ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd2b03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC076744.1| Xenopus laevis MGC82241 protein, mRNA (cDNA clone... 62 8e-07
2gb|BC072192.1| Xenopus laevis hypothetical protein MGC80376, mRN... 58 1e-05
3gb|AC147203.2| Xenopus tropicalis clone Ch216-104J11, complete s... 58 1e-05
4gb|AC147825.2| Xenopus tropicalis clone CH216-135H10, complete s... 54 2e-04
5gb|BC070637.1| Xenopus laevis hypothetical protein MGC81481, mRN... 52 7e-04
6gb|AC147885.2| Xenopus tropicalis clone CH216-12C9, complete seq... 52 7e-04
7gb|AC145802.2| Xenopus tropicalis clone CH216-80C17, complete se... 52 7e-04
8gb|BC054284.1| Xenopus laevis hypothetical protein MGC64530, mRN... 52 7e-04
9gb|AC149877.2| Xenopus tropicalis clone CH216-23F19, complete se... 52 7e-04
10gb|BC084955.1| Xenopus laevis hypothetical LOC495497, mRNA (cDNA... 52 7e-04
11gb|BC080386.1| Xenopus laevis MGC81962 protein, mRNA (cDNA clone... 50 0.003
12gb|BC070691.1| Xenopus laevis hypothetical protein MGC83145, mRN... 50 0.003
13gb|BC044077.1| Xenopus laevis hypothetical protein MGC52668, mRN... 50 0.003
14gb|BC108784.1| Xenopus laevis cDNA clone MGC:132108 IMAGE:694902... 48 0.011
15gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequ... 48 0.011
16gb|BC080012.1| Xenopus laevis MGC81893 protein, mRNA (cDNA clone... 48 0.011
17gb|AC145807.2| Xenopus tropicalis clone CH216-9P15, complete seq... 48 0.011
18gb|BC044312.1| Xenopus laevis hypothetical protein MGC52634, mRN... 48 0.011
19gb|BC057716.1| Xenopus laevis hypothetical protein MGC68865, mRN... 48 0.011
20gb|AC145790.2| Xenopus tropicalis clone CH216-12L5, complete seq... 48 0.011
21gb|BC083039.1| Xenopus laevis hypothetical LOC494867, mRNA (cDNA... 48 0.011
22gb|AC157701.2| Xenopus tropicalis clone ISB1-213C6, complete seq... 48 0.011
23gb|AC149156.3| Xenopus tropicalis clone ISB-258L19, complete seq... 46 0.045
24gb|AC147893.2| Xenopus tropicalis clone CH216-36J13, complete se... 46 0.045
25gb|AC147826.2| Xenopus tropicalis clone CH216-138M21, complete s... 46 0.045
26emb|CT030471.1| Xenopus tropicalis finished cDNA, clone TGas056c05 46 0.045
27gb|AC155997.2| Xenopus tropicalis clone ISB1-312F22, complete se... 46 0.045
28gb|AC149149.3| Xenopus tropicalis clone ISB-175F5, complete sequ... 46 0.045
29gb|BC097818.1| Xenopus laevis cDNA clone IMAGE:3377466 46 0.045
30gb|BC044299.1| Xenopus laevis, clone IMAGE:5570153, mRNA 46 0.045
31gb|BC110763.1| Xenopus laevis cDNA clone MGC:131088 IMAGE:798193... 46 0.045
32gb|BC081064.1| Xenopus laevis MGC81964 protein, mRNA (cDNA clone... 44 0.18
33gb|BC072149.1| Xenopus laevis hypothetical protein MGC80075, mRN... 44 0.18
34gb|AC148455.2| Xenopus tropicalis clone CH216-165I8, complete se... 44 0.18
35gb|BC061649.1| Xenopus laevis hypothetical protein MGC68551, mRN... 44 0.18
36gb|AC156003.2| Xenopus tropicalis clone ISB1-353C11, complete se... 44 0.18
