Clone Name | rbasd1o06 |
---|---|
Clone Library Name | barley_pub |
>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds Length = 1053 Score = 448 bits (226), Expect = e-123 Identities = 330/362 (91%), Gaps = 4/362 (1%) Strand = Plus / Minus Query: 16 tcaacaaacatcaggacaaaacttaaaaaagtatggttccaggaaacatagnnctatatc 75 ||||||||||||||| ||||| ||||||| | |||||||||| |||||||| ||||||| Sbjct: 993 tcaacaaacatcagg-caaaatttaaaaacg-atggttccag-aaacatagttctatatc 937 Query: 76 cttgcagataactggctatagcaaaacgactcaatgcctcagaatcaggccttggcagca 135 ||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||||| Sbjct: 936 ctt-cagataactggctatagcaaaacgaatcaacgcctcagaatcaggccttggcagct 878 Query: 136 gcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttgatacccttg 195 ||||| || ||||||| ||||||||| ||||||||||||||||| ||||||||||| ||| Sbjct: 877 gcctgggcagcggcatccctcttcctctgctcctcaatgatggtcagcttgatacctttg 818 Query: 196 cccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttgcccaga 255 |||||||||||| ||||||| ||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 817 cccttggggagggtcacccacggcttggtgcccttgccgatggtgaacacattgcctaga 758 Query: 256 cnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaaggntccctta 315 | |||||| |||||||||||||| |||| ||||||||||||||||| |||| ||||||| Sbjct: 757 cgggtggcgaactggtgaccctgagcatcctcaacgtggatggtctcgaaggttccctta 698 Query: 316 tgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatg 375 |||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||| Sbjct: 697 tgcttctccctgttcttgatcacaccaacacggccagtgttacgcccaccagtaaccatg 638 Query: 376 ac 377 || Sbjct: 637 ac 636
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 272 bits (137), Expect = 8e-70 Identities = 221/251 (88%) Strand = Plus / Plus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || || |||| || |||||| |||||||| |||||| |||||||| Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 |||||||||| |||||| || ||||| ||| |||||| ||||||||||||||||| ||| Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206 Query: 367 gtcaccatgac 377 ||||||||||| Sbjct: 317207 gtcaccatgac 317217 Score = 44.1 bits (22), Expect = 0.32 Identities = 31/34 (91%) Strand = Plus / Plus Query: 69 ctatatccttgcagataactggctatagcaaaac 102 ||||||||||||| | |||| ||||||||||||| Sbjct: 316902 ctatatccttgcaaacaactcgctatagcaaaac 316935
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1359_D06 Length = 146805 Score = 272 bits (137), Expect = 8e-70 Identities = 221/251 (88%) Strand = Plus / Plus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || || |||| || |||||| |||||||| |||||| |||||||| Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 |||||||||| |||||| || ||||| ||| |||||| ||||||||||||||||| ||| Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990 Query: 367 gtcaccatgac 377 ||||||||||| Sbjct: 45991 gtcaccatgac 46001 Score = 44.1 bits (22), Expect = 0.32 Identities = 31/34 (91%) Strand = Plus / Plus Query: 69 ctatatccttgcagataactggctatagcaaaac 102 ||||||||||||| | |||| ||||||||||||| Sbjct: 45686 ctatatccttgcaaacaactcgctatagcaaaac 45719
>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full insert sequence Length = 1016 Score = 272 bits (137), Expect = 8e-70 Identities = 221/251 (88%) Strand = Plus / Minus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || || |||| || |||||| |||||||| |||||| |||||||| Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 |||||||||| |||||| || ||||| ||| |||||| ||||||||||||||||| ||| Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647 Query: 367 gtcaccatgac 377 ||||||||||| Sbjct: 646 gtcaccatgac 636 Score = 44.1 bits (22), Expect = 0.32 Identities = 31/34 (91%) Strand = Plus / Minus Query: 69 ctatatccttgcagataactggctatagcaaaac 102 ||||||||||||| | |||| ||||||||||||| Sbjct: 951 ctatatccttgcaaacaactcgctatagcaaaac 918
>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full insert sequence Length = 1157 Score = 272 bits (137), Expect = 8e-70 Identities = 221/251 (88%) Strand = Plus / Minus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || || |||| || |||||| |||||||| |||||| |||||||| Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 |||||||||| |||||| || ||||| ||| |||||| ||||||||||||||||| ||| Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651 Query: 367 gtcaccatgac 377 ||||||||||| Sbjct: 650 gtcaccatgac 640 Score = 44.1 bits (22), Expect = 0.32 Identities = 31/34 (91%) Strand = Plus / Minus Query: 69 ctatatccttgcagataactggctatagcaaaac 102 ||||||||||||| | |||| ||||||||||||| Sbjct: 955 ctatatccttgcaaacaactcgctatagcaaaac 922
>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full insert sequence Length = 1079 Score = 264 bits (133), Expect = 2e-67 Identities = 220/251 (87%) Strand = Plus / Minus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || || |||| || |||||| |||||||| |||||| |||||||| Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 |||||||||| |||||| || ||||| ||| |||||| ||||||||||||||||| ||| Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 || ||||||||||||||||||||||||||||||||||| || ||||| | || ||| Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643 Query: 367 gtcaccatgac 377 ||||||||||| Sbjct: 642 gtcaccatgac 632 Score = 44.1 bits (22), Expect = 0.32 Identities = 31/34 (91%) Strand = Plus / Minus Query: 69 ctatatccttgcagataactggctatagcaaaac 102 ||||||||||||| | |||| ||||||||||||| Sbjct: 947 ctatatccttgcaaacaactcgctatagcaaaac 914
