ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd1o24 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X63052.1|HVCP29 Hordeum vulgare gene for CP29 precursor for core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) Length = 2689 Score = 781 bits (394), Expect = 0.0 Identities = 396/397 (99%) Strand = Plus / Minus Query: 1 tttacacgtncggcacattcgtactctcatacttttccccggtaaaattcacacagcaca 60 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2381 tttacacgtacggcacattcgtactctcatacttttccccggtaaaattcacacagcaca 2322 Query: 61 tcatgctgcatcgcacgcacgcatgcagctgagcatcaacagccgacggcggcggacggg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2321 tcatgctgcatcgcacgcacgcatgcagctgagcatcaacagccgacggcggcggacggg 2262 Query: 121 caatcaacggccagctcacaggctgggcaccctctcggcggcgccggagatgacggtgag 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2261 caatcaacggccagctcacaggctgggcaccctctcggcggcgccggagatgacggtgag 2202 Query: 181 caggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgcc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2201 caggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgcc 2142 Query: 241 ggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttctt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2141 ggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttctt 2082 Query: 301 gatctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtc 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2081 gatctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtc 2022 Query: 361 gaacgggccgcctgggtggagcttgtcatcgaattcc 397 ||||||||||||||||||||||||||||||||||||| Sbjct: 2021 gaacgggccgcctgggtggagcttgtcatcgaattcc 1985 Score = 161 bits (81), Expect = 3e-36 Identities = 87/90 (96%) Strand = Plus / Minus Query: 396 ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctnggcgacga 455 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 1901 ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctcggcgacga 1842 Query: 456 cggcnaggatcangttgatagggatgctgt 485 |||| ||||||| ||||||||||||||||| Sbjct: 1841 cggcgaggatcaggttgatagggatgctgt 1812
>dbj|AK104824.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-F05, full insert sequence Length = 1157 Score = 418 bits (211), Expect = e-114 Identities = 313/348 (89%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 940 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 881 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 880 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 821 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 820 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 761 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 |||||||||||||||| |||||| | || || || ||||||||||| ||||| ||||||| Sbjct: 760 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 701 Query: 378 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 437 |||||||||| || | ||||| |||||| |||||| ||||||||||||||| ||||||| Sbjct: 700 ggagcttgtcctccagatccaggccgttgatgatccggtagtactcggcgccgccgacga 641 Query: 438 ggacgacctnggcgacgacggcnaggatcangttgatagggatgctgt 485 ||||||||| |||| ||||||| | ||| | |||||| |||||||||| Sbjct: 640 ggacgacctcggcggcgacggcgacgatgaggttgatggggatgctgt 593
>dbj|AK098872.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001B10, full insert sequence Length = 1101 Score = 418 bits (211), Expect = e-114 Identities = 313/348 (89%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 930 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 871 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 870 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 811 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 810 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 751 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 |||||||||||||||| |||||| | || || || ||||||||||| ||||| ||||||| Sbjct: 750 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 691 Query: 378 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 437 |||||||||| || | ||||| |||||| |||||| ||||||||||||||| ||||||| Sbjct: 690 ggagcttgtcctccagatccaggccgttgatgatccggtagtactcggcgccgccgacga 631 Query: 438 ggacgacctnggcgacgacggcnaggatcangttgatagggatgctgt 485 ||||||||| |||| ||||||| | ||| | |||||| |||||||||| Sbjct: 630 ggacgacctcggcggcgacggcgacgatgaggttgatggggatgctgt 583
>dbj|AK061295.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D05, full insert sequence Length = 1186 Score = 418 bits (211), Expect = e-114 Identities = 313/348 (89%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 941 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 882 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 881 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 822 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 821 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 762 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 |||||||||||||||| |||||| | || || || ||||||||||| ||||| ||||||| Sbjct: 761 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 702 Query: 378 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 437 |||||||||| || | ||||| |||||| |||||| ||||||||||||||| ||||||| Sbjct: 701 ggagcttgtcctccagatccaggccgttgatgatccggtagtactcggcgccgccgacga 642 Query: 438 ggacgacctnggcgacgacggcnaggatcangttgatagggatgctgt 485 ||||||||| |||| ||||||| | ||| | |||||| |||||||||| Sbjct: 641 ggacgacctcggcggcgacggcgacgatgaggttgatggggatgctgt 594
>gb|AY105650.1| Zea mays PCO135935 mRNA sequence Length = 1366 Score = 353 bits (178), Expect = 3e-94 Identities = 307/351 (87%) Strand = Plus / Minus Query: 135 ctcacaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccga 194 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1028 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 969 Query: 195 aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcct 254 |||||||||||||||| | |||||||||| ||| || ||||||||||||||||||| Sbjct: 968 aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 909 Query: 255 ggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 314 ||||||||||| | | ||||||||||||||| ||||| |||||||||||||||||||||| Sbjct: 908 ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 849 Query: 315 tgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctg 374 |||| | || ||||||||||||||| |||| ||||| || |||||||| ||||| || | Sbjct: 848 tgaggatggcggcctggtcggggtcgctggccaggcccagggggtcgaaggggccaccgg 789 Query: 375 ggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccga 434 |||| |||||||| |||| |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 788 ggtgcagcttgtcctcgaggtccagtccgttgatgatccggtagtactcggcgccgccga 729 Query: 435 cgaggacgacctnggcgacgacggcnaggatcangttgatagggatgctgt 485 |||||||||||| |||| ||||| | | || |||||| |||||||||| Sbjct: 728 cgaggacgacctccgcgatcacggcgaccaccaggttgatggggatgctgt 678
>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA, complete cds Length = 957 Score = 345 bits (174), Expect = 8e-92 Identities = 306/351 (87%) Strand = Plus / Minus Query: 135 ctcacaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccga 194 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 886 ctcacaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccga 827 Query: 195 aggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcct 254 |||||||||||||||| | |||||||||| ||| || ||||||||||||||||||| Sbjct: 826 aggggtcgctgaggtgcttggcgaggttctcgacggggccttcgccggtgacgtaggcct 767 Query: 255 ggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacct 314 ||||||||||| | | ||||||||||||||| ||||| |||||||||||||||||||||| Sbjct: 766 ggatgaagaaggcgaacatggagaacatggcgagccggccgttcttgatctccttcacct 707 Query: 315 tgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctg 374 |||| | || ||||||||||||||| |||| | ||| || |||||||| ||||| || | Sbjct: 706 tgaggatggcggcctggtcggggtcgctggccaagcccagggggtcgaaggggccaccgg 647 Query: 375 ggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccga 434 |||| |||||||| |||| |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 646 ggtgcagcttgtcctcgaggtccagtccgttgatgatccggtagtactcggcgccgccga 587 Query: 435 cgaggacgacctnggcgacgacggcnaggatcangttgatagggatgctgt 485 |||||||||||| |||| ||||| | | || |||||| |||||||||| Sbjct: 586 cgaggacgacctccgcgatcacggcgaccaccaggttgatggggatgctgt 536
>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0091I11, complete sequence Length = 135993 Score = 337 bits (170), Expect = 2e-89 Identities = 230/250 (92%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 40261 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 40202 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 40201 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 40142 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 40141 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 40082 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 |||||||||||||||| |||||| | || || || ||||||||||| ||||| ||||||| Sbjct: 40081 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 40022 Query: 378 ggagcttgtc 387 |||||||||| Sbjct: 40021 ggagcttgtc 40012 Score = 97.6 bits (49), Expect = 3e-17 Identities = 79/90 (87%) Strand = Plus / Minus Query: 396 ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctnggcgacga 455 |||| |||||| |||||| ||||||||||||||| |||||||||||||||| |||| ||| Sbjct: 39571 ccaggccgttgatgatccggtagtactcggcgccgccgacgaggacgacctcggcggcga 39512 Query: 456 cggcnaggatcangttgatagggatgctgt 485 |||| | ||| | |||||| |||||||||| Sbjct: 39511 cggcgacgatgaggttgatggggatgctgt 39482
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 337 bits (170), Expect = 2e-89 Identities = 230/250 (92%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7581175 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7581116 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 7581115 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7581056 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 7581055 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7580996 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 |||||||||||||||| |||||| | || || || ||||||||||| ||||| ||||||| Sbjct: 7580995 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 7580936 Query: 378 ggagcttgtc 387 |||||||||| Sbjct: 7580935 ggagcttgtc 7580926 Score = 97.6 bits (49), Expect = 3e-17 Identities = 79/90 (87%) Strand = Plus / Minus Query: 396 ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctnggcgacga 455 |||| |||||| |||||| ||||||||||||||| |||||||||||||||| |||| ||| Sbjct: 7580485 ccaggccgttgatgatccggtagtactcggcgccgccgacgaggacgacctcggcggcga 7580426 Query: 456 cggcnaggatcangttgatagggatgctgt 485 |||| | ||| | |||||| |||||||||| Sbjct: 7580425 cggcgacgatgaggttgatggggatgctgt 7580396
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 337 bits (170), Expect = 2e-89 Identities = 230/250 (92%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7651262 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 7651203 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 7651202 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 7651143 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 7651142 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaccttca 7651083 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 |||||||||||||||| |||||| | || || || ||||||||||| ||||| ||||||| Sbjct: 7651082 gcagcgccgcctggtccgggtcgctcgccagccccagcgggtcgaatgggccacctgggt 7651023 Query: 378 ggagcttgtc 387 |||||||||| Sbjct: 7651022 ggagcttgtc 7651013 Score = 97.6 bits (49), Expect = 3e-17 Identities = 79/90 (87%) Strand = Plus / Minus Query: 396 ccagtccgttggtgatcctgtagtactcggcgcctccgacgaggacgacctnggcgacga 455 |||| |||||| |||||| ||||||||||||||| |||||||||||||||| |||| ||| Sbjct: 7650572 ccaggccgttgatgatccggtagtactcggcgccgccgacgaggacgacctcggcggcga 7650513 Query: 456 cggcnaggatcangttgatagggatgctgt 485 |||| | ||| | |||||| |||||||||| Sbjct: 7650512 cggcgacgatgaggttgatggggatgctgt 7650483
>gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-2) mRNA, complete cds Length = 1073 Score = 323 bits (163), Expect = 3e-85 Identities = 301/348 (86%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 881 acaggctaggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 822 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | |||||||| | ||| || |||||||||||||||||||||| Sbjct: 821 ggtcgctgaggtgcttggcgaggttctccacggggccttcgccggtgacgtaggcctgga 762 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 |||||||| | | |||||||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 761 tgaagaaggcgaacatggagaacatcgcgagccggccgttcttgatctccttcaccttga 702 Query: 318 gcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 | | || ||||||||||||||| |||| ||||| || |||||||| ||||| || |||| Sbjct: 701 ggatggcggcctggtcggggtcgctggccaggcccagggggtcgaaggggccaccggggt 642 Query: 378 ggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcctccgacga 437 | |||||||| || | ||||||||||||||||||| ||||||||||||||| ||||||| Sbjct: 641 gcagcttgtcctcaaggtccagtccgttggtgatccggtagtactcggcgccgccgacga 582 Query: 438 ggacgacctnggcgacgacggcnaggatcangttgatagggatgctgt 485 ||||||||| |||| ||||| | | || |||||| |||||||||| Sbjct: 581 ggacgacctccgcgatcacggccaccaccaggttgatggggatgctgt 534
>dbj|D85512.1| Oryza sativa (japonica cultivar-group) CP26 mRNA, partial sequence Length = 556 Score = 274 bits (138), Expect = 3e-70 Identities = 180/194 (92%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 395 acaggctgggcgtcctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 336 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | | |||||||||| ||| ||||||||||||||||||||||||| Sbjct: 335 ggtcgctgaggtgcttggagaggttctcgacggggccctcgccggtgacgtaggcctgga 276 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||| | Sbjct: 275 tgaagaaccccagcatggagaacatggccagccgcccgttcttgatctccttcaacttca 216 Query: 318 gcagcgccgcctgg 331 ||||||||| |||| Sbjct: 215 gcagcgccgtctgg 202
>gb|AY855171.1| Eleusine coracana subsp. coracana clone 1 light harvesting protein mRNA, partial cds Length = 364 Score = 216 bits (109), Expect = 5e-53 Identities = 172/193 (89%) Strand = Plus / Minus Query: 138 acaggctgggcaccctctcggcggcgccggagatgacggtgagcaggttgttgccgaagg 197 |||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||| Sbjct: 193 acaggctgggtgccctctcggcggcaccagagatgacggtgagcaggttgttgccgaagg 134 Query: 198 ggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctgga 257 ||||||||||||| | |||||||||| ||| ||| |||| |||||||||||||||| Sbjct: 133 ggtcgctgaggtgcttggcgaggttctcgacgggacccccgcctgtgacgtaggcctgga 74 Query: 258 tgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttga 317 | |||||| | | |||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 73 taaagaaggcgaacatggagaacatggccagcctgccgttcttgatctccttcaccttga 14 Query: 318 gcagcgccgcctg 330 |||| |||||||| Sbjct: 13 gcagagccgcctg 1
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 123 bits (62), Expect = 6e-25 Identities = 143/170 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| |||||| || | ||||||| Sbjct: 505 aggttctcgatgggtcccttgccggtgacgatggcctggacgaagaacccaaacatggag 446 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || |||||||||| |||||||||||||||| ||| || ||||||| Sbjct: 445 aacatggcgaggcggccgttcttgagctccttcaccttgagctccgcggcggtgtcgggg 386 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagcttgtc 387 || |||||| |||||||||||||||| |||||| |||| || |||||| Sbjct: 385 tcatcggcgagcccgagcgggtcgaacgcgccgccggggtagaccttgtc 336
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 10793709 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 10793650 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 10793649 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 10793590 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 10793589 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 10793545 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Minus Query: 284 gccagccgtccgttcttgatctccttcacctt 315 ||||| || ||||||||||||||||||||||| Sbjct: 7133596 gccaggcgaccgttcttgatctccttcacctt 7133565
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 17432 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 17373 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 17372 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 17313 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 17312 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 17268
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 130327 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 130268 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 130267 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 130208 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 130207 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 130163
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 777 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 718 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 717 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 658 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 657 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 613
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 663 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 662 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 618
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 665 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 664 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 620
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 663 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 662 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 618
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 121 bits (61), Expect = 2e-24 Identities = 139/165 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 782 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 723 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||||||||||||||||| ||| | |||||| Sbjct: 722 aacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcgggg 663 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 662 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 618
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 119 bits (60), Expect = 9e-24 Identities = 114/132 (86%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || ||||||||||| ||| |||| |||||| Sbjct: 1495 gttgttggcgacggggtcggcgatgtggtcggccaggttctcgatggggcccttgccggt 1436 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||| | ||||||||| | ||||||||||||||||||||| ||||||||||| Sbjct: 1435 gacgatggcctgaacgaagaagccgaacatggagaacatggccagccgcccgttcttgat 1376 Query: 304 ctccttcacctt 315 |||||||||||| Sbjct: 1375 ctccttcacctt 1364
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 117 bits (59), Expect = 3e-23 Identities = 163/195 (83%), Gaps = 2/195 (1%) Strand = Plus / Plus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 79011 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 79070 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 79071 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 79130 Query: 304 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 362 |||||||||||||||| || || | ||| |||||| |||||||||||||||||||| Sbjct: 79131 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 79189 Query: 363 acgggccgcctgggt 377 | | ||||||||||| Sbjct: 79190 aggcgccgcctgggt 79204
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 117 bits (59), Expect = 3e-23 Identities = 163/195 (83%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 21808805 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21808746 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 21808745 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21808686 Query: 304 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 362 |||||||||||||||| || || | ||| |||||| |||||||||||||||||||| Sbjct: 21808685 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 21808627 Query: 363 acgggccgcctgggt 377 | | ||||||||||| Sbjct: 21808626 aggcgccgcctgggt 21808612
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 117 bits (59), Expect = 3e-23 Identities = 163/195 (83%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 21801834 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 21801775 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 21801774 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 21801715 Query: 304 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 362 |||||||||||||||| || || | ||| |||||| |||||||||||||||||||| Sbjct: 21801714 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 21801656 Query: 363 acgggccgcctgggt 377 | | ||||||||||| Sbjct: 21801655 aggcgccgcctgggt 21801641
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 117 bits (59), Expect = 3e-23 Identities = 163/195 (83%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 804 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 745 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 744 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 685 Query: 304 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 362 |||||||||||||||| || || | ||| |||||| |||||||||||||||||||| Sbjct: 684 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 626 Query: 363 acgggccgcctgggt 377 | | ||||||||||| Sbjct: 625 aggcgccgcctgggt 611
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 117 bits (59), Expect = 3e-23 Identities = 163/195 (83%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 379 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 320 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 319 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 260 Query: 304 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 362 |||||||||||||||| || || | ||| |||||| |||||||||||||||||||| Sbjct: 259 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 201 Query: 363 acgggccgcctgggt 377 | | ||||||||||| Sbjct: 200 aggcgccgcctgggt 186
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 117 bits (59), Expect = 3e-23 Identities = 163/195 (83%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||| |||| || | |||||||||| ||| |||| |||||| Sbjct: 785 gttgttggcgacggggtcggtgacgtggtcgaagaggttctcgatggggcccttgccggt 726 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| |||||| || | ||||||||||||||| || || |||||||||| Sbjct: 725 gacgatggcctggacgaagaatccgaacatggagaacatggcgaggcggccgttcttgag 666 Query: 304 ctccttcaccttgagcagcgccgcctg-gtcggggtcggtggcgaggccgagcgggtcga 362 |||||||||||||||| || || | ||| |||||| |||||||||||||||||||| Sbjct: 665 ctccttcaccttgagc-tcggcgaaggtgtcagggtcgtcggcgaggccgagcgggtcga 607 Query: 363 acgggccgcctgggt 377 | | ||||||||||| Sbjct: 606 aggcgccgcctgggt 592
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 713 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 654 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 653 aacatggcgaggcggccgttcttgatctccttcaccttgagc 612
