||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatagaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR643468.2|CNS0EVGY Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| ||||||||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatagaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 catctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgat 294
           ||||| ||| ||||||||||| ||||  || || || ||||||| ||| |||||||||||
Sbjct: 341 catctgaaagcgatcccaggttttggatccctcaccacagggggtttttctggtggtgat 282

            
Query: 295 g 295
           |
Sbjct: 281 g 281



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR639079.2|CNS0ES31 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| ||||||||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatagaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|AJ312336.1|OMY312336 Oncorhynchus mykiss partial mRNA for putative 40S ribosomal protein
           20S protein
          Length = 478

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 173/219 (78%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || |||||||| ||||| ||||||||| |||| ||||||||||||||||| | 
Sbjct: 411 gatggtgacctcaacctctacaccaggctcaatgctgattgaggtgatctgcttgacaat 352

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || | ||  |||   ||||| ||||  | |||||| | ||||||||  || ||||||||
Sbjct: 351 ctcagagggactgtgcaggtcgatcaaacgcttgtggatccgcatctggaagcgatccca 292

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
           ||| ||||  |||||||| ||||| |  || ||||||||||||   ||   |||||||||
Sbjct: 291 ggtcttggagccttctccacagggtgtctttctggtggtgatgcgcagagtcttggtggg 232

                                                  
Query: 313 catcctgacggggcccttgaccttgagctgcttctcctt 351
           ||| | ||| || ||||| |||||||| | |||||||||
Sbjct: 231 catacggactggacccttcaccttgaggttcttctcctt 193



to top

>ref|NM_125624.2| Arabidopsis thaliana structural constituent of ribosome AT5G62300
           mRNA, complete cds
          Length = 637

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 157/198 (79%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || ||||| || ||||| || ||||||||||| ||||||||||||||||| ||
Sbjct: 457 gatggtgacctcaacttcaacaccaggttcaatggtgatggaggtgatctgcttgaccac 398

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || |||||||  || || || || | |||||| ||||  | ||| || |  |||||
Sbjct: 397 atcaggagagctgaaaagatctataactcgcttgtgtaccctaagctcgaatctgtccca 338

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            |||||||| ||||| || || || | ||| | ||| ||||| ||||| |||||||||||
Sbjct: 337 tgtgttggttccttcaccacaaggagctttacgggtagtgatcttgagaaccttggtggg 278

                             
Query: 313 catcctgacggggccctt 330
           ||| ||||| || |||||
Sbjct: 277 cattctgactggaccctt 260



to top

>ref|XM_968376.1| PREDICTED: Tribolium castaneum similar to CG15693-PA (LOC662265),
           mRNA
          Length = 498

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 134 atggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||| ||||||||||| || |||||||||||| |||| ||||||||||| |||||||
Sbjct: 442 atggttacttcaacctccacgccgggctcaatgttgattgaggtgatctgtttgacga 385



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 218 accctcttgtgcacccgcatctcaaaccgatcccaggtgttggtaccttctccgcagggg 277
           ||||||||||| | || |||||  || || |||||||| |||| |||||| || ||||| 
Sbjct: 358 accctcttgtgaatcctcatctggaatcggtcccaggtcttggaaccttcaccacagggc 299

                            
Query: 278 gatttcctggtggtgat 294
           | |||||||||||||||
Sbjct: 298 gttttcctggtggtgat 282



to top

>gb|BT000382.1| Arabidopsis thaliana 40S ribosomal protein S20 (At5g62300) mRNA,
           complete cds
          Length = 441

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 157/198 (79%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || ||||| || ||||| || ||||||||||| ||||||||||||||||| ||
Sbjct: 342 gatggtgacctcaacttcaacaccaggttcaatggtgatggaggtgatctgcttgaccac 283

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || |||||||  || || || || | |||||| ||||  | ||| || |  |||||
Sbjct: 282 atcaggagagctgaaaagatctataactcgcttgtgtaccctaagctcgaatctgtccca 223

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            |||||||| ||||| || || || | ||| | ||| ||||| ||||| |||||||||||
Sbjct: 222 tgtgttggttccttcaccacaaggagctttacgggtagtgatcttgagaaccttggtggg 163

                             
Query: 313 catcctgacggggccctt 330
           ||| ||||| || |||||
Sbjct: 162 cattctgactggaccctt 145



to top

>gb|AF325017.2|AF325017 Arabidopsis thaliana AT5g62300 (AT5g62300/mmi9_120) mRNA, complete
           cds
          Length = 615