>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds Length = 1013 Score = 206 bits (104), Expect = 4e-50 Identities = 215/254 (84%) Strand = Plus / Minus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || ||||||| || |||||| ||||| || |||||| | |||||| Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| ||||||||||| ||||| | |||||||| |||||||||||| Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 ||||||| || |||||| |||||||| ||| ||| | ||| ||||| ||||||| |||| Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 ||||| |||||||||||||||||||| ||||| || || |||||||| | || ||| Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625 Query: 367 gtcaccatgacgac 380 |||||||||||||| Sbjct: 624 gtcaccatgacgac 611
>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 Length = 1148 Score = 204 bits (103), Expect = 1e-49 Identities = 190/217 (87%), Gaps = 3/217 (1%) Strand = Plus / Minus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcct-caatgatggtgagctt 185 |||||||||||||| || || || | || |||||| ||||||| | |||||| ||||||| Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807 Query: 186 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacac 245 ||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747 Query: 246 gttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaa 305 |||||||||| |||||| || ||||| ||| |||||| ||||||||||||||||| || Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687 Query: 306 ggntcccttatgcttctccctgttcttgatcacacca 342 | | |||| |||||||||||||| |||||||||||| Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651
>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence Length = 1116 Score = 200 bits (101), Expect = 2e-48 Identities = 189/220 (85%) Strand = Plus / Minus Query: 158 tcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 217 |||| |||||||| |||||| ||||||||||||||||||||||||| ||||||||||| | Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806 Query: 218 gcttggtgcccttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccct 277 ||||| |||||||||| ||||||||||||||||||| | |||||| |||||||| ||| Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746 Query: 278 gggcatnctcaacgtggatggtctnaaaggntcccttatgcttctccctgttcttgatca 337 || | ||| ||||||||||| | ||| ||||| |||||||||||||||||||||| Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686 Query: 338 caccaacacgcccagtgttgcgcccaccagtcaccatgac 377 |||| |||||||| ||||| | ||| || ||||||||||| Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgac 646
>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds Length = 1037 Score = 200 bits (101), Expect = 2e-48 Identities = 212/251 (84%) Strand = Plus / Minus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || ||||||| || |||||| ||||| || |||||| | |||||| Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || |||||||||||||| ||||||||||| ||||| | |||||||| |||||||||||| Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 ||||||| || |||||| |||||||| ||| ||| | ||| ||||| ||||||| || | Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 ||||| |||||||||||||||||||| ||||| ||||| |||||||| | || ||| Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623 Query: 367 gtcaccatgac 377 ||||||||||| Sbjct: 622 gtcaccatgac 612
>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds Length = 1090 Score = 200 bits (101), Expect = 2e-48 Identities = 189/220 (85%) Strand = Plus / Minus Query: 158 tcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 217 |||| |||||||| |||||| ||||||||||||||||||||||||| ||||||||||| | Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785 Query: 218 gcttggtgcccttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccct 277 ||||| |||||||||| ||||||||||||||||||| | |||||| |||||||| ||| Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725 Query: 278 gggcatnctcaacgtggatggtctnaaaggntcccttatgcttctccctgttcttgatca 337 || | ||| ||||||||||| | ||| ||||| |||||||||||||||||||||| Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665 Query: 338 caccaacacgcccagtgttgcgcccaccagtcaccatgac 377 |||| |||||||| ||||| | ||| || ||||||||||| Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgac 625
>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence Length = 1145 Score = 182 bits (92), Expect = 5e-43 Identities = 212/254 (83%) Strand = Plus / Plus Query: 127 ttggcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttg 186 |||||||||||||| || || |||| || |||||| ||||| || |||||| | |||||| Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237 Query: 187 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 246 || ||||| |||||||| ||||||||||| ||||| | |||||||| |||||||||||| Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297 Query: 247 ttgcccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaag 306 ||||||| || |||||| |||||||| ||| ||| | ||| ||||| || |||| |||| Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357 Query: 307 gntcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 366 ||||| |||||||||||||||||||| ||||| ||||| ||||||| | || ||| Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417 Query: 367 gtcaccatgacgac 380 |||||||||||||| Sbjct: 418 gtcaccatgacgac 431
>ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 768 Score = 137 bits (69), Expect = 3e-29 Identities = 186/227 (81%) Strand = Plus / Minus Query: 130 gcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttgata 189 |||||||||||||| || |||| | |||||| || ||||| |||||| ||||||||||| Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699 Query: 190 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 249 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639 Query: 250 cccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaaggnt 309 ||||||| |||||| || || ||| || | ||| || |||||||||| ||| Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579 Query: 310 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgtt 356 ||||| ||||||||||||||||| || || |||||||| |||||||| Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagtgtt 532
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 137 bits (69), Expect = 3e-29 Identities = 186/227 (81%) Strand = Plus / Minus Query: 130 gcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttgata 189 |||||||||||||| || |||| | |||||| || ||||| |||||| ||||||||||| Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910 Query: 190 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 249 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850 Query: 250 cccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaaggnt 309 ||||||| |||||| || || ||| || | ||| || |||||||||| ||| Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790 Query: 310 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgtt 356 ||||| ||||||||||||||||| || || |||||||| |||||||| Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagtgtt 14497743
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0514H03 Length = 167230 Score = 137 bits (69), Expect = 3e-29 Identities = 186/227 (81%) Strand = Plus / Minus Query: 130 gcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttgata 189 |||||||||||||| || |||| | |||||| || ||||| |||||| ||||||||||| Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223 Query: 190 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 249 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163 Query: 250 cccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaaggnt 309 ||||||| |||||| || || ||| || | ||| || |||||||||| ||| Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103 Query: 310 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgtt 356 ||||| ||||||||||||||||| || || |||||||| |||||||| Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagtgtt 57056
>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full insert sequence Length = 1035 Score = 137 bits (69), Expect = 3e-29 Identities = 186/227 (81%) Strand = Plus / Minus Query: 130 gcagcagcctgagctgcggcatncctcttcctntgctcctcaatgatggtgagcttgata 189 |||||||||||||| || |||| | |||||| || ||||| |||||| ||||||||||| Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816 Query: 190 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 249 ||||||||||| ||||| |||||| |||||| |||||||||| ||||||||||| ||| Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756 Query: 250 cccagacnggtggcaaactggtgaccctgggcatnctcaacgtggatggtctnaaaggnt 309 ||||||| |||||| || || ||| || | ||| || |||||||||| ||| Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696 Query: 310 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgtt 356 ||||| ||||||||||||||||| || || |||||||| |||||||| Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagtgtt 649
>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds Length = 1086 Score = 137 bits (69), Expect = 3e-29 Identities = 173/209 (82%) Strand = Plus / Minus Query: 169 tcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgccc 228 |||| |||||| ||||||||||| || |||||||| || ||||||||| || || ||| Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724 Query: 229 ttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccctgggcatnctca 288 ||||||||||||||||| || || || | || ||||||| |||||| ||||| || | Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664 Query: 289 acgtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgc 348 ||||||||||||| |||| |||||||||||||||||||||||| || || |||||||| Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaacacga 604 Query: 349 ccagtgttgcgcccaccagtcaccatgac 377 || |||| | ||||||||||||||||| Sbjct: 603 cctctgtttcttccaccagtcaccatgac 575
>ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 738 Score = 125 bits (63), Expect = 1e-25 Identities = 176/215 (81%) Strand = Plus / Minus Query: 165 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 224 ||||||||||||| |||||||||| ||||||||||||||||| ||||| ||||| | Sbjct: 699 ctcctcaatgatgctgagcttgatgcccttgcccttggggagagatacccacggcttcct 640 Query: 225 gcccttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccctgggcatn 284 ||||||| |||||||| |||||||||| | || || |||||||| || |||||| Sbjct: 639 ctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggccgagggcatc 580 Query: 285 ctcaacgtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaac 344 ||| || |||||||||| |||| ||||| |||||||||||| |||||||||| || || Sbjct: 579 ctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgatcaccccgac 520 Query: 345 acgcccagtgttgcgcccaccagtcaccatgacga 379 ||||| ||||| | |||||| |||||||| |||| Sbjct: 519 gcgccccgtgttcctcccaccggtcaccatcacga 485
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 125 bits (63), Expect = 1e-25 Identities = 176/215 (81%) Strand = Plus / Minus Query: 165 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 224 ||||||||||||| |||||||||| ||||||||||||||||| ||||| ||||| | Sbjct: 81024 ctcctcaatgatgctgagcttgatgcccttgcccttggggagagatacccacggcttcct 80965 Query: 225 gcccttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccctgggcatn 284 ||||||| |||||||| |||||||||| | || || |||||||| || |||||| Sbjct: 80964 ctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggccgagggcatc 80905 Query: 285 ctcaacgtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaac 344 ||| || |||||||||| |||| ||||| |||||||||||| |||||||||| || || Sbjct: 80904 ctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgatcaccccgac 80845 Query: 345 acgcccagtgttgcgcccaccagtcaccatgacga 379 ||||| ||||| | |||||| |||||||| |||| Sbjct: 80844 gcgccccgtgttcctcccaccggtcaccatcacga 80810
