ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2c19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC145927.3| Gallus gallus BAC clone CH261-29M22 from chromoso... 46 0.091
2gb|AC169385.2| Mus musculus BAC clone RP23-247C1 from chromosome... 42 1.4
3emb|CR376860.38| Zebrafish DNA sequence from clone DKEY-111H22 i... 42 1.4
4emb|AL592402.12| Human DNA sequence from clone RP11-554K11 on ch... 42 1.4
5gb|AC154606.2| Mus musculus BAC clone RP23-252E10 from chromosom... 42 1.4
6gb|AC154474.2| Mus musculus BAC clone RP24-122P10 from chromosom... 42 1.4
7gb|AC160932.3| Mus musculus BAC clone RP24-275L14 from chromosom... 42 1.4
8gb|AC116763.11| Mus musculus chromosome 5, clone RP23-385G21, co... 42 1.4
9gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, com... 40 5.6
10gb|AC149315.1| Phakopsora pachyrhizi clone JGIAFNA-101K13, compl... 40 5.6
11gb|AC121774.3| Mus musculus BAC clone RP23-350E1 from chromosome... 40 5.6
12ref|XM_547674.2| PREDICTED: Canis familiaris similar to Thioredo... 40 5.6
13emb|AL512587.13| Mouse DNA sequence from clone RP23-467P7 on chr... 40 5.6
14gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 5.6
15emb|AL035251.11|HS705O1 Human DNA sequence from clone RP4-705O1 ... 40 5.6
16gb|AC165053.2| Phakopsora pachyrhizi clone JGIAFNA-1305N22, comp... 40 5.6
17emb|BX510366.5| Zebrafish DNA sequence from clone DKEY-189P24 in... 40 5.6
18dbj|AK048812.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 5.6
19gb|AC122763.9| Mus musculus chromosome 19, clone RP24-68F2, comp... 40 5.6
20gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, comple... 40 5.6
21emb|CT025734.8| Mouse DNA sequence from clone RP24-375J21 on chr... 40 5.6
22emb|CT025681.8| Mouse DNA sequence from clone RP24-325P17 on chr... 40 5.6

>gb|AC145927.3| Gallus gallus BAC clone CH261-29M22 from chromosome unknown, complete
              sequence
          Length = 227692

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 338    aggttgaagctttgtttatgtagatga 364
              |||| ||||||||||||||||||||||
Sbjct: 197219 aggtagaagctttgtttatgtagatga 197193



to top

>gb|AC169385.2| Mus musculus BAC clone RP23-247C1 from chromosome 16, complete sequence
          Length = 206814

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 350    tgtttatgtagatgagagagg 370
              |||||||||||||||||||||
Sbjct: 135791 tgtttatgtagatgagagagg 135771



to top

>emb|CR376860.38| Zebrafish DNA sequence from clone DKEY-111H22 in linkage group 8,
             complete sequence
          Length = 195545

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 119   agtttatgtaaatctgtagct 139
             |||||||||||||||||||||
Sbjct: 32795 agtttatgtaaatctgtagct 32815



to top

>emb|AL592402.12| Human DNA sequence from clone RP11-554K11 on chromosome 1 Contains a
             processed pseudogene similar to ribosomal protein L31
             (RPL31), complete sequence
          Length = 200461

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 313   tcacctcctattcttcagaaa 333
             |||||||||||||||||||||
Sbjct: 86603 tcacctcctattcttcagaaa 86623



to top

>gb|AC154606.2| Mus musculus BAC clone RP23-252E10 from chromosome 16, complete
             sequence
          Length = 181697

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 350   tgtttatgtagatgagagagg 370
             |||||||||||||||||||||
Sbjct: 36649 tgtttatgtagatgagagagg 36629



to top

>gb|AC154474.2| Mus musculus BAC clone RP24-122P10 from chromosome 16, complete
             sequence
          Length = 223585

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 250   tgctctgaagcctggatcatt 270
             |||||||||||||||||||||
Sbjct: 86831 tgctctgaagcctggatcatt 86811



to top

>gb|AC160932.3| Mus musculus BAC clone RP24-275L14 from chromosome 12, complete
             sequence
          Length = 177886

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 236   tctaattttctatctgctctg 256
             |||||||||||||||||||||
Sbjct: 32134 tctaattttctatctgctctg 32154



to top

>gb|AC116763.11| Mus musculus chromosome 5, clone RP23-385G21, complete sequence
          Length = 196521

