Clone Name | rbasd2e04 |
---|---|
Clone Library Name | barley_pub |
>gb|AY106290.1| Zea mays PCO139213 mRNA sequence Length = 908 Score = 99.6 bits (50), Expect = 1e-17 Identities = 119/142 (83%) Strand = Plus / Minus Query: 449 gcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccg 508 ||||||| |||||| | || ||||||||||||||||||||||||| ||| ||||| || Sbjct: 823 gcgccgatgcggcgcaatgcagcgtccgccagcttctggcccttgggaccactgccacct 764 Query: 509 agaacgacgccacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcg 568 | | || ||||||||||||||||| ||| || ||||| |||||||||||||| || || Sbjct: 763 aagatgatgccacggaaggcgcagtagaccgcacgggataccttcttgaagaccacgtca 704 Query: 569 tcggcttggaggctcttgagga 590 ||| |||||||||||||||| Sbjct: 703 ccgggctggaggctcttgagga 682 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 368 gggccgtggaccttctccgagaccgtggccaccctgatgagcacttcggccgccttcacc 427 ||||||||||||||||| || ||||| |||||| |||| ||||| || || ||||||| | Sbjct: 905 gggccgtggaccttctctgataccgttgccaccttgatcagcacctcagcagccttcaac 846 Query: 428 accc 431 |||| Sbjct: 845 accc 842
>ref|XM_472605.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2415 Score = 89.7 bits (45), Expect = 1e-14 Identities = 129/157 (82%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||| ||| ||| || || | || || |||||||||| ||||||| | Sbjct: 2321 gcgagcttcgccgcggcgaggcgtcgcagcggcgcttcggccagcttcttgcccttgacg 2262 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| ||| ||||| |||||||| ||||| ||||||| ||| | ||||| ||||| | Sbjct: 2261 ccgccgccgccgaggacgacgccgcggaacgcgcagtagaccgtacgggacaccttgccg 2202 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 |||||||| ||| |||| ||||||||||||||||||| Sbjct: 2201 aagacgacgtcgccggcctggaggctcttgaggagca 2165
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 89.7 bits (45), Expect = 1e-14 Identities = 129/157 (82%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||| ||| ||| || || | || || |||||||||| ||||||| | Sbjct: 21864566 gcgagcttcgccgcggcgaggcgtcgcagcggcgcttcggccagcttcttgcccttgacg 21864507 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| ||| ||||| |||||||| ||||| ||||||| ||| | ||||| ||||| | Sbjct: 21864506 ccgccgccgccgaggacgacgccgcggaacgcgcagtagaccgtacgggacaccttgccg 21864447 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 |||||||| ||| |||| ||||||||||||||||||| Sbjct: 21864446 aagacgacgtcgccggcctggaggctcttgaggagca 21864410 Score = 69.9 bits (35), Expect = 9e-09 Identities = 127/157 (80%), Gaps = 3/157 (1%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||||||| ||| || || | || || || ||||||| ||||||||| Sbjct: 21856019 gcgagcttcgccgcgccgaggcgtcgcagcggcgcttcggctagcttcttgcccttggcg 21855960 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| | ||||| |||||||| |||||||| ||| ||| |||||||| ||||| | Sbjct: 21855959 ccgc---caccgaggacgacgccgcggaaggcaaagtagaccgcccgggacaccttaccg 21855903 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 ||||||| ||| |||| |||||||||||||| |||| Sbjct: 21855902 aagacgatgtcgccggcctggaggctcttgagaagca 21855866 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 430 ccggccagcgagcttcgccgcgccg 454 ||||||||||||||| ||||||||| Sbjct: 13308622 ccggccagcgagcttagccgcgccg 13308646
>emb|AL606452.2|OSJN00007 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000114_01, complete sequence Length = 127713 Score = 89.7 bits (45), Expect = 1e-14 Identities = 129/157 (82%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||| ||| ||| || || | || || |||||||||| ||||||| | Sbjct: 49167 gcgagcttcgccgcggcgaggcgtcgcagcggcgcttcggccagcttcttgcccttgacg 49108 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| ||| ||||| |||||||| ||||| ||||||| ||| | ||||| ||||| | Sbjct: 49107 ccgccgccgccgaggacgacgccgcggaacgcgcagtagaccgtacgggacaccttgccg 49048 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 |||||||| ||| |||| ||||||||||||||||||| Sbjct: 49047 aagacgacgtcgccggcctggaggctcttgaggagca 49011 Score = 69.9 bits (35), Expect = 9e-09 Identities = 127/157 (80%), Gaps = 3/157 (1%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||||||| ||| || || | || || || ||||||| ||||||||| Sbjct: 40620 gcgagcttcgccgcgccgaggcgtcgcagcggcgcttcggctagcttcttgcccttggcg 40561 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| | ||||| |||||||| |||||||| ||| ||| |||||||| ||||| | Sbjct: 40560 ccgc---caccgaggacgacgccgcggaaggcaaagtagaccgcccgggacaccttaccg 40504 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 ||||||| ||| |||| |||||||||||||| |||| Sbjct: 40503 aagacgatgtcgccggcctggaggctcttgagaagca 40467