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 125 bits (63), Expect = 1e-25 Identities = 176/215 (81%) Strand = Plus / Minus Query: 165 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 224 ||||||||||||| |||||||||| ||||||||||||||||| ||||| ||||| | Sbjct: 17551219 ctcctcaatgatgctgagcttgatgcccttgcccttggggagagatacccacggcttcct 17551160 Query: 225 gcccttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccctgggcatn 284 ||||||| |||||||| |||||||||| | || || |||||||| || |||||| Sbjct: 17551159 ctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggccgagggcatc 17551100 Query: 285 ctcaacgtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaac 344 ||| || |||||||||| |||| ||||| |||||||||||| |||||||||| || || Sbjct: 17551099 ctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgatcaccccgac 17551040 Query: 345 acgcccagtgttgcgcccaccagtcaccatgacga 379 ||||| ||||| | |||||| |||||||| |||| Sbjct: 17551039 gcgccccgtgttcctcccaccggtcaccatcacga 17551005
>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full insert sequence Length = 1162 Score = 125 bits (63), Expect = 1e-25 Identities = 176/215 (81%) Strand = Plus / Minus Query: 165 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 224 ||||||||||||| |||||||||| ||||||||||||||||| ||||| ||||| | Sbjct: 851 ctcctcaatgatgctgagcttgatgcccttgcccttggggagagatacccacggcttcct 792 Query: 225 gcccttgccaatggtgaacacgttgcccagacnggtggcaaactggtgaccctgggcatn 284 ||||||| |||||||| |||||||||| | || || |||||||| || |||||| Sbjct: 791 ctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggccgagggcatc 732 Query: 285 ctcaacgtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaac 344 ||| || |||||||||| |||| ||||| |||||||||||| |||||||||| || || Sbjct: 731 ctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgatcaccccgac 672 Query: 345 acgcccagtgttgcgcccaccagtcaccatgacga 379 ||||| ||||| | |||||| |||||||| |||| Sbjct: 671 gcgccccgtgttcctcccaccggtcaccatcacga 637
>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence Length = 128856 Score = 111 bits (56), Expect = 2e-21 Identities = 118/140 (84%) Strand = Plus / Minus Query: 211 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacnggtggcaaactgg 270 ||||| ||||| || ||||||||||| |||||||| ||| |||||| || ||||||| Sbjct: 83652 acccatggctttgtccccttgccaatagtgaacacattgaccagacgagttgcaaactca 83593 Query: 271 tgaccctgggcatnctcaacgtggatggtctnaaaggntcccttatgcttctccctgttc 330 ||||| ||||| || ||||||||| |||| ||||| |||||||||||| || |||||| Sbjct: 83592 tgaccagtggcatcctgaacgtggattgtctcaaaggttcccttatgcttttctctgttc 83533 Query: 331 ttgatcacaccaacacgccc 350 |||||||| ||||||||||| Sbjct: 83532 ttgatcactccaacacgccc 83513
>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds Length = 1105 Score = 93.7 bits (47), Expect = 4e-16 Identities = 182/229 (79%) Strand = Plus / Minus Query: 149 catncctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggc 208 ||| ||||||||| ||||||||||||||| | |||||||||||||||||||| || Sbjct: 856 cattcctcttcctggcctcctcaatgatggttaatttgatacccttgcccttgggaagag 797 Query: 209 tcacccaaggcttggtgcccttgccaatggtgaacacgttgcccagacnggtggcaaact 268 |||||| ||||| || || || || ||||| || || ||||| |||| || ||||||| Sbjct: 796 acacccatggctttgtaccttttccgatggtaaaaacattgcctagacgagtagcaaact 737 Query: 269 ggtgaccctgggcatnctcaacgtggatggtctnaaaggntcccttatgcttctccctgt 328 |||||| ||| || || || ||| | |||| ||| |||||||| |||||||||| Sbjct: 736 cgtgaccaagggaatcctgaatgtgaacagtctcgaagctccccttatgtttctccctgt 677 Query: 329 tcttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgac 377 ||||||| || ||||| |||||||| || | ||| |||||||||||||| Sbjct: 676 tcttgataactccaactcgcccagtattcctccccccagtcaccatgac 628
>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds Length = 1054 Score = 73.8 bits (37), Expect = 4e-10 Identities = 40/41 (97%) Strand = Plus / Minus Query: 310 cccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||||||||||||||||||||||| ||||||||||| Sbjct: 705 cccttatgcttctccctgttcttgatcactccaacacgccc 665 Score = 50.1 bits (25), Expect = 0.005 Identities = 34/37 (91%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttgccca 253 ||||| |||||||||||||| |||||||| ||||||| Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgccca 762
>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420 mRNA, complete cds Length = 1080 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 858 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 799 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 798 ccatggctttgttcctttgccaatggtgtacac 766 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 661
>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds Length = 789 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 765 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 706 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 705 ccatggctttgttcctttgccaatggtgtacac 673 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 568