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 157/198 (79%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || ||||| || ||||| || ||||||||||| ||||||||||||||||| ||
Sbjct: 436 gatggtgacctcaacttcaacaccaggttcaatggtgatggaggtgatctgcttgaccac 377

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || |||||||  || || || || | |||||| ||||  | ||| || |  |||||
Sbjct: 376 atcaggagagctgaaaagatctataactcgcttgtgtaccctaagctcgaatctgtccca 317

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            |||||||| ||||| || || || | ||| | ||| ||||| ||||| |||||||||||
Sbjct: 316 tgtgttggttccttcaccacaaggagctttacgggtagtgatcttgagaaccttggtggg 257

                             
Query: 313 catcctgacggggccctt 330
           ||| ||||| || |||||
Sbjct: 256 cattctgactggaccctt 239



to top

>gb|AF370460.1|AF370460 Arabidopsis thaliana 40S ribosomal protein S20 (MMI9.13) mRNA,
           complete cds
          Length = 615

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 157/198 (79%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || ||||| || ||||| || ||||||||||| ||||||||||||||||| ||
Sbjct: 436 gatggtgacctcaacttcaacaccaggttcaatggtgatggaggtgatctgcttgaccac 377

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || |||||||  || || || || | |||||| ||||  | ||| || |  |||||
Sbjct: 376 atcaggagagctgaaaagatctataactcgcttgtgtaccctaagctcgaatctgtccca 317

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            |||||||| ||||| || || || | ||| | ||| ||||| ||||| |||||||||||
Sbjct: 316 tgtgttggttccttcaccacaaggagctttacgggtagtgatcttgagaaccttggtggg 257

                             
Query: 313 catcctgacggggccctt 330
           ||| ||||| || |||||
Sbjct: 256 cattctgactggaccctt 239



to top

>gb|AY085673.1| Arabidopsis thaliana clone 16926 mRNA, complete sequence
          Length = 628

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 157/198 (79%)
 Strand = Plus / Minus

                                                                       
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacgac 192
           |||||| || ||||| || ||||| || ||||||||||| ||||||||||||||||| ||
Sbjct: 457 gatggtgacctcaacttcaacaccaggttcaatggtgatggaggtgatctgcttgaccac 398

                                                                       
Query: 193 gtctggggagctgacgaggtcaatcaccctcttgtgcacccgcatctcaaaccgatccca 252
            || || |||||||  || || || || | |||||| ||||  | ||| || |  |||||
Sbjct: 397 atcaggagagctgaaaagatctataactcgcttgtgtaccctaagctcgaatctgtccca 338

                                                                       
Query: 253 ggtgttggtaccttctccgcagggggatttcctggtggtgatgttgagcaccttggtggg 312
            |||||||| ||||| || || || | ||| | ||| ||||| ||||| |||||||||||
Sbjct: 337 tgtgttggttccttcaccacaaggagctttacgggtagtgatcttgagaaccttggtggg 278

                             
Query: 313 catcctgacggggccctt 330
           ||| ||||| || |||||
Sbjct: 277 cattctgactggaccctt 260



to top

>ref|XM_954146.1| Neurospora crassa OR74A hypothetical protein (NCU06892.1) partial
           mRNA
          Length = 354

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 cgcatctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtg 292
           |||||||| ||  |||||||||| |||| ||| || ||||||||||| || | |||||||
Sbjct: 248 cgcatctcgaagagatcccaggtcttggaaccctcaccgcagggggacttgcgggtggtg 189

                                                    
Query: 293 atgttgagcaccttggtgggcatcctgacggggcccttgac 333
           || ||||| | ||||||||| |  | |||||||||||||||
Sbjct: 188 atcttgaggatcttggtgggaaggcggacggggcccttgac 148



to top

>ref|XM_327177.1| Neurospora crassa OR74A hypothetical protein (NCU06892.1) partial
           mRNA
          Length = 354

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 cgcatctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtg 292
           |||||||| ||  |||||||||| |||| ||| || ||||||||||| || | |||||||
Sbjct: 248 cgcatctcgaagagatcccaggtcttggaaccctcaccgcagggggacttgcgggtggtg 189

                                                    
Query: 293 atgttgagcaccttggtgggcatcctgacggggcccttgac 333
           || ||||| | ||||||||| |  | |||||||||||||||
Sbjct: 188 atcttgaggatcttggtgggaaggcggacggggcccttgac 148



to top

>emb|CR734985.2|CNS0GTW8 Tetraodon nigroviridis full-length cDNA
          Length = 483