>ref|XM_466211.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2580 Score = 71.9 bits (36), Expect = 2e-09 Identities = 153/192 (79%) Strand = Plus / Minus Query: 399 ccctgatgagcacttcggccgccttcaccacccggccagcgagcttcgccgcgccgacgc 458 |||||||||| | |||||||| ||||||||||| | | |||||||| |||||||| || Sbjct: 2239 ccctgatgaggatttcggccgatctcaccacccggtcggtgagcttcgtcgcgccgatgc 2180 Query: 459 ggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccgagaacgacgc 518 | | || || ||||| || |||||| | ||| ||||||||||||| ||||| || Sbjct: 2179 gcctcagggcggcgtcggcgagcttccgtcccctggcaccgctgccaccgagggtgatcg 2120 Query: 519 cacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcgtcggcttgga 578 | ||||| || |||| ||| | |||||||||||||||||||||| || |||| |||| Sbjct: 2119 cgcggaacgcacagtagacggaccgggagaccttcttgaagacggggtcatcggtctgga 2060 Query: 579 ggctcttgagga 590 |||||||||||| Sbjct: 2059 ggctcttgagga 2048
>ref|XM_466210.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3911 Score = 71.9 bits (36), Expect = 2e-09 Identities = 153/192 (79%) Strand = Plus / Minus Query: 399 ccctgatgagcacttcggccgccttcaccacccggccagcgagcttcgccgcgccgacgc 458 |||||||||| | |||||||| ||||||||||| | | |||||||| |||||||| || Sbjct: 3570 ccctgatgaggatttcggccgatctcaccacccggtcggtgagcttcgtcgcgccgatgc 3511 Query: 459 ggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccgagaacgacgc 518 | | || || ||||| || |||||| | ||| ||||||||||||| ||||| || Sbjct: 3510 gcctcagggcggcgtcggcgagcttccgtcccctggcaccgctgccaccgagggtgatcg 3451 Query: 519 cacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcgtcggcttgga 578 | ||||| || |||| ||| | |||||||||||||||||||||| || |||| |||| Sbjct: 3450 cgcggaacgcacagtagacggaccgggagaccttcttgaagacggggtcatcggtctgga 3391 Query: 579 ggctcttgagga 590 |||||||||||| Sbjct: 3390 ggctcttgagga 3379
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 71.9 bits (36), Expect = 2e-09 Identities = 153/192 (79%) Strand = Plus / Minus Query: 399 ccctgatgagcacttcggccgccttcaccacccggccagcgagcttcgccgcgccgacgc 458 |||||||||| | |||||||| ||||||||||| | | |||||||| |||||||| || Sbjct: 21079185 ccctgatgaggatttcggccgatctcaccacccggtcggtgagcttcgtcgcgccgatgc 21079126 Query: 459 ggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccgagaacgacgc 518 | | || || ||||| || |||||| | ||| ||||||||||||| ||||| || Sbjct: 21079125 gcctcagggcggcgtcggcgagcttccgtcccctggcaccgctgccaccgagggtgatcg 21079066 Query: 519 cacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcgtcggcttgga 578 | ||||| || |||| ||| | |||||||||||||||||||||| || |||| |||| Sbjct: 21079065 cgcggaacgcacagtagacggaccgggagaccttcttgaagacggggtcatcggtctgga 21079006 Query: 579 ggctcttgagga 590 |||||||||||| Sbjct: 21079005 ggctcttgagga 21078994
>dbj|AP004017.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1008_F08 Length = 105979 Score = 71.9 bits (36), Expect = 2e-09 Identities = 153/192 (79%) Strand = Plus / Minus Query: 399 ccctgatgagcacttcggccgccttcaccacccggccagcgagcttcgccgcgccgacgc 458 |||||||||| | |||||||| ||||||||||| | | |||||||| |||||||| || Sbjct: 80930 ccctgatgaggatttcggccgatctcaccacccggtcggtgagcttcgtcgcgccgatgc 80871 Query: 459 ggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccgagaacgacgc 518 | | || || ||||| || |||||| | ||| ||||||||||||| ||||| || Sbjct: 80870 gcctcagggcggcgtcggcgagcttccgtcccctggcaccgctgccaccgagggtgatcg 80811 Query: 519 cacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcgtcggcttgga 578 | ||||| || |||| ||| | |||||||||||||||||||||| || |||| |||| Sbjct: 80810 cgcggaacgcacagtagacggaccgggagaccttcttgaagacggggtcatcggtctgga 80751 Query: 579 ggctcttgagga 590 |||||||||||| Sbjct: 80750 ggctcttgagga 80739