>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 995 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 838 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 779 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 778 ccatggctttgttcctttgccaatggtgtacac 746 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641
>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 1005 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 849 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 790 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 789 ccatggctttgttcctttgccaatggtgtacac 757 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 652
>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 978 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 859 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 800 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 799 ccatggctttgttcctttgccaatggtgtacac 767 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 662
>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 60.0 bits (30), Expect = 5e-06 Identities = 70/84 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| ||||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 565 tctgtttctgcctccagtcaccat 542
>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 537 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 378 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 319 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 318 ccatggctttgttcctttgccaatggtgtacac 286 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 181
>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 988 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 829 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 770 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 769 ccatggctttgttcctttgccaatggtgtacac 737 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 632
>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB61ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 737 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 578 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 519 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 518 ccatggctttgttcctttgccaatggtgtacac 486 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 381
>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB12ZD07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 566 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 407 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 348 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 347 ccatggctttgttcctttgccaatggtgtacac 315 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 210
>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 997 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 838 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 779 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 778 ccatggctttgttcctttgccaatggtgtacac 746 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641
>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence Length = 1010 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 853 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 794 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 793 ccatggctttgttcctttgccaatggtgtacac 761 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 656
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2 Length = 51440 Score = 60.0 bits (30), Expect = 5e-06 Identities = 77/93 (82%) Strand = Plus / Minus Query: 153 cctcttcctntgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcac 212 ||||||||| |||||| ||||| || ||||||||||| ||||||||||| || ||| Sbjct: 6910 cctcttcctggcctcctcgatgatagtcagcttgatacctttgcccttgggaagagacac 6851 Query: 213 ccaaggcttggtgcccttgccaatggtgaacac 245 ||| ||||| || || |||||||||||| |||| Sbjct: 6850 ccatggctttgttcctttgccaatggtgtacac 6818 Score = 60.0 bits (30), Expect = 5e-06 Identities = 52/60 (86%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| ||||||||||||||| | ||| || ||||||||||||||||| Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 6713
>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4 Length = 966 Score = 60.0 bits (30), Expect = 5e-06 Identities = 107/134 (79%) Strand = Plus / Minus Query: 211 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacnggtggcaaactgg 270 ||||| ||||| || ||||| |||| |||||||| || |||| || || ||||| | Sbjct: 756 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 697 Query: 271 tgaccctgggcatnctcaacgtggatggtctnaaaggntcccttatgcttctccctgttc 330 |||||||| | || || || ||||| ||||| |||| ||||||||||||||||||||| Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637 Query: 331 ttgatcacaccaac 344 || || |||||||| Sbjct: 636 ttaataacaccaac 623
>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein (MG02747.4) partial mRNA Length = 735 Score = 56.0 bits (28), Expect = 9e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 164 gctcctcaatgatggtgagcttgatacccttgcccttggg 203 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein (FG08714.1) partial mRNA Length = 732 Score = 56.0 bits (28), Expect = 9e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 164 gctcctcaatgatggtgagcttgatacccttgcccttggg 203 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Minus Query: 332 tgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgac 380 |||| ||||||||||| || ||||||| |||||||| ||||||||||| Sbjct: 532 tgatgacaccaacacgacccatgttgcgaccaccagtgaccatgacgac 484