37gb|BC056059.1| Xenopus laevis cathepsin S, mRNA (cDNA clone MGC:... 44 0.18
38gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete se... 44 0.18
39gb|AC148599.2| Xenopus tropicalis clone CH216-2G20, complete seq... 44 0.18
40gb|AC147912.2| Xenopus tropicalis clone CH216-83D6, complete seq... 44 0.18
41emb|CR942772.2| Xenopus tropicalis finished cDNA, clone TEgg036g05 44 0.18
42gb|AC140672.5| Mus musculus BAC clone RP24-208P4 from chromosome... 44 0.18
43ref|NM_001017288.2| Xenopus tropicalis hypothetical protein LOC5... 42 0.70
44gb|BC085045.1| Xenopus laevis cDNA clone IMAGE:5513587, partial cds 42 0.70
45gb|BC084599.1| Xenopus laevis cDNA clone IMAGE:3401855 42 0.70
46gb|BC106398.1| Xenopus laevis cDNA clone MGC:131019 IMAGE:797975... 42 0.70
47gb|BC081039.1| Xenopus laevis MGC81738 protein, mRNA (cDNA clone... 42 0.70
48gb|BC081219.1| Xenopus laevis MGC85240 protein, mRNA (cDNA clone... 42 0.70
49gb|BC076648.1| Xenopus tropicalis MGC79476 protein, mRNA (cDNA c... 42 0.70
50gb|BC081003.1| Xenopus laevis MGC81274 protein, mRNA (cDNA clone... 42 0.70
51gb|BC079702.1| Xenopus laevis MGC81785 protein, mRNA (cDNA clone... 42 0.70
52gb|AC147887.2| Xenopus tropicalis clone CH216-147L5, complete se... 42 0.70
53gb|BC072946.1| Xenopus laevis MGC80529 protein, mRNA (cDNA clone... 42 0.70
54gb|AC155972.2| Xenopus tropicalis clone CH216-33N3, complete seq... 42 0.70
55gb|BC072928.1| Xenopus laevis cDNA clone MGC:80440 IMAGE:5155640... 42 0.70
56gb|BC054253.1| Xenopus laevis hypothetical protein MGC64464, mRN... 42 0.70
57gb|AC156250.2| Xenopus tropicalis clone ISB1-258K10, complete se... 42 0.70
58gb|AC156251.2| Xenopus tropicalis clone ISB1-273O4, complete seq... 42 0.70
59ref|NM_001015921.2| Xenopus tropicalis matrix metallopeptidase 1... 42 0.70
60gb|AC149518.2| Xenopus tropicalis clone CH216-59A18, complete se... 42 0.70
61gb|AC147889.2| Xenopus tropicalis clone CH216-168F2, complete se... 42 0.70
62gb|AC151346.2| Xenopus tropicalis clone ISB-384J24, complete seq... 42 0.70
63gb|AC155990.2| Xenopus tropicalis clone ISB1-282D1, complete seq... 42 0.70
64ref|XM_393893.2| PREDICTED: Apis mellifera similar to GA17752-PA... 42 0.70
65gb|AC152932.2| Xenopus tropicalis clone ISB1-31M3, complete sequ... 42 0.70
66ref|NM_001005002.1| Xenopus tropicalis MGC79476 protein (MGC7947... 42 0.70
67gb|AC157689.2| Xenopus tropicalis clone ISB1-171O22, complete se... 42 0.70
68gb|BC092315.1| Xenopus laevis cDNA clone IMAGE:6946280, partial cds 42 0.70
69emb|CR855692.2| Xenopus tropicalis finished cDNA, clone TGas092h03 42 0.70
70emb|CR942569.2| Xenopus tropicalis finished cDNA, clone TGas043a13 42 0.70
71emb|CR942710.2| Xenopus tropicalis finished cDNA, clone TNeu055i10 42 0.70
72emb|CR926404.2| Xenopus tropicalis finished cDNA, clone TGas120b12 42 0.70
73gb|AC147839.2| Xenopus tropicalis clone CH216-9N23, complete seq... 42 0.70
74gb|BC084929.1| Xenopus laevis hypothetical LOC495419, mRNA (cDNA... 42 0.70