>dbj|AK073875.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033074B12, full insert sequence Length = 3913 Score = 71.9 bits (36), Expect = 2e-09 Identities = 153/192 (79%) Strand = Plus / Minus Query: 399 ccctgatgagcacttcggccgccttcaccacccggccagcgagcttcgccgcgccgacgc 458 |||||||||| | |||||||| ||||||||||| | | |||||||| |||||||| || Sbjct: 3572 ccctgatgaggatttcggccgatctcaccacccggtcggtgagcttcgtcgcgccgatgc 3513 Query: 459 ggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccgagaacgacgc 518 | | || || ||||| || |||||| | ||| ||||||||||||| ||||| || Sbjct: 3512 gcctcagggcggcgtcggcgagcttccgtcccctggcaccgctgccaccgagggtgatcg 3453 Query: 519 cacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcgtcggcttgga 578 | ||||| || |||| ||| | |||||||||||||||||||||| || |||| |||| Sbjct: 3452 cgcggaacgcacagtagacggaccgggagaccttcttgaagacggggtcatcggtctgga 3393 Query: 579 ggctcttgagga 590 |||||||||||| Sbjct: 3392 ggctcttgagga 3381
>dbj|AK066869.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013083I21, full insert sequence Length = 2580 Score = 71.9 bits (36), Expect = 2e-09 Identities = 153/192 (79%) Strand = Plus / Minus Query: 399 ccctgatgagcacttcggccgccttcaccacccggccagcgagcttcgccgcgccgacgc 458 |||||||||| | |||||||| ||||||||||| | | |||||||| |||||||| || Sbjct: 2239 ccctgatgaggatttcggccgatctcaccacccggtcggtgagcttcgtcgcgccgatgc 2180 Query: 459 ggcgtagagctgcgtccgccagcttctggcccttggcaccgctgcccccgagaacgacgc 518 | | || || ||||| || |||||| | ||| ||||||||||||| ||||| || Sbjct: 2179 gcctcagggcggcgtcggcgagcttccgtcccctggcaccgctgccaccgagggtgatcg 2120 Query: 519 cacggaaggcgcagtggacagcccgggagaccttcttgaagacgacatcgtcggcttgga 578 | ||||| || |||| ||| | |||||||||||||||||||||| || |||| |||| Sbjct: 2119 cgcggaacgcacagtcgacggaccgggagaccttcttgaagacggggtcatcggtctgga 2060 Query: 579 ggctcttgagga 590 |||||||||||| Sbjct: 2059 ggctcttgagga 2048
>ref|XM_472603.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3342 Score = 69.9 bits (35), Expect = 9e-09 Identities = 127/157 (80%), Gaps = 3/157 (1%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||||||| ||| || || | || || || ||||||| ||||||||| Sbjct: 3248 gcgagcttcgccgcgccgaggcgtcgcagcggcgcttcggctagcttcttgcccttggcg 3189 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| | ||||| |||||||| |||||||| ||| ||| |||||||| ||||| | Sbjct: 3188 ccgc---caccgaggacgacgccgcggaaggcaaagtagaccgcccgggacaccttaccg 3132 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 ||||||| ||| |||| |||||||||||||| |||| Sbjct: 3131 aagacgatgtcgccggcctggaggctcttgagaagca 3095
>dbj|AK120173.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013032P11, full insert sequence Length = 3252 Score = 69.9 bits (35), Expect = 9e-09 Identities = 127/157 (80%), Gaps = 3/157 (1%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||||||| ||| || || | || || || ||||||| ||||||||| Sbjct: 2838 gcgagcttcgccgcgccgaggcgtcgcagcggcgcttcggctagcttcttgcccttggcg 2779 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| | ||||| |||||||| |||||||| ||| ||| |||||||| ||||| | Sbjct: 2778 ccgc---caccgaggacgacgccgcggaaggcaaagtagaccgcccgggacaccttaccg 2722 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 ||||||| ||| |||| |||||||||||||| |||| Sbjct: 2721 aagacgatgtcgccggcctggaggctcttgagaagca 2685
>dbj|AK067590.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112G22, full insert sequence Length = 2565 Score = 69.9 bits (35), Expect = 9e-09 Identities = 127/157 (80%), Gaps = 3/157 (1%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||||||| ||| || || | || || || ||||||| ||||||||| Sbjct: 2106 gcgagcttcgccgcgccgaggcgtcgcagcggcgcttcggctagcttcttgcccttggcg 2047 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| | ||||| |||||||| |||||||| ||| ||| |||||||| ||||| | Sbjct: 2046 ccgc---caccgaggacgacgccgcggaaggcaaagtagaccgcccgggacaccttaccg 1990 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 ||||||| ||| |||| |||||||||||||| |||| Sbjct: 1989 aagacgatgtcgccggcctggaggctcttgagaagca 1953