>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence Length = 728 Score = 56.0 bits (28), Expect = 9e-05 Identities = 44/50 (88%) Strand = Plus / Minus Query: 289 acgtggatggtctnaaaggntcccttatgcttctccctgttcttgatcac 338 ||||||||||||| ||| ||||| ||||||||||||||||||||||| Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442 Score = 54.0 bits (27), Expect = 3e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 318 cttctccctgttcttgatcacaccaacacgcccagtgtt 356 ||||||||||||||||||||| || |||||||| ||||| Sbjct: 429 cttctccctgttcttgatcactcctacacgcccggtgtt 391
>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA, complete cds Length = 1024 Score = 56.0 bits (28), Expect = 9e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 164 gctcctcaatgatggtgagcttgatacccttgcccttggg 203 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727
>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like protein mRNA, complete cds Length = 1052 Score = 56.0 bits (28), Expect = 9e-05 Identities = 47/54 (87%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaac 344 ||||| ||||| |||| ||||||||||||||||||||||| || |||||||| Sbjct: 659 gtggagggtctcaaagctacccttatgcttctccctgttcttaataacaccaac 606
>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.2 mRNA, complete cds Length = 1174 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 679 tctgtttctgcctccagtcaccat 656 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830
>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.1 mRNA, complete cds Length = 1088 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 594 tctgtttctgcctccagtcaccat 571 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 820 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 567 tctgtttctgcctccagtcaccat 544 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 1059 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 591 tctgtttctgcctccagtcaccat 568 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA project) Length = 104607 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 7836 tctgtttctgcctccagtcaccat 7813 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987
>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 789 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 567 tctgtttctgcctccagtcaccat 544 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 1008 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 591 tctgtttctgcctccagtcaccat 568 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1168 Score = 52.0 bits (26), Expect = 0.001 Identities = 51/60 (85%) Strand = Plus / Plus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Plus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263
>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 976 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 561 tctgtttctgcctccagtcaccat 538 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712
>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 942 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 565 tctgtttctgcctccagtcaccat 542 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716
>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 952 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 554 tctgtttctgcctccagtcaccat 531 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705
>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence Length = 1011 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 594 tctgtttctgcctccagtcaccat 571 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9 Length = 86380 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/84 (82%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||| |||| |||| |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560 Query: 351 agtgttgcgcccaccagtcaccat 374 |||| | || ||||||||||| Sbjct: 82559 tctgtttctgcctccagtcaccat 82536 Score = 46.1 bits (23), Expect = 0.082 Identities = 32/35 (91%) Strand = Plus / Minus Query: 166 tcctcaatgatggtgagcttgatacccttgccctt 200 |||||||||||||| ||||| ||||| |||||||| Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710
>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA Length = 992 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttg 249 |||||| |||||||||||||| ||||||||||| Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttg 781
>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA Length = 783 Score = 50.1 bits (25), Expect = 0.005 Identities = 28/29 (96%) Strand = Plus / Minus Query: 175 atggtgagcttgatacccttgcccttggg 203 |||| |||||||||||||||||||||||| Sbjct: 743 atggagagcttgatacccttgcccttggg 715
>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript variant A (RpS4), mRNA Length = 983 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttg 249 |||||| |||||||||||||| ||||||||||| Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttg 781
>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript variant B (RpS4), mRNA Length = 969 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttg 249 |||||| |||||||||||||| ||||||||||| Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttg 767
>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 207761 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttg 249 |||||| |||||||||||||| ||||||||||| Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttg 141900