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 439 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 381



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 163 gagggtgatgcggatgcggtg 143



to top

>emb|CR734923.2|CNS0GTUI Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 445 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 387



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 169 gagggtgatgcggatgcggtg 149



to top

>emb|CR734916.2|CNS0GTUB Tetraodon nigroviridis full-length cDNA
          Length = 483

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 439 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 381



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 163 gagggtgatgcggatgcggtg 143



to top

>emb|CR734480.2|CNS0GTI7 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR734398.2|CNS0GTFX Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR734036.2|CNS0GT5V Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR734019.2|CNS0GT5E Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR733996.2|CNS0GT4R Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 catctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgat 294
           ||||| ||| ||||||||||| ||||  || || || ||||||| ||| |||||||||||
Sbjct: 342 catctgaaagcgatcccaggttttggatccctcaccacagggggtttttctggtggtgat 283

            
Query: 295 g 295
           |
Sbjct: 282 g 282



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR733749.2|CNS0GSXW Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR732672.2|CNS0GS9X Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 445 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 387



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 169 gagggtgatgcggatgcggtg 149



to top

>emb|CR712324.2|CNS0GCKW Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR711720.2|CNS0GC44 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR724810.2|CNS0GM7K Tetraodon nigroviridis full-length cDNA
          Length = 482

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 437 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 379



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 161 gagggtgatgcggatgcggtg 141



to top

>emb|CR721461.2|CNS0GJMJ Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 catctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgat 294
           ||||| ||| ||||||||||| ||||  || || || ||||||| ||| |||||||||||
Sbjct: 340 catctgaaagcgatcccaggttttggatccctcaccacagggggtttttctggtggtgat 281

            
Query: 295 g 295
           |
Sbjct: 280 g 280



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR721261.2|CNS0GJGZ Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR721152.2|CNS0GJDY Tetraodon nigroviridis full-length cDNA
          Length = 483

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR720850.2|CNS0GJ5K Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR719936.2|CNS0GIG6 Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR719195.2|CNS0GHVL Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR719155.2|CNS0GHUH Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR718908.2|CNS0GHNM Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR718540.2|CNS0GHDE Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR718516.2|CNS0GHCQ Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR718464.2|CNS0GHBA Tetraodon nigroviridis full-length cDNA
          Length = 492

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR718172.2|CNS0GH36 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR718131.2|CNS0GH21 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR718037.2|CNS0GGZF Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR717406.2|CNS0GGHW Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR717154.2|CNS0GGAZ Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR717127.2|CNS0GGA8 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR716551.2|CNS0GFU8 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR716346.2|CNS0GFOJ Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR716267.2|CNS0GFMC Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR716217.2|CNS0GFKY Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR716191.2|CNS0GFK8 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR715963.2|CNS0GFDZ Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR715795.2|CNS0GF9B Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| ||||||||||||| ||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatagaggtgatttgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR715714.2|CNS0GF72 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR715674.2|CNS0GF5Y Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR715611.2|CNS0GF47 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR715336.2|CNS0GEWK Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR715001.2|CNS0GEN9 Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 445 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 387



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 169 gagggtgatgcggatgcggtg 149



to top

>emb|CR714583.2|CNS0GEBN Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR714404.2|CNS0GE6O Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR714337.2|CNS0GE4T Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR714272.2|CNS0GE30 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR714257.2|CNS0GE2L Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR713840.2|CNS0GDR0 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR713771.2|CNS0GDP3 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 catctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgat 294
           ||||| ||| ||||||||||| ||||  || || || ||||||| ||| |||||||||||
Sbjct: 342 catctgaaagcgatcccaggttttggatccctcgccacagggggtttttctggtggtgat 283

            
Query: 295 g 295
           |
Sbjct: 282 g 282



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR713597.2|CNS0GDK9 Tetraodon nigroviridis full-length cDNA
          Length = 492

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR712819.2|CNS0GCYN Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



to top

>emb|CR712806.2|CNS0GCYA Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR713255.2|CNS0GDAR Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR713181.2|CNS0GD8P Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR713175.2|CNS0GD8J Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR712632.2|CNS0GCTG Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR712139.2|CNS0GCFR Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR710802.2|CNS0GBEM Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 catctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgat 294
           ||||| ||| ||||||||||| ||||  || || || ||||||| ||| |||||||||||
Sbjct: 341 catctgaaagcgatcccaggttttggatccctcgccacagggggtttttctggtggtgat 282