>dbj|AK062183.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-D12, full insert sequence Length = 2955 Score = 69.9 bits (35), Expect = 9e-09 Identities = 127/157 (80%), Gaps = 3/157 (1%) Strand = Plus / Minus Query: 437 gcgagcttcgccgcgccgacgcggcgtagagctgcgtccgccagcttctggcccttggca 496 ||||||||||||||||||| ||| || || | || || || ||||||| ||||||||| Sbjct: 2564 gcgagcttcgccgcgccgaggcgtcgcagcggcgcttcggctagcttcttgcccttggcg 2505 Query: 497 ccgctgcccccgagaacgacgccacggaaggcgcagtggacagcccgggagaccttcttg 556 |||| | ||||| |||||||| |||||||| ||| ||| |||||||| ||||| | Sbjct: 2504 ccgc---caccgaggacgacgccgcggaaggcaaagtagaccgcccgggacaccttaccg 2448 Query: 557 aagacgacatcgtcggcttggaggctcttgaggagca 593 ||||||| ||| |||| |||||||||||||| |||| Sbjct: 2447 aagacgatgtcgccggcctggaggctcttgagaagca 2411
>emb|X51781.1|RSSAG Rat mRNA for retina S-antigen Length = 1482 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 540 cccgggagaccttcttgaagacgacat 566 ||||||||||||||||||||| ||||| Sbjct: 194 cccgggagaccttcttgaagatgacat 168
>emb|X15353.1|RNSAGMR Rat S-Ag mRNA for pineal S-antigen Length = 1367 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 540 cccgggagaccttcttgaagacgacat 566 ||||||||||||||||||||| ||||| Sbjct: 85 cccgggagaccttcttgaagatgacat 59
>ref|NM_013023.2| Rattus norvegicus retinal S-antigen (Sag), mRNA Length = 1482 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 540 cccgggagaccttcttgaagacgacat 566 ||||||||||||||||||||| ||||| Sbjct: 194 cccgggagaccttcttgaagatgacat 168
>gb|M60737.1|RATSANTI Rat S-antigen mRNA, complete cds Length = 1372 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 540 cccgggagaccttcttgaagacgacat 566 ||||||||||||||||||||| ||||| Sbjct: 85 cccgggagaccttcttgaagatgacat 59
>gb|AC022008.4| Homo sapiens chromosome 3 clone RP11-63O1 map 3p, complete sequence Length = 176051 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccatatttg 200 ||||||||||||||||||||| |||| Sbjct: 105753 ttctggagctgggacatccatctttg 105778
>gb|AC185244.2| Pan troglodytes BAC clone CH251-245L20 from chromosome 1, complete sequence Length = 140818 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 124544 ttctggagctgggacatccat 124564
>gb|AC023480.7| Homo sapiens chromosome 3 clone RP11-399K19 map 3p, complete sequence Length = 199814 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccatattt 199 |||||||||||||| |||||||||| Sbjct: 47569 ttctggagctgggatatccatattt 47545
>gb|AC093655.4| Homo sapiens BAC clone RP11-424F6 from 7, complete sequence Length = 119721 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 72924 ttctggagctgggacatccat 72904
>gb|AC073216.7| Homo sapiens BAC clone RP11-521C10 from 7, complete sequence Length = 113530 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 66485 ttctggagctgggacatccat 66465
>emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on chromosome 1 Contains the gene for a novel protein similar to Notch homolog 2 (Drosophila) NOTCH2, a novel gene and a CpG island, complete sequence Length = 204307 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 3795 ttctggagctgggacatccat 3775
>emb|AL596222.13| Human DNA sequence from clone RP11-114O18 on chromosome 1 Contains the 5' end of the NOTCH2 gene for Notch homolog 2 (Drosophila) and a CpG island, complete sequence Length = 107056 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 50315 ttctggagctgggacatccat 50335
>emb|AL583856.6| Human DNA sequence from clone RP11-134K13 on chromosome 6 Contains a novel gene, a spermine synthase (SMS) pseudogene and a CpG island, complete sequence Length = 79555 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 39534 ttctggagctgggacatccat 39554