>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete sequence Length = 272016 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttg 249 |||||| |||||||||||||| ||||||||||| Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttg 169834
>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds Length = 852 Score = 50.1 bits (25), Expect = 0.005 Identities = 28/29 (96%) Strand = Plus / Minus Query: 175 atggtgagcttgatacccttgcccttggg 203 |||| |||||||||||||||||||||||| Sbjct: 745 atggagagcttgatacccttgcccttggg 717
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 50.1 bits (25), Expect = 0.005 Identities = 28/29 (96%) Strand = Plus / Plus Query: 175 atggtgagcttgatacccttgcccttggg 203 |||| |||||||||||||||||||||||| Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919
>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4, complete cds Length = 870 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgttg 249 |||||| |||||||||||||| ||||||||||| Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttg 681
>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal protein S4e mRNA, complete cds Length = 792 Score = 48.1 bits (24), Expect = 0.021 Identities = 30/32 (93%) Strand = Plus / Minus Query: 217 ggcttggtgcccttgccaatggtgaacacgtt 248 ||||||||||||||||||||| |||| ||||| Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670
>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14 Length = 86121 Score = 48.1 bits (24), Expect = 0.021 Identities = 24/24 (100%) Strand = Plus / Plus Query: 327 gttcttgatcacaccaacacgccc 350 |||||||||||||||||||||||| Sbjct: 15660 gttcttgatcacaccaacacgccc 15683
>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e Length = 1090 Score = 46.1 bits (23), Expect = 0.082 Identities = 45/53 (84%) Strand = Plus / Minus Query: 295 atggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacg 347 ||||||| |||| |||||||||||||||||||| || || || |||||||| Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacg 626
>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360 mRNA, complete cds Length = 1074 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 44.1 bits (22), Expect = 0.32 Identities = 24/25 (96%) Strand = Plus / Minus Query: 269 ggtgaccctgggcatnctcaacgtg 293 ||||||||||||||| ||||||||| Sbjct: 4589196 ggtgaccctgggcatgctcaacgtg 4589172
>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 44.1 bits (22), Expect = 0.32 Identities = 28/30 (93%) Strand = Plus / Plus Query: 219 cttggtgcccttgccaatggtgaacacgtt 248 |||||||| |||||| |||||||||||||| Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311
>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1037 Score = 44.1 bits (22), Expect = 0.32 Identities = 28/30 (93%) Strand = Plus / Minus Query: 219 cttggtgcccttgccaatggtgaacacgtt 248 |||||||| |||||| |||||||||||||| Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683
>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360) mRNA, complete cds Length = 817 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568
>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360) mRNA, complete cds Length = 1032 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 699 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 640
>gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306, section 415 of 469 of the complete genome Length = 10848 Score = 44.1 bits (22), Expect = 0.32 Identities = 24/25 (96%) Strand = Plus / Minus Query: 269 ggtgaccctgggcatnctcaacgtg 293 ||||||||||||||| ||||||||| Sbjct: 8128 ggtgaccctgggcatgctcaacgtg 8104
>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds Length = 813 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568
>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 1034 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 700 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 641
>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1000 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 685 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 626
>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB21ZB04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1007 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 692 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 633
>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 984 Score = 44.1 bits (22), Expect = 0.32 Identities = 37/42 (88%) Strand = Plus / Minus Query: 309 tcccttatgcttctccctgttcttgatcacaccaacacgccc 350 |||||||||||| || | |||||| |||||||| |||||||| Sbjct: 607 tcccttatgcttttcacggttcttaatcacacccacacgccc 566
>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 934 Score = 44.1 bits (22), Expect = 0.32 Identities = 55/66 (83%) Strand = Plus / Minus Query: 309 tcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagt 368 ||||||||||||||| | ||||| |||||||| |||||||| |||| | || ||||| Sbjct: 607 tcccttatgcttctcacggttctgaatcacacccacacgcccgctgtttctgcctccagt 548 Query: 369 caccat 374 |||||| Sbjct: 547 caccat 542
>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence Length = 1023 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete sequence. Sequence from clones T23A1, F5J6, MJB20 Length = 76170 Score = 44.1 bits (22), Expect = 0.32 Identities = 50/60 (83%) Strand = Plus / Minus Query: 291 gtggatggtctnaaaggntcccttatgcttctccctgttcttgatcacaccaacacgccc 350 ||||||||| | |||| ||||| || ||||| | |||||| ||||||||||||||||| Sbjct: 48796 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 48737