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 23604256 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 23604197 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 23604196 aacatggcgaggcggccgttcttgatctccttcaccttgagc 23604155 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 30025084 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 30025025 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 30025024 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 30024965 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 30024964 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 30024917
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 66955 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 66896 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 66895 aacatggcgaggcggccgttcttgatctccttcaccttgagc 66854
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 784 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 725 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 724 aacatggcgaggcggccgttcttgatctccttcaccttgagc 683
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 783 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 724 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 723 aacatggcgaggcggccgttcttgatctccttcaccttgagc 682
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 115 bits (58), Expect = 1e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 1213 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1154 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 1153 aacatggcgaggcggccgttcttgatctccttcaccttgagc 1112 Score = 48.1 bits (24), Expect = 0.027 Identities = 36/40 (90%) Strand = Plus / Minus Query: 343 ggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 1088 ggcgaggccgagcgggtcgaaggcgccgcccgggtagagc 1049
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 113 bits (57), Expect = 5e-22 Identities = 138/165 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 763 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 704 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || || |||||||||||||||||||||||| ||| | |||||| Sbjct: 703 aacatggcgaggcggcctttcttgatctccttcaccttgagctccgcgaacgcctcgggg 644 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 || ||||||||||||||||||||| | |||||| |||| |||| Sbjct: 643 tcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagc 599
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 676 ctccttgaccttgagc 661 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 647 cggggtcgtcggcgaggccgagcgggtcgaa 617
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 700 ctccttgaccttgagc 685 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 700 ctccttgaccttgagc 685 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 822 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 763 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 762 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 703 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 702 ctccttgaccttgagc 687 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 673 cggggtcgtcggcgaggccgagcgggtcgaa 643
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 707 ctccttgaccttgagc 692 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 678 cggggtcgtcggcgaggccgagcgggtcgaa 648
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 860 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 801 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 800 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 741 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 740 ctccttgaccttgagc 725 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 711 cggggtcgtcggcgaggccgagcgggtcgaa 681
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 111 bits (56), Expect = 2e-21 Identities = 134/160 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| ||||||||| | ||||||| Sbjct: 1174 aggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaacatggag 1115 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctggtcgggg 337 |||||||| || || ||||||||||||| ||||||||||||| ||| | |||||| Sbjct: 1114 aacatggcgaggcggccgttcttgatcttcttcaccttgagctccgcgcacgcctcgggg 1055 Query: 338 tcggtggcgaggccgagcgggtcgaacgggccgcctgggt 377 || ||||||||||||||||||||| | |||||| |||| Sbjct: 1054 tcatcggcgaggccgagcgggtcgaaggcgccgccggggt 1015
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 22434833 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 22434774 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 22434773 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 22434714 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 22434713 ctccttgaccttgagc 22434698 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 22434684 cggggtcgtcggcgaggccgagcgggtcgaa 22434654 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Minus Query: 280 catggccagccgtccgttcttgatctcctt 309 |||||| ||||| ||||||||||||||||| Sbjct: 23305209 catggcgagccgcccgttcttgatctcctt 23305180 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 cgccgcctggtcggggtcgg 341 |||||||||||||||||||| Sbjct: 19834168 cgccgcctggtcggggtcgg 19834187
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 95900 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 95841 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 95840 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 95781 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 95780 ctccttgaccttgagc 95765 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 95751 cggggtcgtcggcgaggccgagcgggtcgaa 95721
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 796 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 737 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 736 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 677 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 676 ctccttgaccttgagc 661 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 647 cggggtcgtcggcgaggccgagcgggtcgaa 617
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 700 ctccttgaccttgagc 685 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 820 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 761 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 760 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 701 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 700 ctccttgaccttgagc 685 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 671 cggggtcgtcggcgaggccgagcgggtcgaa 641
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 825 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 766 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 765 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 706 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 705 ctccttgaccttgagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 827 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 768 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 767 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 708 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 707 ctccttgaccttgagc 692 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 678 cggggtcgtcggcgaggccgagcgggtcgaa 648
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 111 bits (56), Expect = 2e-21 Identities = 116/136 (85%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 793 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 734 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||||| ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 733 gacgatggcctggacgaagaagccgaacatggagaacatggcgaggcggccgttcttgag 674 Query: 304 ctccttcaccttgagc 319 |||||||||||||||| Sbjct: 673 ctccttcaccttgagc 658
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||| | ||||||||| | ||||||| Sbjct: 791 aggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagccgaacatggag 732 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 731 aacatggcgaggcggccgttcttgatctccttcaccttgagc 690
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 107 bits (54), Expect = 3e-20 Identities = 159/194 (81%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 437 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 378 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||| | ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 377 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 318 Query: 304 ctccttcaccttgagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||||||||||||||| || || ||| |||||| ||||||||| ||||||||||| Sbjct: 317 ctccttcaccttgagctcggcggcggtgtccgggtcgtcggcgaggcccagcgggtcgaa 258 Query: 364 cgggccgcctgggt 377 | |||||| |||| Sbjct: 257 ggcgccgccggggt 244
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 747 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 688 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 687 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 628 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 627 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 580
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Plus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 13927 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 13986 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 13987 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 14046 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 14047 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 14094
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 103 bits (52), Expect = 5e-19 Identities = 85/96 (88%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||||| ||| |||| |||||| ||| |||||||| |||||| || | ||||||||| Sbjct: 634 gttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggagaa 575 Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 ||| |||||||||||||||||||||||||||||||| Sbjct: 574 catcgccagccgtccgttcttgatctccttcacctt 539
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 21074 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 21015 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 21014 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 20955 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 20954 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 20907
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 103 bits (52), Expect = 5e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| |||||||| || |||||||||| ||| |||| |||||||||| ||||| Sbjct: 2670 ggggtcggtgaggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctg 2611 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 | ||||||||| | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 2610 cacgaagaagccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 2551 Query: 316 gagc 319 |||| Sbjct: 2550 gagc 2547
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 103 bits (52), Expect = 5e-19 Identities = 115/136 (84%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| || |||| || | |||||||||| ||| |||| |||||| Sbjct: 789 gttgttggcgacggggtcggcgacgtggtcgaagaggttctcgatggggcccttgccggt 730 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| |||||| | ||||||||| | ||||||||||||||| || || |||||||||| Sbjct: 729 gacgatggcctgcacgaagaagccgaacatggagaacatggcaaggcggccgttcttgag 670 Query: 304 ctccttcaccttgagc 319 |||||||||||||||| Sbjct: 669 ctccttcaccttgagc 654
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 708 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 661