>emb|AL139009.14| Human DNA sequence from clone RP5-976H8 on chromosome 10p14-15.3, complete sequence Length = 172657 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 71375 ttctggagctgggacatccat 71355
>emb|AL133376.6| Human DNA sequence from clone RP1-76K20 on chromosome 11p13-14.3 Contains GSSs, complete sequence Length = 99228 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 7021 ttctggagctgggacatccat 7001
>gb|AC073493.27| Homo sapiens Xp BAC RP11-631N21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 211422 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 83735 ttctggagctgggacatccat 83755
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 405 tgagcacttcggccgccttca 425 ||||||||||||||||||||| Sbjct: 2963058 tgagcacttcggccgccttca 2963038
>gb|AC009659.5| Homo sapiens chromosome 11, clone RP11-362G8, complete sequence Length = 175372 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 23190 ttctggagctgggacatccat 23170
>gb|AC183687.3| Pan troglodytes BAC clone CH251-25N14 from chromosome 1, complete sequence Length = 192054 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 183069 ttctggagctgggacatccat 183049
>gb|AC011492.8| Homo sapiens chromosome 19 clone CTB-187L3, complete sequence Length = 153064 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 144819 ttctggagctgggacatccat 144799
>gb|AC106747.2| Homo sapiens chromosome 5 clone RP11-152C23, complete sequence Length = 106038 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 98042 ttctggagctgggacatccat 98022
>gb|AC079603.11| Homo sapiens 12 BAC RP11-798I13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164837 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 55 gtagtatatatttacatcata 75 ||||||||||||||||||||| Sbjct: 10454 gtagtatatatttacatcata 10474
>gb|AC106822.3| Homo sapiens chromosome 5 clone RP11-772C9, complete sequence Length = 115988 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 6565 ttctggagctgggacatccat 6545
>gb|AC092793.5| Homo sapiens 12p BAC RP11-74N9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 76000 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 42019 ttctggagctgggacatccat 41999
>gb|AC098864.3| Homo sapiens BAC clone RP11-359L10 from 4, complete sequence Length = 216280 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 25251 ttctggagctgggacatccat 25231
>gb|AC106792.2| Homo sapiens chromosome 5 clone RP11-403M22, complete sequence Length = 84297 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 56449 ttctggagctgggacatccat 56469
>gb|AC099331.2| Homo sapiens chromosome 3 clone RP11-90B15, complete sequence Length = 151498 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 65684 ttctggagctgggacatccat 65704
>gb|AC099557.2| Homo sapiens chromosome 3 clone RP11-613N24, complete sequence Length = 196355 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 68858 ttctggagctgggacatccat 68838
>gb|AC106767.2| Homo sapiens chromosome 5 clone RP11-269M17, complete sequence Length = 143792 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 118025 ttctggagctgggacatccat 118005
>gb|AC016146.18| Homo sapiens 3 BAC RP11-327M20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 190456 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccatattt 199 |||||||||||||| |||||||||| Sbjct: 126983 ttctggagctgggatatccatattt 126959
>gb|AD000091.1|CH19F15314 Homo sapiens DNA from chromosome 19p13.1 cosmid f15314, genomic sequence Length = 41369 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 16577 ttctggagctgggacatccat 16557
>gb|AC022431.6| Homo sapiens chromosome 5 clone CTD-2583B1, complete sequence Length = 173698 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 180 gagctgggacatccatatttgccct 204 |||||||||||||||| |||||||| Sbjct: 155575 gagctgggacatccatctttgccct 155599
>gb|AC009910.5|AC009910 Drosophila melanogaster, chromosome 2L, region 25D-25E, BAC clone BACR35L07, complete sequence Length = 193924 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 345 ttcaggcgagcgctttgtacc 365 ||||||||||||||||||||| Sbjct: 154497 ttcaggcgagcgctttgtacc 154477