>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence Length = 149455 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 197 ccttggggaggctcacccaag 217 ||||||||||||||||||||| Sbjct: 134897 ccttggggaggctcacccaag 134877
>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA Length = 720 Score = 42.1 bits (21), Expect = 1.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 175 atggtgagcttgatacccttgcccttggg 203 |||| |||||||| ||||||||||||||| Sbjct: 674 atggagagcttgacacccttgcccttggg 646
>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4 (Afu3g06840) partial mRNA Length = 786 Score = 42.1 bits (21), Expect = 1.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 175 atggtgagcttgatacccttgcccttggg 203 ||||||||||| | ||||||||||||||| Sbjct: 740 atggtgagcttaacacccttgcccttggg 712
>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA, isoform A (LOC583495), partial mRNA Length = 285 Score = 42.1 bits (21), Expect = 1.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 241 aacacgttgcccagacnggtggca 264 |||||||||||||||| ||||||| Sbjct: 179 aacacgttgcccagacgggtggca 156
>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence Length = 124792 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 319 ttctccctgttcttgatcaca 339 ||||||||||||||||||||| Sbjct: 120862 ttctccctgttcttgatcaca 120842
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 183 cttgatacccttgcccttggggagg 207 ||||| ||||||||||||||||||| Sbjct: 775952 cttgacacccttgcccttggggagg 775976
>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone MGC:92076 IMAGE:7046733), complete cds Length = 888 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 210 cacccaaggcttggtgcccttgccaatg 237 |||||| |||||| |||||||||||||| Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA Length = 2945 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gccaatggtgaacacgttgc 250 |||||||||||||||||||| Sbjct: 1770 gccaatggtgaacacgttgc 1789
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 gagcttgatacccttgcccttggg 203 |||||||| ||||||||||||||| Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718
>gb|AF359361.3| Gibberella zeae strain GZ3639 trichothecene gene cluster, complete sequence Length = 57840 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 accaacacgcccagtgttgc 358 |||||||||||||||||||| Sbjct: 18319 accaacacgcccagtgttgc 18300
>ref|XM_383708.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03532.1) partial mRNA Length = 1338 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 339 accaacacgcccagtgttgc 358 |||||||||||||||||||| Sbjct: 574 accaacacgcccagtgttgc 593
>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNA06200) partial mRNA Length = 840 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 gagcttgatacccttgcccttggg 203 |||||||| ||||||||||||||| Sbjct: 738 gagcttgacacccttgcccttggg 715
>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA Length = 888 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 210 cacccaaggcttggtgcccttgccaatg 237 |||||| |||||| |||||||||||||| Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone MGC:34152 IMAGE:5198480), complete cds Length = 1554 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 117 gaatcaggccttggcagcagcctg 140 |||||||||||||||||| ||||| Sbjct: 421 gaatcaggccttggcagccgcctg 398
>emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clone 1a13 Length = 2945 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gccaatggtgaacacgttgc 250 |||||||||||||||||||| Sbjct: 1770 gccaatggtgaacacgttgc 1789
>gb|AF336366.2| Gibberella zeae H-11 trichothecene biosynthesis gene cluster, complete sequence Length = 27022 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 339 accaacacgcccagtgttgc 358 |||||||||||||||||||| Sbjct: 772 accaacacgcccagtgttgc 753
>gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179854 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 202 gggaggctcacccaaggcttggtg 225 |||||||||||||||| ||||||| Sbjct: 12827 gggaggctcacccaagccttggtg 12850
>gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Park Cancer Institute Human BAC Library) complete sequence Length = 171236 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 202 gggaggctcacccaaggcttggtg 225 |||||||||||||||| ||||||| Sbjct: 157441 gggaggctcacccaagccttggtg 157464
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 tcaggacaaaacttaaaaaa 45 |||||||||||||||||||| Sbjct: 5078320 tcaggacaaaacttaaaaaa 5078301
>emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 966 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 gttcttgatcacaccaacacgccc 350 |||||| ||||||||||||||||| Sbjct: 656 gttcttaatcacaccaacacgccc 633
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete sequence Length = 215366 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 tgcccttggggaggctcacc 213 |||||||||||||||||||| Sbjct: 213316 tgcccttggggaggctcacc 213297 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,656,198 Number of Sequences: 3902068 Number of extensions: 2656198 Number of successful extensions: 54887 Number of sequences better than 10.0: 104 Number of HSP's better than 10.0 without gapping: 104 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54619 Number of HSP's gapped (non-prelim): 263 length of query: 380 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 358 effective length of database: 17,147,199,772 effective search space: 6138697518376 effective search space used: 6138697518376 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)