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 828 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 769 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 768 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 709 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 708 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 661
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 103 bits (52), Expect = 5e-19 Identities = 115/136 (84%) Strand = Plus / Minus Query: 184 gttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggt 243 ||||||| ||| ||||||| ||||||| || ||||||||| ||||| |||| |||||| Sbjct: 821 gttgttggcgacggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggt 762 Query: 244 gacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgat 303 |||| || ||||| ||||||||| | ||||||||||||||| || || || |||||||| Sbjct: 761 gacgatggtctggacgaagaagccgaacatggagaacatggcgaggcggccattcttgat 702 Query: 304 ctccttcaccttgagc 319 |||||| ||||||||| Sbjct: 701 ctccttgaccttgagc 686 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 672 cggggtcgtcggcgaggccgagcgggtcgaa 642
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 103 bits (52), Expect = 5e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711 Query: 316 gagc 319 |||| Sbjct: 710 gagc 707
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 103 bits (52), Expect = 5e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| ||||| |||| |||||||||| |||||| Sbjct: 813 ggggtcggcgaggtggtcgagcaggttctccaaggggcccttgccggtgacgatggcctg 754 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || ||||||||| | ||||||||||||||| || || || |||||||||||||| ||||| Sbjct: 753 gacgaagaagccgaacatggagaacatggcgaggcggccattcttgatctccttgacctt 694 Query: 316 gagc 319 |||| Sbjct: 693 gagc 690 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 333 cggggtcggtggcgaggccgagcgggtcgaa 363 |||||||| ||||||||||||||||||||| Sbjct: 676 cggggtcgtcggcgaggccgagcgggtcgaa 646
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 103 bits (52), Expect = 5e-19 Identities = 139/168 (82%) Strand = Plus / Minus Query: 196 ggggtcgctgaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctg 255 ||||||| ||||||| || ||||||||| | ||||||| |||||||||| |||||| Sbjct: 830 ggggtcggcgaggtggtcggccaggttctccagtggccccttgccggtgacgatggcctg 771 Query: 256 gatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || |||||| || | ||||||||||||||| || || ||||||||||||||||||||||| Sbjct: 770 gacgaagaacccgaacatggagaacatggcgaggcggccgttcttgatctccttcacctt 711 Query: 316 gagcagcgccgcctggtcggggtcggtggcgaggccgagcgggtcgaa 363 |||| || | ||||||||| ||||||||||||||||||||| Sbjct: 710 gagctcggcgaacgcctcggggtcgtcggcgaggccgagcgggtcgaa 663
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m7 (Lhcbm7) mRNA, complete cds Length = 1016 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 719 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 660 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| || ||||||||||||||||||||||| Sbjct: 659 gaacatggccaggcggccgttcttgatctccttcacctt 621
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 720 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 661 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| || ||||||||||||||||||||||| Sbjct: 660 gaacatggccaggcggccgttcttgatctccttcacctt 622
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b binding protein (LhcII-1.3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1100 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 714 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 655 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| || ||||||||||||||||||||||| Sbjct: 654 gaacatggccaggcggccgttcttgatctccttcacctt 616
>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1107 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 748 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 689 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| || ||||||||||||||||||||||| Sbjct: 688 gaacatggccaggcggccgttcttgatctccttcacctt 650
>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1835 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 1590 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1531 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| || ||||||||||||||||||||||| Sbjct: 1530 gaacatggccaggcggccgttcttgatctccttcacctt 1492
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 99.6 bits (50), Expect = 8e-18 Identities = 89/102 (87%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||||| |||| |||| | | ||||| Sbjct: 313 aggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccgaacctggag 254 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || ||||||||||||||||||||||||||| Sbjct: 253 aacatggcgaggcggccgttcttgatctccttcaccttgagc 212
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||||| |||||||| ||||||||| |||||| | |||||| || | ||||||||| Sbjct: 900 gttctcgaggggccccttcccggtgacgatggcctgcacgaagaatccgaacatggagaa 841 Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 ||||||||| |||||||||||||||||||| ||||| Sbjct: 840 catggccaggcgtccgttcttgatctccttgacctt 805
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||||| ||| |||| ||||||||| |||||| | |||||| || | ||||||||| Sbjct: 1120 gttctcgagggggcccttcccggtgacgatggcctgcacgaagaacccgaacatggagaa 1061 Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 ||||||||| |||||||||||||||||||||||||| Sbjct: 1060 catggccaggcgtccgttcttgatctccttcacctt 1025
>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb3) mRNA, complete cds Length = 1314 Score = 93.7 bits (47), Expect = 5e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 233 ccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgt 292 |||| |||||| ||| |||||||| ||||||||| | |||||||||||||||||| || Sbjct: 758 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 699 Query: 293 ccgttcttgatctccttcacctt 315 ||||||||||||||||||||||| Sbjct: 698 ccgttcttgatctccttcacctt 676
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein precursor (cabII-2) mRNA, complete cds Length = 1068 Score = 93.7 bits (47), Expect = 5e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 702 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 643 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||| ||||| || ||||||||||||||||||||||| Sbjct: 642 gaacatagccaggcggccgttcttgatctccttcacctt 604
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1256 Score = 93.7 bits (47), Expect = 5e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 718 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 659 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||| ||||| || ||||||||||||||||||||||| Sbjct: 658 gaacatagccaggcggccgttcttgatctccttcacctt 620
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1508 Score = 93.7 bits (47), Expect = 5e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 1399 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1340 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||||| ||||| || ||||||||||||||||||||||| Sbjct: 1339 gaacatagccaggcggccgttcttgatctccttcacctt 1301
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 91.7 bits (46), Expect = 2e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 206 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaag 265 |||||| || ||||||||| | ||| |||| |||||| ||| |||||| | ||||||| Sbjct: 733 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 674 Query: 266 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || | |||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 673 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 624
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 91.7 bits (46), Expect = 2e-15 Identities = 88/102 (86%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| || |||| |||||||||| |||||||| ||||||||| | |||||| Sbjct: 1607 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccgaacatggaa 1548 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || |||||||||| |||||||||||||||| Sbjct: 1547 aacatggcgaggcggccgttcttgagctccttcaccttgagc 1506
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||||| ||| |||| |||||||||| |||||||| |||||| |||| ||||||||| Sbjct: 764 gttctcgatggggcccttgccggtgacgatggcctggacgaagaaacccaacatggagaa 705 Query: 280 catggccagccgtccgttcttgatctccttcaccttga 317 |||||| || || ||||| |||| |||||||||||||| Sbjct: 704 catggcgaggcggccgttattgaactccttcaccttga 667
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 91.7 bits (46), Expect = 2e-15 Identities = 94/110 (85%) Strand = Plus / Minus Query: 206 aggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaag 265 |||||| || ||||||||| | ||| |||| |||||| ||| |||||| | ||||||| Sbjct: 717 aggtggtcggacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaag 658 Query: 266 cccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || | |||||||||||||||||| || ||||||||||||||||||||||| Sbjct: 657 ccgaacatggagaacatggccaggcggccgttcttgatctccttcacctt 608
>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m1 gene, complete cds; nuclear gene for chloroplast product Length = 1934 Score = 89.7 bits (45), Expect = 8e-15 Identities = 87/101 (86%) Strand = Plus / Minus Query: 215 cacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatg 274 |||||||||| | ||| |||| |||||| ||| |||||| | ||||||||| | |||| Sbjct: 1432 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1373 Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || ||||||||||||||||||||||| Sbjct: 1372 gagaacatggccaggcggccgttcttgatctccttcacctt 1332
>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 1781 Score = 89.7 bits (45), Expect = 8e-15 Identities = 87/101 (86%) Strand = Plus / Minus Query: 215 cacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatg 274 |||||||||| | ||| |||| |||||| ||| |||||| | ||||||||| | |||| Sbjct: 1345 cacaggttctgcagggggcccttgccggtcacgatggcctgaacgaagaagccgaacatg 1286 Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || ||||||||||||||||||||||| Sbjct: 1285 gagaacatggccaggcggccgttcttgatctccttcacctt 1245
>dbj|AB050007.2| Chlamydomonas reinhardtii lhcb5 mRNA for CP26, complete cds Length = 952 Score = 87.7 bits (44), Expect = 3e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 228 agggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggcca 287 |||| ||||||||||| ||||||| ||||| | ||||||||||| ||||| |||||||| Sbjct: 827 aggggccctcgccggtcacgtaggactggacggcgaagcccagcacggagaccatggcca 768 Query: 288 gccgtccgttcttgatctccttcacctt 315 | || ||||||||||||||||| ||||| Sbjct: 767 ggcggccgttcttgatctccttgacctt 740 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 172 gacggtgagcaggttgttgccgaaggggtcg 202 |||||| |||||||||| ||||||||||||| Sbjct: 883 gacggtcagcaggttgtagccgaaggggtcg 853
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 87.7 bits (44), Expect = 3e-14 Identities = 86/100 (86%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| || |||| |||||||||| |||||||| |||||| || | ||||||| Sbjct: 737 aggttctcgagcgggcccttgccggtgacgatggcctggacgaagaacccgaacatggag 678 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttga 317 |||||||| || || |||||||||| |||||||||||||| Sbjct: 677 aacatggcgaggcggccgttcttgagctccttcaccttga 638 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 343 ggcgaggccgagcgggtcgaacgggccgcctgggtggagc 382 ||||||||||||||||||||||| |||||| |||| |||| Sbjct: 612 ggcgaggccgagcgggtcgaacgtgccgccggggtagagc 573