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 162    gggtttctttgggatcagaag 182
              |||||||||||||||||||||
Sbjct: 124530 gggtttctttgggatcagaag 124510



to top

>gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, complete sequence
          Length = 172282

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    actttattgatataaagtag 32
             ||||||||||||||||||||
Sbjct: 10600 actttattgatataaagtag 10619



to top

>gb|AC149315.1| Phakopsora pachyrhizi clone JGIAFNA-101K13, complete sequence
          Length = 34485

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 347   ctttgtttatgtagatgaga 366
             ||||||||||||||||||||
Sbjct: 24243 ctttgtttatgtagatgaga 24262



to top

>gb|AC121774.3| Mus musculus BAC clone RP23-350E1 from chromosome 5, complete sequence
          Length = 191733

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 13     actttattgatataaagtag 32
              ||||||||||||||||||||
Sbjct: 148900 actttattgatataaagtag 148919



to top

>ref|XM_547674.2| PREDICTED: Canis familiaris similar to Thioredoxin domain
           containing protein 2 (Spermatid-specific thioredoxin-1)
           (Sptrx-1) (LOC490552), mRNA
          Length = 1407

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 314 cacctcctattcttcagaaa 333
           ||||||||||||||||||||
Sbjct: 600 cacctcctattcttcagaaa 619



to top

>emb|AL512587.13| Mouse DNA sequence from clone RP23-467P7 on chromosome 2, complete
              sequence
          Length = 180204

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 379    gcaaagtcatgtgtgatgca 398
              ||||||||||||||||||||
Sbjct: 137512 gcaaagtcatgtgtgatgca 137493



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 56     aactcacggccaatggccacaagg 79
              ||||| ||||||||||||||||||
Sbjct: 595040 aactcgcggccaatggccacaagg 595063



to top

>emb|AL035251.11|HS705O1 Human DNA sequence from clone RP4-705O1 on chromosome 20q11.2 Contains
             a novel gene, complete sequence
          Length = 161888

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 273   tacagtccactgggcttgag 292
             ||||||||||||||||||||
Sbjct: 97925 tacagtccactgggcttgag 97906



to top

>gb|AC165053.2| Phakopsora pachyrhizi clone JGIAFNA-1305N22, complete sequence
          Length = 40161

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 347   ctttgtttatgtagatgaga 366
             ||||||||||||||||||||
Sbjct: 29054 ctttgtttatgtagatgaga 29035



to top

>emb|BX510366.5| Zebrafish DNA sequence from clone DKEY-189P24 in linkage group 5,
            complete sequence
          Length = 179350

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 309  gtggtcacctcctattcttc 328
            ||||||||||||||||||||
Sbjct: 8381 gtggtcacctcctattcttc 8400



to top

>dbj|AK048812.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230071P17 product:hypothetical
            protein, full insert sequence
          Length = 4525

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 379  gcaaagtcatgtgtgatgca 398
            ||||||||||||||||||||
Sbjct: 2120 gcaaagtcatgtgtgatgca 2101



to top

>gb|AC122763.9| Mus musculus chromosome 19, clone RP24-68F2, complete sequence
          Length = 176325

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 318    tcctattcttcagaaagctgaggttgaa 345
              |||||| |||||| ||||||||||||||
Sbjct: 117024 tcctatacttcaggaagctgaggttgaa 116997



to top

>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence
          Length = 38997

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 347  ctttgtttatgtagatgaga 366
            ||||||||||||||||||||
Sbjct: 3334 ctttgtttatgtagatgaga 3353



to top

>emb|CT025734.8| Mouse DNA sequence from clone RP24-375J21 on chromosome 14, complete
              sequence
          Length = 187933

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 355    atgtagatgagagagggcct 374
              ||||||||||||||||||||
Sbjct: 157299 atgtagatgagagagggcct 157280



to top

>emb|CT025681.8| Mouse DNA sequence from clone RP24-325P17 on chromosome 14, complete
              sequence
          Length = 205581

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 306    tccgtggtcacctcctattcttca 329
              ||||||||| ||||||||||||||
Sbjct: 189140 tccgtggtctcctcctattcttca 189117


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,362,536
Number of Sequences: 3902068
Number of extensions: 3362536
Number of successful extensions: 64459
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64416
Number of HSP's gapped (non-prelim): 43
length of query: 420
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 398
effective length of database: 17,147,199,772
effective search space: 6824585509256
effective search space used: 6824585509256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top