>gb|AC018503.6|AC018503 Homo sapiens chromosome 3 clone RP11-41L18 map 3p, complete sequence Length = 191161 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccatattt 199 |||||||||||||| |||||||||| Sbjct: 136230 ttctggagctgggatatccatattt 136254
>gb|AC073065.6| Homo sapiens BAC clone RP11-149O3 from 2, complete sequence Length = 175345 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 116025 ttctggagctgggacatccat 116005
>gb|AC007024.4|AC007024 Homo sapiens PAC clone RP4-664A21 from 7p15, complete sequence Length = 83848 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 40628 ttctggagctgggacatccat 40648
>gb|AC026205.6|AC026205 Homo sapiens chromosome 3 clone RP11-61I9 map 3p, complete sequence Length = 176669 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 75136 ttctggagctgggacatccat 75116
>gb|AC024159.4|AC024159 Homo sapiens chromosome 3 clone RP11-255K15 map 3p, complete sequence Length = 195544 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 142839 ttctggagctgggacatccat 142859
>gb|AC008940.3|AC008940 Homo sapiens chromosome 5 clone CTD-2319M24, complete sequence Length = 131975 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 180 gagctgggacatccatatttgccct 204 |||||||||||||||| |||||||| Sbjct: 8725 gagctgggacatccatctttgccct 8749
>gb|AE003610.3| Drosophila melanogaster chromosome 2L, section 19 of 83 of the complete sequence Length = 260249 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 345 ttcaggcgagcgctttgtacc 365 ||||||||||||||||||||| Sbjct: 197604 ttcaggcgagcgctttgtacc 197584
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 442 cttcgccgcgccgacgcggcg 462 ||||||||||||||||||||| Sbjct: 377221 cttcgccgcgccgacgcggcg 377241
>gb|AC004721.1|AC004721 Drosophila melanogaster DNA sequence (P1 DS03308 (D285)), complete sequence Length = 80628 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 345 ttcaggcgagcgctttgtacc 365 ||||||||||||||||||||| Sbjct: 14418 ttcaggcgagcgctttgtacc 14398
>emb|AL662966.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035B13, complete sequence Length = 145234 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 430 ccggccagcgagcttcgccgcgccg 454 ||||||||||||||| ||||||||| Sbjct: 80721 ccggccagcgagcttagccgcgccg 80745
>gb|AC026167.5| Homo sapiens chromosome 3 clone RP11-140B10 map 3p, complete sequence Length = 188867 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 68559 ttctggagctgggacatccat 68579
>gb|AC117439.5| Homo sapiens 3 BAC RP11-183P11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172676 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ttctggagctgggacatccat 195 ||||||||||||||||||||| Sbjct: 32740 ttctggagctgggacatccat 32760
>gb|AC079936.7| Oryza sativa (japonica cultivar-group) chromosome X clone OSJNBb0061I18, complete sequence Length = 143163 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 430 ccggccagcgagcttcgccg 449 |||||||||||||||||||| Sbjct: 71728 ccggccagcgagcttcgccg 71747
>ref|XM_607870.2| PREDICTED: Bos taurus similar to family with sequence similarity 40, member B (LOC529423), mRNA Length = 2421 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 534 ggacagcccgggagaccttc 553 |||||||||||||||||||| Sbjct: 674 ggacagcccgggagaccttc 693
>gb|AC098885.3| Mus musculus BAC clone RP23-122L17 from 5, complete sequence Length = 211112 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ttacacccaactcctcaaca 50 |||||||||||||||||||| Sbjct: 161524 ttacacccaactcctcaaca 161543
>gb|AC100383.12| Mus musculus chromosome 6, clone RP23-132E3, complete sequence Length = 241050 Score = 40.1 bits (20), Expect = 8.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 59 tatatatttacatcatagacaattacta 86 |||||||||| || |||||||||||||| Sbjct: 139272 tatatatttaaatgatagacaattacta 139299