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 83.8 bits (42), Expect = 5e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 259 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcac 312 ||||||||| | ||||||||||||||||| |||||||||||||||||||||||| Sbjct: 785 gaagaagccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 732
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 83.8 bits (42), Expect = 5e-13 Identities = 51/54 (94%) Strand = Plus / Minus Query: 259 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcac 312 ||||||||| | ||||||||||||||||| |||||||||||||||||||||||| Sbjct: 778 gaagaagccgaacatggagaacatggccaaccgtccgttcttgatctccttcac 725
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 83.8 bits (42), Expect = 5e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | |||||||||| |||||||| |||||| || | ||||||| Sbjct: 798 aggttctcgatggggcctttgccggtgacgatggcctggacgaagaaaccgaacatggag 739 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||| || |||||||||| |||||| ||||| Sbjct: 738 aacatggccaggcggccgttcttgagctccttaacctt 701
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 81.8 bits (41), Expect = 2e-12 Identities = 53/57 (92%) Strand = Plus / Minus Query: 259 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||| | ||||||||||||||||||||| |||||||| |||||||||||||| Sbjct: 627 gaagaagccgaacatggagaacatggccagccgcccgttctttatctccttcacctt 571
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 79.8 bits (40), Expect = 8e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||| || ||||||| |||||| ||| ||||||| ||||||||| | |||||| || Sbjct: 397 gttctccaatggccccttgccggtcacgatcgcctggacgaagaagccgaacatggataa 338 Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 ||||||||||| || |||||||||||||||||||| Sbjct: 337 catggccagcctgccattcttgatctccttcacctt 302 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 332 tcggggtcggtggcgaggccgagcgggtcgaa 363 ||||||||| ||||||||| ||||||||||| Sbjct: 285 tcggggtcgtcggcgaggccaagcgggtcgaa 254
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 79.8 bits (40), Expect = 8e-12 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgkacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || ||||||||||||||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 79.8 bits (40), Expect = 8e-12 Identities = 87/100 (87%), Gaps = 2/100 (2%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 726 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 667 Query: 277 gaacatggcc-agccgtccgttcttgatctccttcacctt 315 |||||||||| || || ||||||||||||||||||||||| Sbjct: 666 gaacatggccaaggcg-ccgttcttgatctccttcacctt 628
>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc II) mRNA, partial cds; nuclear gene for chloroplast product Length = 537 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Minus Query: 233 ccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgt 292 |||| |||||| ||| |||||| | ||||||||| | |||| |||||||||||| || Sbjct: 476 ccctggccggtcacgatggcctgcacgaagaagccgaacatgctgaacatggccagacga 417 Query: 293 ccgttcttgatctccttcaccttgagc 319 ||||||||||||||||||||||||||| Sbjct: 416 ccgttcttgatctccttcaccttgagc 390
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m6 mRNA, complete cds; nuclear gene for chloroplast product Length = 1094 Score = 77.8 bits (39), Expect = 3e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 729 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 670 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||| ||||| || ||||||||||||||||||||||| Sbjct: 669 gaacgatgccaggcggccgttcttgatctccttcacctt 631
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Minus Query: 233 ccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgt 292 |||| |||||||||| |||||||| |||||| || | |||||||||||| || |||| | Sbjct: 761 cccttgccggtgacgatggcctggacgaagaatccgaacatggagaacatagctagcctt 702 Query: 293 ccgttcttgatctccttcaccttgagc 319 || ||||||| |||||||||||||||| Sbjct: 701 ccattcttgagctccttcaccttgagc 675
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1) gene, complete cds Length = 2290 Score = 77.8 bits (39), Expect = 3e-11 Identities = 84/99 (84%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatgga 276 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | |||||| Sbjct: 1750 caggttctggacggggcccttgccggtcacgatggcctggacgaagaagccgaacatgga 1691 Query: 277 gaacatggccagccgtccgttcttgatctccttcacctt 315 |||| ||||| || ||||||||||||||||||||||| Sbjct: 1690 gaacgatgccaggcggccgttcttgatctccttcacctt 1652
>ref|NM_117102.3| Arabidopsis thaliana LHCB5 (LIGHT HARVESTING COMPLEX OF PHOTOSYSTEM II 5); chlorophyll binding AT4G10340 (LHCB5) mRNA, complete cds Length = 1208 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 792 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 733 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 732 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 682
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 75.8 bits (38), Expect = 1e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| || |||| ||||||||| |||||||| |||||| || | ||||||| Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || || ||||||| |||||||||||||||| Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636
>gb|AF339718.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At4g10340) mRNA, complete cds Length = 893 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 608 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 549 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 548 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 498
>gb|AF326900.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At4g10340) mRNA, complete cds Length = 998 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 660 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 601 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 600 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 550
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 815 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 756 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 755 aacatggccaaccgcccgttcttgatctccttcacctt 718
>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 752 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||||| |||||| | |||||| || | |||||| Sbjct: 742 aggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaacatggaa 683 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || |||||||||| |||||||||||| Sbjct: 682 aacatggccaagcgcccgttcttgagctccttcacctt 645
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgaacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || ||||||||||||||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtcccttcccggtgacgatggcctgaacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || ||||||||||||||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648
>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648
>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 762 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 685 aacatggccaaccgcccgttcttgatctccttcacctt 648
>gb|AY070466.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds Length = 1950 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Plus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 45 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 104 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 105 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 155
>gb|AF424597.1|AF424597 Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds Length = 1027 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 660 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 601 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 600 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 550
>gb|AY054126.1| Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds Length = 843 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 608 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 549 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 548 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 498
>gb|AF380631.1|AF380631 Arabidopsis thaliana AT4g10340/F24G24_140 mRNA, complete cds Length = 982 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 660 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 601 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 600 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 550
>emb|BX829238.1|CNS0A4DW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL83ZF07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 641 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 582 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 581 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 531
>emb|BX826540.1|CNS0A4GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB37ZC03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 989 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 640 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 581 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 580 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 530
>emb|BX826592.1|CNS0A355 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB45ZA02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 647 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 588 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 587 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 537
>gb|AF134129.1| Arabidopsis thaliana Lhcb5 protein (Lhcb5) mRNA, complete cds Length = 1029 Score = 75.8 bits (38), Expect = 1e-10 Identities = 92/111 (82%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcggcgcct 430 |||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||| || Sbjct: 655 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcggctcca 596 Query: 431 ccgacgaggacgacctnggcgacgacggcnaggatcangttgatagggatg 481 |||| ||| || |||| || || ||||| || | | ||||||||||||| Sbjct: 595 ccgaggagaacaacctcagcaactacggcgagaacaaggttgatagggatg 545
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 1893 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 1834 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 1833 aacatggccaaccgcccgttcttgatctccttcacctt 1796
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 75.8 bits (38), Expect = 1e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| || |||| ||||||||| |||||||| |||||| || | ||||||| Sbjct: 1737 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggag 1678 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || || ||||||| |||||||||||||||| Sbjct: 1677 aacatggcgaggcggcccttcttgagctccttcaccttgagc 1636
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 75.8 bits (38), Expect = 1e-10 Identities = 83/98 (84%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| || | ||||||||| |||||| | |||||| || | |||||| Sbjct: 216 aggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaa 157 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| ||| ||||||||||||||||||||||| Sbjct: 156 aacatggccaaccgcccgttcttgatctccttcacctt 119
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 75.8 bits (38), Expect = 1e-10 Identities = 77/90 (85%) Strand = Plus / Minus Query: 230 ggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagc 289 ||||||| |||||||||| |||||||| || || || | |||||| |||||||| || Sbjct: 755 ggccccttgccggtgacgatggcctggacaaaaaacccgaacatggataacatggcgagg 696 Query: 290 cgtccgttcttgatctccttcaccttgagc 319 || ||||||||||||||||||||||||||| Sbjct: 695 cggccgttcttgatctccttcaccttgagc 666