            
Query: 295 g 295
           |
Sbjct: 281 g 281



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR710639.2|CNS0GBA3 Tetraodon nigroviridis full-length cDNA
          Length = 491

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR710416.2|CNS0GB3W Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR710033.2|CNS0GAT9 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR710027.2|CNS0GAT3 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR709898.2|CNS0GAPI Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR709869.2|CNS0GAOP Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR709412.2|CNS0GAC0 Tetraodon nigroviridis full-length cDNA
          Length = 493

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 449 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 391



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 173 gagggtgatgcggatgcggtg 153



to top

>emb|CR709314.2|CNS0GA9A Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR709295.2|CNS0GA8R Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR709499.2|CNS0GAEF Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR709495.2|CNS0GAEB Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR709450.2|CNS0GAD2 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR709120.2|CNS0GA3W Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR708631.2|CNS0G9QB Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR708538.2|CNS0G9NQ Tetraodon nigroviridis full-length cDNA
          Length = 493

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 449 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 391



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 173 gagggtgatgcggatgcggtg 153



to top

>emb|CR708410.2|CNS0G9K6 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR708379.2|CNS0G9JB Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR708321.2|CNS0G9HP Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR708171.2|CNS0G9DJ Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR708123.2|CNS0G9C7 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR708012.2|CNS0G994 Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR708008.2|CNS0G990 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR707910.2|CNS0G96A Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR707834.2|CNS0G946 Tetraodon nigroviridis full-length cDNA
          Length = 482

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 438 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 380



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 162 gagggtgatgcggatgcggtg 142



to top

>emb|CR707808.2|CNS0G93G Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR707754.2|CNS0G91Y Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR707592.2|CNS0G8XG Tetraodon nigroviridis full-length cDNA
          Length = 492

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR707579.2|CNS0G8X3 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR707501.2|CNS0G8UX Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 catctcaaaccgatcccaggtgttggtaccttctccgcagggggatttcctggtggtgat 294
           ||||| ||| ||||||||||| ||||  || || || ||||||| ||| |||||||||||
Sbjct: 340 catctgaaagcgatcccaggttttggatccctcgccacagggggtttttctggtggtgat 281

            
Query: 295 g 295
           |
Sbjct: 280 g 280



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR707040.2|CNS0G8I4 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR707031.2|CNS0G8HV Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR706992.2|CNS0G8GS Tetraodon nigroviridis full-length cDNA
          Length = 518

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 474 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 416



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 198 gagggtgatgcggatgcggtg 178



to top

>emb|CR706858.2|CNS0G8D2 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR706689.2|CNS0G88D Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR706588.2|CNS0G85K Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR705833.2|CNS0G7KL Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR705619.2|CNS0G7EN Tetraodon nigroviridis full-length cDNA
          Length = 484

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 440 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 382



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 164 gagggtgatgcggatgcggtg 144



to top

>emb|CR705466.2|CNS0G7AE Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR705260.2|CNS0G74O Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR705163.2|CNS0G71Z Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR704309.2|CNS0G6E9 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR703983.2|CNS0G657 Tetraodon nigroviridis full-length cDNA
          Length = 477

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 439 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 381



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 163 gagggtgatgcggatgcggtg 143



to top

>emb|CR703602.2|CNS0G5UM Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR703006.2|CNS0G5E2 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR702686.2|CNS0G556 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR702627.2|CNS0G53J Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR701679.2|CNS0G4D7 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR701426.2|CNS0G466 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR701135.2|CNS0G3Y3 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR700712.2|CNS0G3MC Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR700557.2|CNS0G3I1 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR700518.2|CNS0G3GY Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR699589.2|CNS0G2R5 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR699449.2|CNS0G2N9 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR699079.2|CNS0G2CZ Tetraodon nigroviridis full-length cDNA
          Length = 483

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 439 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 381



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 163 gagggtgatgcggatgcggtg 143



to top

>emb|CR698748.2|CNS0G23S Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR698720.2|CNS0G230 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR698421.2|CNS0G1UP Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR697786.2|CNS0G1D2 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



to top

>emb|CR697270.2|CNS0G0YQ Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR697262.2|CNS0G0YI Tetraodon nigroviridis full-length cDNA
          Length = 492

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR696193.2|CNS0G04T Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR695640.2|CNS0FZPG Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR695493.2|CNS0FZLD Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



to top

>emb|CR695463.2|CNS0FZKJ Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 442 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 384