>emb|CR954985.1| Human DNA sequence from clone XX-HCC1954_35K08, complete sequence Length = 164576 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 477 ccagcttctggcccttggcaccgc 500 ||||| |||||||||||||||||| Sbjct: 144595 ccagcctctggcccttggcaccgc 144618
>gb|AC131886.5| Rattus norvegicus 4 BAC CH230-53A1 (Children's Hospital Oakland Research Institute) complete sequence Length = 222634 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 atatatttacatcatagaca 79 |||||||||||||||||||| Sbjct: 132467 atatatttacatcatagaca 132486
>emb|CR378676.1| Photobacterium profundum SS9 chromosome 2; segment 2/7 Length = 343529 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 attactaatcacattattga 99 |||||||||||||||||||| Sbjct: 8137 attactaatcacattattga 8118
>emb|CR394529.7| Zebrafish DNA sequence from clone CH211-121F17 in linkage group 24, complete sequence Length = 75984 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 75 agacaattactaatcacattattg 98 |||||||||| ||||||||||||| Sbjct: 73007 agacaattacaaatcacattattg 73030
>emb|BX005068.13| Zebrafish DNA sequence from clone DKEY-40H17 in linkage group 1, complete sequence Length = 215007 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 atatatttacatcatagaca 79 |||||||||||||||||||| Sbjct: 211092 atatatttacatcatagaca 211073
>gb|AC087491.5| Homo sapiens chromosome 17, clone RP11-62N23, complete sequence Length = 157216 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 477 ccagcttctggcccttggcaccgc 500 ||||| |||||||||||||||||| Sbjct: 48093 ccagcctctggcccttggcaccgc 48116
>gb|AF435975.1| Homo sapiens dopamine- and cAMP-regulated neuronal phosphoprotein (PPP1R1B) gene, complete cds, alternatively spliced Length = 34765 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 477 ccagcttctggcccttggcaccgc 500 ||||| |||||||||||||||||| Sbjct: 2695 ccagcctctggcccttggcaccgc 2718
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 405 tgagcacttcggccgccttc 424 |||||||||||||||||||| Sbjct: 1712664 tgagcacttcggccgccttc 1712683 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 471 cgtccgccagcttctggccc 490 |||||||||||||||||||| Sbjct: 240986 cgtccgccagcttctggccc 241005
>gb|AF323029.1|AF323029 Sphingomonas capsulata aminopeptidase precursor, gene, partial cds Length = 1923 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 476 gccagcttctggcccttggc 495 |||||||||||||||||||| Sbjct: 281 gccagcttctggcccttggc 262
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 430 ccggccagcgagcttcgccg 449 |||||||||||||||||||| Sbjct: 12432447 ccggccagcgagcttcgccg 12432428
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 279 gacaagaatttacaaccgac 298 |||||||||||||||||||| Sbjct: 11909694 gacaagaatttacaaccgac 11909675
>dbj|AP006177.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0734C01 Length = 163208 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 279 gacaagaatttacaaccgac 298 |||||||||||||||||||| Sbjct: 69049 gacaagaatttacaaccgac 69030
>gb|AC100746.4| Mus musculus chromosome 5, clone RP24-399G21, complete sequence Length = 157682 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 31 ttacacccaactcctcaaca 50 |||||||||||||||||||| Sbjct: 148933 ttacacccaactcctcaaca 148914
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 430 ccggccagcgagcttcgccg 449 |||||||||||||||||||| Sbjct: 12439787 ccggccagcgagcttcgccg 12439768 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,443,826 Number of Sequences: 3902068 Number of extensions: 4443826 Number of successful extensions: 81193 Number of sequences better than 10.0: 76 Number of HSP's better than 10.0 without gapping: 77 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80642 Number of HSP's gapped (non-prelim): 535 length of query: 615 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 592 effective length of database: 17,143,297,704 effective search space: 10148832240768 effective search space used: 10148832240768 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)