>emb|X61915.1|PTCABP P.thunbergii cab gene Length = 5419 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||||||||||||| |||||||| |||||||||||||| Sbjct: 2943 catggagaacatggccagccgaccgttcttaatctccttcacctt 2899
>gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding protein (Cab) mRNA, partial cds Length = 583 Score = 73.8 bits (37), Expect = 5e-10 Identities = 43/45 (95%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||||||||||||| |||||||| |||||||||||||| Sbjct: 329 catggagaacatggccagccgaccgttcttaatctccttcacctt 285
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 73.8 bits (37), Expect = 5e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 259 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||| | ||||||||||||||||||||| |||||||| | |||||||||||| Sbjct: 760 gaagaagccgaacatggagaacatggccagccgcccgttctttagctccttcacctt 704
>gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll a/b binding protein (CipLhcb3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1047 Score = 73.8 bits (37), Expect = 5e-10 Identities = 46/49 (93%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||||||||||||||| ||| ||||||||||||||||| |||||| Sbjct: 745 catggagaacatggccagccttccattcttgatctccttcactttgagc 697
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 73.8 bits (37), Expect = 5e-10 Identities = 52/57 (91%) Strand = Plus / Minus Query: 259 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||| | |||||||||||| |||||||| |||||||| |||||||||||||| Sbjct: 476 gaagaagccgaacatggagaacatcgccagccgcccgttcttaatctccttcacctt 420
>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex II protein m9 mRNA, partial cds; nuclear gene for chloroplast product Length = 577 Score = 71.9 bits (36), Expect = 2e-09 Identities = 86/100 (86%), Gaps = 2/100 (2%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagccca-gcatgg 275 |||||||| || ||| |||| |||||| ||| |||||||| ||||||||| | ||||| Sbjct: 391 caggttctggatggggcccttgccggtcacgatggcctggacgaagaagccgaagcatg- 333 Query: 276 agaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| ||| ||||||||||||||||| ||||| Sbjct: 332 agaacatggccaaccgcccgttcttgatctccttgacctt 293
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 71.9 bits (36), Expect = 2e-09 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || |||||||||| |||||||||||| Sbjct: 685 aacatggccaagcgyccgttcttgagctccttcacctt 648
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 71.9 bits (36), Expect = 2e-09 Identities = 89/104 (85%), Gaps = 2/104 (1%) Strand = Plus / Minus Query: 217 caggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagccca-gcatgg 275 |||||||| || ||| |||| |||||| ||| |||||| | ||||||||| | ||| || Sbjct: 731 caggttctggatggggcccttgccggtcacgatggcctgcacgaagaagccgaagca-gg 673 Query: 276 agaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||||| || || ||||||||||||||||||||||||||| Sbjct: 672 agaacatggcaaggcggccgttcttgatctccttcaccttgagc 629
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 71.9 bits (36), Expect = 2e-09 Identities = 84/100 (84%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||| | ||| |||| ||||||||| |||||| | |||||| || | ||||||||| Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgcacgaagaacccaaacatggagaa 1612 Query: 280 catggccagccgtccgttcttgatctccttcaccttgagc 319 ||| || || || ||||||||||||||||||||||||||| Sbjct: 1611 catagcgagacgcccgttcttgatctccttcaccttgagc 1572
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 71.9 bits (36), Expect = 2e-09 Identities = 54/60 (90%) Strand = Plus / Minus Query: 260 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| | ||| ||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 695 aagaagccaaacattgagaacatggcaaggcgaccgttcttgatctccttcaccttgagc 636
>gb|AY087939.1| Arabidopsis thaliana clone 39765 mRNA, complete sequence Length = 1036 Score = 69.9 bits (35), Expect = 7e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 371 cctgggtggagcttgtcatcgaattccagtccgttggtgatcctgtagtactcgg 425 |||||||| |||||||| ||||| |||| |||||||||||| ||||||||||||| Sbjct: 702 cctgggtgtagcttgtcctcgaaatccaatccgttggtgattctgtagtactcgg 648
>gb|U51634.1|PPU51634 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 252 Score = 69.9 bits (35), Expect = 7e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcacc 313 ||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 43 catggagaacatggccagccgaccgttcttaatctccttcacc 1
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 67.9 bits (34), Expect = 3e-08 Identities = 85/102 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||||||| |||||| || | ||||||| Sbjct: 617 aggttctccaacgggccctttccggtgacgatagcctggacgaagaatccgaacatggag 558 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| |||| |||||||||| |||||| ||||||||| Sbjct: 557 aacatggcaagcctgccgttcttgagctccttaaccttgagc 516
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 760 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacaatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || ||||||||||||||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgatctccttcacctt 648
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 759 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| |||||||| |||||| | |||||| || | |||||| Sbjct: 734 aggttctcgatgggtcccttcccggtgacaatggcctgaacgaagaatccgaacatggaa 675 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || ||||||||||||||||||||||| Sbjct: 674 aacatggccaagcgcccgttcttgatctccttcacctt 637
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || |||||||||| |||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || |||||||||| |||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| |||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || |||||||||| |||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648
>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | |||||| |||||||||| ||| ||||||||||||||||| Sbjct: 713 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 654 Query: 310 cacctt 315 |||||| Sbjct: 653 cacctt 648
>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | |||||| |||||||||| ||| ||||||||||||||||| Sbjct: 713 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 654 Query: 310 cacctt 315 |||||| Sbjct: 653 cacctt 648
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | |||||| |||||||||| ||| ||||||||||||||||| Sbjct: 759 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 700 Query: 310 cacctt 315 |||||| Sbjct: 699 cacctt 694
>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding protein of photosystem II Length = 772 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 ||||| |||| ||| |||| |||||| ||| ||||| | ||||||||| | ||||||| Sbjct: 634 aggttttcgatggggcccttgccggtcacgattgcctgcacgaagaagccgaacatggag 575 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||||||| |||||||| | |||||||||||| Sbjct: 574 aacatcgccagccgcccgttctttagctccttcacctt 537
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||||| |||||| || | ||||||||||||||||| ||| |||||||| | |||||| Sbjct: 733 ggcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctcctt 674 Query: 310 cacctt 315 |||||| Sbjct: 673 cacctt 668
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | |||||| |||||||||| ||| ||||||||||||||||| Sbjct: 768 ggcctgcacgaagaatccgaacatggaaaacatggccaaccgcccgttcttgatctcctt 709 Query: 310 cacctt 315 |||||| Sbjct: 708 cacctt 703
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 67.9 bits (34), Expect = 3e-08 Identities = 85/102 (83%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| |||||| | |||||||| | ||||||| Sbjct: 723 aggttctccaatgggcccttgccggtgacaatggcctgcacaaagaagccaaacatggag 664 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| || || || |||||||||||||| ||||||||| Sbjct: 663 aacatggcgaggcggccattcttgatctccttaaccttgagc 622
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||||| |||||| || | ||||||||||||||||| ||| |||||||| | |||||| Sbjct: 291 ggcctggacgaagaacccgaacatggagaacatggccaaccgcccgttctttagctcctt 232 Query: 310 cacctt 315 |||||| Sbjct: 231 cacctt 226
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||||| |||||| || | ||| ||||||||||||| || ||||||||||||||||| Sbjct: 741 ggcctggacgaagaacccgaacattgagaacatggccaatcggccgttcttgatctcctt 682 Query: 310 cacctt 315 |||||| Sbjct: 681 cacctt 676
>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein Length = 1746 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 251 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 310 ||||||| |||||| || | |||||||||||| ||||| || ||||||||||||||||| Sbjct: 1235 gcctggacgaagaacccaaacatggagaacattgccaggcggccgttcttgatctcctta 1176 Query: 311 acctt 315 ||||| Sbjct: 1175 acctt 1171
>gb|AY267624.1| Bigelowiella natans chlorophyll a/b-binding protein II 2 mRNA, complete cds; nuclear gene for plastid product Length = 1147 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 251 gcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttc 310 ||||| ||| ||||||| |||||||||||||| || || || ||||||||||||||||| Sbjct: 936 gcctgaatgtagaagccgagcatggagaacatagcaagacggccgttcttgatctccttg 877 Query: 311 acctt 315 ||||| Sbjct: 876 acctt 872
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m9 (Lhcbm9) mRNA, complete cds Length = 1221 Score = 65.9 bits (33), Expect = 1e-07 Identities = 39/41 (95%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || ||||||||||||||||||||||| Sbjct: 663 gagaacatggccaggcggccgttcttgatctccttcacctt 623
>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b binding protein Length = 978 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||||||||||||| |||||||| ||||| |||||||| Sbjct: 724 catggagaacatggccagccgaccgttcttaatctctttcacctt 680
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||||| || || ||||||||||||||||||||||||||| Sbjct: 689 gagaacatggcaaggcggccgttcttgatctccttcaccttgagc 645
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1050 Score = 65.9 bits (33), Expect = 1e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 239 ccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 298 ||||||||| |||||||| |||||| || | ||| || |||||||||| ||| |||||| Sbjct: 758 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 699 Query: 299 ttgatctccttcacctt 315 |||| |||||||||||| Sbjct: 698 ttgagctccttcacctt 682
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1062 Score = 65.9 bits (33), Expect = 1e-07 Identities = 66/77 (85%) Strand = Plus / Minus Query: 239 ccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 298 ||||||||| |||||||| |||||| || | ||| || |||||||||| ||| |||||| Sbjct: 755 ccggtgacgatggcctggacgaagaatccgaacatagaaaacatggccaaccgcccgttc 696 Query: 299 ttgatctccttcacctt 315 |||| |||||||||||| Sbjct: 695 ttgagctccttcacctt 679
>gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b binding protein mRNA, partial cds; nuclear gene for chloroplast product Length = 600 Score = 65.9 bits (33), Expect = 1e-07 Identities = 45/49 (91%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||||||| |||| | |||||||||||||||||||||||||||| Sbjct: 474 catggagaacatagccaatcttccgttcttgatctccttcaccttgagc 426
>emb|X95727.1|BJMCAB1GE B.juncea mRNA for chlorophyll a/b-binding protein Length = 1033 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 356 gggtcgaacgggccgcctgggtggagcttgtcatcgaattccagtccgttggtgatcctg 415 |||||||| ||||| |||||||| |||||||| ||||| |||| ||||||||||| | | Sbjct: 641 gggtcgaatgggcctcctgggtgaagcttgtcttcgaagtccaagccgttggtgattcgg 582 Query: 416 tagtactc 423 |||||||| Sbjct: 581 tagtactc 574 Score = 42.1 bits (21), Expect = 1.7 Identities = 54/65 (83%) Strand = Plus / Minus Query: 254 tggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacc 313 ||||||||||| | | |||||| |||||||||| | |||||||||||||| || ||| Sbjct: 743 tggatgaagaaagcaaacatggaaaacatggccaatctcccgttcttgatctctttaacc 684 Query: 314 ttgag 318 ||||| Sbjct: 683 ttgag 679