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 166 gagggtgatgcggatgcggtg 146



to top

>emb|CR695015.2|CNS0FZ83 Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 445 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 387



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR694872.2|CNS0FZ44 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR694861.2|CNS0FZ3T Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR694479.2|CNS0FYT7 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR694108.2|CNS0FYIW Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR694015.2|CNS0FYGB Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR693929.2|CNS0FYDX Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR693035.2|CNS0FXP3 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR691940.2|CNS0FWUO Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR691809.2|CNS0FWR1 Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR691794.2|CNS0FWQM Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR691075.2|CNS0FW6N Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR691044.2|CNS0FW5S Tetraodon nigroviridis full-length cDNA
          Length = 494

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 446 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 388



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR691010.2|CNS0FW4U Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR685887.2|CNS0FS6J Tetraodon nigroviridis full-length cDNA
          Length = 483

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 439 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 381



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 163 gagggtgatgcggatgcggtg 143



to top

>emb|CR690503.2|CNS0FVQR Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR688491.2|CNS0FU6V Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR688438.2|CNS0FU5E Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR689843.2|CNS0FV8F Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR688641.2|CNS0FUB1 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR688563.2|CNS0FU8V Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR688548.2|CNS0FU8G Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR688536.2|CNS0FU84 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR688163.2|CNS0FTXR Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR687772.2|CNS0FTMW Tetraodon nigroviridis full-length cDNA
          Length = 485

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR687758.2|CNS0FTMI Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR686961.2|CNS0FT0D Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR686931.2|CNS0FSZJ Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR686539.2|CNS0FSON Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR686507.2|CNS0FSNR Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR686353.2|CNS0FSJH Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR686159.2|CNS0FSE3 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR685723.2|CNS0FS1Z Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR685330.2|CNS0FRR2 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR685244.2|CNS0FROO Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR681903.2|CNS0FP3V Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR681885.2|CNS0FP3D Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR683945.2|CNS0FQOL Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR683745.2|CNS0FQJ1 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR683522.2|CNS0FQCU Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR683015.2|CNS0FPYR Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR682721.2|CNS0FPQL Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR681830.2|CNS0FP1U Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR681632.2|CNS0FOWC Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR680781.2|CNS0FO8P Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR679799.2|CNS0FNHF Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR678834.2|CNS0FMQM Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR678707.2|CNS0FMN3 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR676461.2|CNS0FKX5 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR675972.2|CNS0FKJU Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR674657.2|CNS0FJJB Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR671739.2|CNS0FHA9 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR669071.2|CNS0FF85 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR669052.2|CNS0FF7M Tetraodon nigroviridis full-length cDNA
          Length = 518

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 474 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 416



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 198 gagggtgatgcggatgcggtg 178



to top

>emb|CR668178.2|CNS0FEJC Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR667682.2|CNS0FE5K Tetraodon nigroviridis full-length cDNA
          Length = 482

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 438 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 380



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 162 gagggtgatgcggatgcggtg 142



to top

>emb|CR666786.2|CNS0FDGO Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR666686.2|CNS0FDDW Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR666050.2|CNS0FCW8 Tetraodon nigroviridis full-length cDNA
          Length = 488

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 444 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 386



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 168 gagggtgatgcggatgcggtg 148



to top

>emb|CR665272.2|CNS0FCAM Tetraodon nigroviridis full-length cDNA
          Length = 487

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 443 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 385



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 167 gagggtgatgcggatgcggtg 147



to top

>emb|CR664210.2|CNS0FBH4 Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 445 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 387



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 169 gagggtgatgcggatgcggtg 149



to top

>emb|CR663451.2|CNS0FAW1 Tetraodon nigroviridis full-length cDNA
          Length = 489

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 133 gatggtcacttcaacctcgacaccgggctcaatggtgatagaggtgatctgcttgacga 191
           ||||||||| || ||||| || || ||||||||| |||| |||||||||||||||||||
Sbjct: 445 gatggtcacctccacctccaccccaggctcaatgctgatggaggtgatctgcttgacga 387



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 409 gagggtgatgcggatgcggtg 429
           |||||||||||||||||||||
Sbjct: 169 gagggtgatgcggatgcggtg 149


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,272,750
Number of Sequences: 3902068
Number of extensions: 4272750
Number of successful extensions: 99830
Number of sequences better than 10.0: 632
Number of HSP's better than 10.0 without gapping: 634
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 97187
Number of HSP's gapped (non-prelim): 2545
length of query: 546
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 523
effective length of database: 17,143,297,704
effective search space: 8965944699192
effective search space used: 8965944699192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top