>emb|X06602.1|EGLHCPAB Euglena gracilis mRNA for light harvesting chlorophyll a/b protein Length = 681 Score = 63.9 bits (32), Expect = 5e-07 Identities = 80/96 (83%) Strand = Plus / Minus Query: 220 gttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggagaa 279 |||||| | ||| ||||||||||| ||| |||||| | |||||||||||||| Sbjct: 296 gttctccacggggccctcgccggtcacgatggcctgtgcgtagaagcccagcatgccact 237 Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| ||||||||||||||||||||||| Sbjct: 236 catggccagccggccgttcttgatctccttcacctt 201
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 63.9 bits (32), Expect = 5e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 260 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| | ||||||||||||||| || || || |||||||||||||| ||||||||| Sbjct: 886 aagaagccaaacatggagaacatggcgaggcggccattcttgatctccttaaccttgagc 827
>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein of photosystem II Length = 7650 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 261 agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||||||||| | ||||||||| || |||||||| | |||||||||||||||| Sbjct: 4919 agaagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 4861 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 261 agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||||||||| | ||||||||| || |||||||| | |||||||||||||||| Sbjct: 1476 agaagcccagcatggccaccatggccaggcggccgttcttcagctccttcaccttgagc 1418 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| |||||||||| |||||||||||| Sbjct: 7000 catggccagccggccgttcttgacctccttcacctt 6965 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 280 catggccagccgtccgttcttgatctccttcacctt 315 |||||||||||| |||||||||| |||||||||||| Sbjct: 216 catggccagccggccgttcttgacctccttcacctt 181 Score = 48.1 bits (24), Expect = 0.027 Identities = 45/52 (86%) Strand = Plus / Minus Query: 265 gcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttg 316 ||||||||||| | ||||||||| || |||||||| | ||||||||||||| Sbjct: 3759 gcccagcatggccagcatggccaggcggccgttcttcacctccttcaccttg 3708
>gb|AF398746.1|AF398746 Carlquistia muirii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds Length = 1100 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | ||||||||||||||| |||| || ||||||||| Sbjct: 986 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 927 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 926 tccttcacctt 916
>gb|AF398740.1|AF398740 Wilkesia gymnoxiphium ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | ||||||||||||||| |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacatggctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein Length = 928 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Minus Query: 205 gaggtgggcgcacaggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaa 264 ||||||| || |||||||||| || || |||| |||||||||| || || | |||||| Sbjct: 777 gaggtggtcgaacaggttctccaatgggcccttgccggtgacgatagcttgcacgaagaa 718 Query: 265 gcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 || | ||| ||||||||||| || || || |||||||||||||||||||| Sbjct: 717 cccgaacatagagaacatggcaagacggccattcttgatctccttcacctt 667
>gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding protein (LHCPII) gene exons 1-5, 5' end Length = 3122 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 261 agaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||||||||| | ||||||||| || |||||||| | |||||||||||||||| Sbjct: 2928 agaagcccagcatggccaccatggccagacggccgttcttcacctccttcaccttgagc 2870
>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 763 Score = 60.0 bits (30), Expect = 7e-06 Identities = 65/77 (84%) Strand = Plus / Minus Query: 239 ccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttc 298 ||||||||| ||||||| |||||| || | ||| || |||||||||| ||| |||||| Sbjct: 724 ccggtgacgatggcctggncgaagaatccgaacatagaaaacatggccaaccgcccgttc 665 Query: 299 ttgatctccttcacctt 315 |||| |||||||||||| Sbjct: 664 ttgagctccttcacctt 648
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 60.0 bits (30), Expect = 7e-06 Identities = 81/98 (82%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| ||| |||| ||||||||| ||||| | |||||| || | |||||| Sbjct: 745 aggttctcgatgggtccctttccggtgacgattgcctgcacgaagaatccgaacatggaa 686 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||| || |||||||||| |||||||||||| Sbjct: 685 aacatggccaagcgcccgttcttgagctccttcacctt 648
>dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590a, complete sequence Length = 16141 Score = 60.0 bits (30), Expect = 7e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcac 312 ||||||||||||||||| || ||| ||||||||||||||||| Sbjct: 11294 catggagaacatggccaaccttccattcttgatctccttcac 11335
>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds Length = 1041 Score = 60.0 bits (30), Expect = 7e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||||||||| |||||||||||||| || ||||||||||||||||| Sbjct: 702 ggcctgcacgaagaagcccaggcaagagaacatggccaggcggccgttcttgatctcctt 643 Query: 310 cacctt 315 ||||| Sbjct: 642 gacctt 637
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||| |||| || |||||||||||||||||||||||| Sbjct: 713 gagaacatagccaaccttccgttcttgatctccttcacctt 673
>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017 Length = 330 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||||||||| || | ||||||||||||||||| ||||||||| Sbjct: 251 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 203
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||||| || ||||||||||||||||||||||| Sbjct: 2894 gagaacatggccaatcgcccgttcttgatctccttcacctt 2854
>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev Length = 326 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||| ||||| || || || ||||||||||||||||||||||||||| Sbjct: 72 catggaaaacattgcaagacgaccgttcttgatctccttcaccttgagc 120
>emb|Z16408.1|PSLHCB51 P.sylvestris Lhcb5*1 mRNA encoding Lhcb5 protein Length = 1193 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 259 gaagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||| ||||| ||||||||||||| || ||| || || |||||||||||||| Sbjct: 834 gaagaagccgagcattgagaacatggccaaccttccatttttaatctccttcacctt 778
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||| |||| || |||||||||||||||||||||||| Sbjct: 245 gagaacatagccaaccttccgttcttgatctccttcacctt 205
>gb|AY104614.1| Zea mays PCO084486 mRNA sequence Length = 1214 Score = 58.0 bits (29), Expect = 3e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 175 ggtgagcaggttgttgccgaaggggtcgctgaggtgggcgcacaggttctcgaagggccc 234 |||||||| ||||||| || ||||||| ||||||| || |||||||| ||| || || Sbjct: 963 ggtgagcacgttgttgttgacggggtcggcgaggtggtcgagcaggttctggaacgggcc 904 Query: 235 ctcgccggtgacgtaggcctggatgaagaagcccagcatggagaacatggccagccgtcc 294 ||||||||||| ||||||||||| | || || |||| || |||||| |||| || Sbjct: 903 gacgccggtgacgagcccctggatgaagtaaccgaggatggcgagcatggcgagcctgcc 844 Query: 295 gttcttgatctccttcaccttgagc 319 ||||||||||||||| | ||||||| Sbjct: 843 gttcttgatctccttgagcttgagc 819
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds Length = 1240 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||||||||| || | ||||||||||||||||| ||||||||| Sbjct: 1114 catggagaacatggcaagtctgccgttcttgatctcctttaccttgagc 1066
>dbj|AB122118.1| Chlamydomonas reinhardtii LhcI-5 gene for light-harvesting chlorophyll-a/b protein of photosystem I, complete cds Length = 1886 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 280 catggccagccgtccgttcttgatctccttcaccttgagc 319 ||||||||| || ||||||||||||||||| ||||||||| Sbjct: 1442 catggccaggcggccgttcttgatctccttaaccttgagc 1403
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 260 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||| | ||| ||||||||||||| ||||||||||||| ||||||||||| Sbjct: 927 aagaagccaaacatagagaacatggccaatcgtccgttcttgagttccttcacctt 872
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 260 aagaagcccagcatggagaacatggccagccgtccgttcttgatctccttcaccttgagc 319 |||||||| | |||||||||||| || || | |||||||||||||||||||| |||||| Sbjct: 236 aagaagccaaacatggagaacatagcaagtctgccgttcttgatctccttcactttgagc 177
>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA, complete cds; nuclear gene for plastid product Length = 1284 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 269 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || || || ||||||||||||||||| ||||| Sbjct: 924 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 878
>gb|AF398747.1|AF398747 Anisocarpus scabridus ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398745.1|AF398745 Osmadenia tenella ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398744.1|AF398744 Madia nutans ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398743.1|AF398743 Deinandra lobbii ASCAB9 (ASCAB9) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398741.1|AF398741 Wilkesia gymnoxiphium ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and partial cds Length = 1083 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 909 tccttcacctt 899
>gb|AF398739.1|AF398739 Dubautia scabra ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and partial cds Length = 1037 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 923 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 864 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 863 tccttcacctt 853
>gb|AF398738.1|AF398738 Dubautia plantaginea ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and partial cds Length = 1102 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 988 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 929 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 928 tccttcacctt 918
>gb|AF398737.1|AF398737 Dubautia laxa ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and partial cds Length = 1083 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 909 tccttcacctt 899
>gb|AF398736.1|AF398736 Dubautia latifolia ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and partial cds Length = 1085 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 971 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 912 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 911 tccttcacctt 901
>gb|AF398735.1|AF398735 Dubautia laevigata ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and partial cds Length = 1101 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 987 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 928 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 927 tccttcacctt 917
>gb|AF398734.1|AF398734 Argyroxiphium sandwicense ASCAB9-C (ASCAB9-C) gene, exons 4, 5 and 6 and partial cds Length = 1083 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 969 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 910 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 909 tccttcacctt 899
>gb|AF398733.1|AF398733 Argyroxiphium sandwicense ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398732.1|AF398732 Argyroxiphium caliginis ASCAB9-B (ASCAB9-B) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcgaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398731.1|AF398731 Wilkesia gymnoxiphium ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398730.1|AF398730 Dubautia sherffiana ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398729.1|AF398729 Dubautia raillardioides ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398728.1|AF398728 Dubautia plantaginea ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398726.1|AF398726 Dubautia latifolia ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398725.1|AF398725 Dubautia laevigata ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF398723.1|AF398723 Argyroxiphium caliginis ASCAB9-A (ASCAB9-A) gene, exons 4, 5 and 6 and partial cds Length = 1103 Score = 54.0 bits (27), Expect = 4e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 245 acgtaggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatc 304 ||||| ||||||||||| || | | |||||||||||| || |||| || ||||||||| Sbjct: 989 acgtacgcctggatgaaaaacgcaaacatggagaacattgctagcctgccattcttgatc 930 Query: 305 tccttcacctt 315 ||||||||||| Sbjct: 929 tccttcacctt 919
>gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting complex protein LHCG12 mRNA, complete cds Length = 1170 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 269 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || || || ||||||||||||||||| ||||| Sbjct: 922 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 876
>gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting complex protein LHCG11 mRNA, complete cds Length = 1128 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 269 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || || || ||||||||||||||||| ||||| Sbjct: 879 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 833
>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA, complete cds Length = 1191 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 269 agcatggagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||||||||| || || || ||||||||||||||||| ||||| Sbjct: 919 agcatggagaacatagcgagacggccgttcttgatctccttaacctt 873
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 54.0 bits (27), Expect = 4e-04 Identities = 119/147 (80%), Gaps = 2/147 (1%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||||| || |||| ||||||||| |||||||| |||||| || | |||||| Sbjct: 789 aggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaacatggac 730 Query: 278 aacatggccagccgtccgttcttgatctccttcaccttgagcagcgccgcctgg-tcggg 336 |||||||| || || || ||||||| |||||| ||||||||| ||||| | ||||| Sbjct: 729 aacatggcgaggcggcccttcttgagctccttgaccttgagct-cgccgaaggcctcggg 671 Query: 337 gtcggtggcgaggccgagcgggtcgaa 363 |||| ||||||||| ||||||||||| Sbjct: 670 gtcgtcggcgaggcccagcgggtcgaa 644
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 293 ccgttcttgatctccttcaccttgagc 319 ||||||||||||||||||||||||||| Sbjct: 668 ccgttcttgatctccttcaccttgagc 642
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699 Query: 310 cacctt 315 |||||| Sbjct: 698 cacctt 693
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 2558 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 2617 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 2618 aacatagccaaccttccgttcttgagctccttcacctt 2655
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 2558 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 2617 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 2618 aacatagccaaccttccgttcttgagctccttcacctt 2655
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 780 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 721 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 720 aacatagccaaccttccgttcttgagctccttcacctt 683
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 738 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 679 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 678 aacatagccaaccttccgttcttgagctccttcacctt 641
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 mRNA, complete cds Length = 859 Score = 52.0 bits (26), Expect = 0.002 Identities = 42/46 (91%), Gaps = 1/46 (2%) Strand = Plus / Minus Query: 271 catggagaacatggcca-gccgtccgttcttgatctccttcacctt 315 ||||||||||| ||||| ||| ||||||||||||||||||||||| Sbjct: 732 catggagaacagggccaagcctgccgttcttgatctccttcacctt 687 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 332 tcggggtcggtggcgaggccgagcgggtcgaa 363 ||||||||| ||||||||| ||||||||||| Sbjct: 670 tcggggtcgtcggcgaggccaagcgggtcgaa 639
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 780 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 721 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 720 aacatagccaaccttccgttcttgagctccttcacctt 683
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 696 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 637 Query: 310 cacctt 315 |||||| Sbjct: 636 cacctt 631
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699 Query: 310 cacctt 315 |||||| Sbjct: 698 cacctt 693
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699 Query: 310 cacctt 315 |||||| Sbjct: 698 cacctt 693
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 96000 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 95941 Query: 310 cacctt 315 |||||| Sbjct: 95940 cacctt 95935 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 93276 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 93335 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 93336 aacatagccaaccttccgttcttgagctccttcacctt 93373
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 80926 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 80867 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 80866 aacatagccaaccttccgttcttgagctccttcacctt 80829 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 78202 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 78261 Query: 310 cacctt 315 |||||| Sbjct: 78262 cacctt 78267
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 725 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 666 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 665 aacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 776 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 717 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 716 aacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 764 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 705 Query: 310 cacctt 315 |||||| Sbjct: 704 cacctt 699
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 416 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 357 Query: 310 cacctt 315 |||||| Sbjct: 356 cacctt 351
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 767 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 708 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 707 aacatagccaaccttccgttcttgagctccttcacctt 670
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 757 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 698 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 697 aacatagccaaccttccgttcttgagctccttcacctt 660
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 760 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 701 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 700 aacatagccaaccttccgttcttgagctccttcacctt 663
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 760 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 701 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 700 aacatagccaaccttccgttcttgagctccttcacctt 663
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Plus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 159 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 218 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 219 aacatagccaaccttccgttcttgagctccttcacctt 256
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 758 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 699 Query: 310 cacctt 315 |||||| Sbjct: 698 cacctt 693
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 52.0 bits (26), Expect = 0.002 Identities = 59/70 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||||| |||||| || | || |||||||||||||| || |||||||||| ||||| Sbjct: 745 ggcctggacgaagaacccgaacacggagaacatggccaacctaccgttcttgagttcctt 686 Query: 310 caccttgagc 319 ||||||||| Sbjct: 685 gaccttgagc 676
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 996 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 937 Query: 310 cacctt 315 |||||| Sbjct: 936 cacctt 931
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 218 aggttctcgaagggcccctcgccggtgacgtaggcctggatgaagaagcccagcatggag 277 |||||||| || || |||| ||||||||| ||| || | |||||| || | ||| ||| Sbjct: 1025 aggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaaacatagag 966 Query: 278 aacatggccagccgtccgttcttgatctccttcacctt 315 ||||| |||| || ||||||||||| |||||||||||| Sbjct: 965 aacatagccaaccttccgttcttgagctccttcacctt 928
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || ||||||||||| |||||| Sbjct: 696 ggcctgaacgaagaatccaaacatagagaacatagccaaccttccgttcttgagctcctt 637 Query: 310 cacctt 315 |||||| Sbjct: 636 cacctt 631
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 52.0 bits (26), Expect = 0.002 Identities = 59/70 (84%) Strand = Plus / Minus Query: 250 ggcctggatgaagaagcccagcatggagaacatggccagccgtccgttcttgatctcctt 309 |||||| | |||||| || | ||| |||||||| |||| || |||||||||||||| || Sbjct: 887 ggcctgaacgaagaacccgaacattgagaacatagccaacctaccgttcttgatctcttt 828 Query: 310 caccttgagc 319 |||||||||| Sbjct: 827 caccttgagc 818
>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070 (LHCB2.2) mRNA, complete cds Length = 1060 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||| || || |||||||||| |||||||||||| Sbjct: 728 gagaacatggcaagacgaccgttcttgagctccttcacctt 688
>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G05060 transcript variant AT2G05060.2 mRNA, complete cds Length = 2130 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||| || || |||||||||| |||||||||||| Sbjct: 1412 gagaacatggcaagacgaccgttcttgagctccttcacctt 1452
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||| ||||||| || |||||||||||||||||||| Sbjct: 544 gagaacatagccagcctgccattcttgatctccttcacctt 504
>gb|DQ226725.1| Boechera divaricarpa isolate SLW-A-F06 mRNA sequence Length = 452 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 271 catggagaacatggccagccgtccgttcttgatctccttcacctt 315 ||||||||||||||| || || |||||||||| |||||| ||||| Sbjct: 270 catggagaacatggcaagacgaccgttcttgagctcctttacctt 226
>gb|BT014450.1| Lycopersicon esculentum clone 133776F, mRNA sequence Length = 1196 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 169 gatgacggtgagcaggttgttgccgaaggggtc 201 |||||||||||||| ||||||||| |||||||| Sbjct: 907 gatgacggtgagcaagttgttgccaaaggggtc 875
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Minus Query: 275 gagaacatggccagccgtccgttcttgatctccttcacctt 315 |||||||| |||| || ||||||||| |||||||||||||| Sbjct: 2246 gagaacatagccaaccttccgttcttaatctccttcacctt 2206 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,480,633 Number of Sequences: 3902068 Number of extensions: 3480633 Number of successful extensions: 70303 Number of sequences better than 10.0: 530 Number of HSP's better than 10.0 without gapping: 535 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67902 Number of HSP's gapped (non-prelim): 2391 length of query: 485 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 463 effective length of database: 17,147,199,772 effective search space: 7939153494436 effective search space used: 7939153494436 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