75gb|AC151309.2| Xenopus tropicalis clone CH216-97A24, complete se... 42 0.70
76gb|DP000015.1| Xenopus tropicalis target 1 genomic scaffold 40 2.8
77gb|BC077765.1| Xenopus laevis TFIIS elongation factor, mRNA (cDN... 40 2.8
78gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669... 40 2.8
79gb|BC070612.1| Xenopus laevis hypothetical protein MGC81341, mRN... 40 2.8
80gb|AC151324.2| Xenopus tropicalis clone ISB-266M19, complete seq... 40 2.8
81gb|BC046272.1| Xenopus laevis speckle-type POZ protein, mRNA (cD... 40 2.8
82gb|AC146801.2| Xenopus tropicalis clone CH216-59H14, complete se... 40 2.8
83gb|AC148453.2| Xenopus tropicalis clone CH216-147I21, complete s... 40 2.8
84gb|BC060749.1| Xenopus laevis hypothetical protein MGC68966, mRN... 40 2.8
85gb|AC131151.2| Homo sapiens 3 BAC RP11-219E24 (Roswell Park Canc... 40 2.8
86gb|BC054268.1| Xenopus laevis inositol(myo)-1(or 4)-monophosphat... 40 2.8
87gb|BC056849.1| Xenopus laevis Chymotrypsinogen 2, mRNA (cDNA clo... 40 2.8
88emb|X81986.1|XLXSUG1 X.laevis XSUG1 mRNA 40 2.8
89emb|X12525.1|XLACTA Xenopus laevis sarcomeric alpha 3-actin gene 40 2.8
90gb|AC149594.2| Xenopus tropicalis chromosome CH216-62P2, complet... 40 2.8
91gb|AC148449.2| Xenopus tropicalis clone CH216-118D6, complete se... 40 2.8
92gb|BC099004.1| Xenopus laevis cDNA clone IMAGE:3746025, partial cds 40 2.8
93gb|AC160834.3| Xenopus tropicalis clone ISB1-89K8, complete sequ... 40 2.8
94gb|BC114211.1| Xenopus laevis cDNA clone IMAGE:7394716 40 2.8
95gb|AC092673.3| Homo sapiens BAC clone RP11-624A4 from 4, complet... 40 2.8
96gb|AC151361.2| Xenopus tropicalis clone ISB-9I1, complete sequence 40 2.8
97gb|AC145796.2| Xenopus tropicalis clone CH216-19K4, complete seq... 40 2.8
98gb|AC149879.2| Xenopus tropicalis clone CH216-40M16, complete se... 40 2.8
99gb|BC097896.1| Xenopus laevis cDNA clone IMAGE:6325610 40 2.8
100gb|BC090056.1| Xenopus laevis cDNA clone MGC:69062 IMAGE:4965751... 40 2.8
101gb|BC094198.1| Xenopus laevis cDNA clone IMAGE:6956323, partial cds 40 2.8
102gb|BC044965.1| Xenopus laevis, clone IMAGE:4889220, mRNA 40 2.8
103gb|BC093489.1| Xenopus laevis cDNA clone MGC:98819 IMAGE:3400699... 40 2.8
104emb|AJ006236.1|NTA6236 Nicotiana tabacum DNA fragment for K81 le... 40 2.8
105gb|AC149515.2| Xenopus tropicalis clone CH216-35C7, complete seq... 40 2.8
106gb|AC148600.2| Xenopus tropicalis clone CH216-62H10, complete se... 40 2.8
107gb|BC086458.1| Xenopus laevis hypothetical LOC495825, mRNA (cDNA... 40 2.8
108gb|BC084070.1| Xenopus laevis hypothetical LOC494987, mRNA (cDNA... 40 2.8
109gb|AC151318.2| Xenopus tropicalis clone ISB-241L4, complete sequ... 40 2.8
110gb|BC110955.1| Xenopus laevis cDNA clone IMAGE:6642407 40 2.8
111gb|U63711.1|XLU63711 Xenopus laevis xefiltin mRNA, complete cds 40 2.8
112gb|AC151352.2| Xenopus tropicalis clone ISB-48G11, complete sequ... 40 2.8
113gb|AF078162.1| Xenopus laevis Xbr-1a/Xvent-2 protein (Xbr-1a/Xve... 40 2.8
114emb|AL772217.10| Mouse DNA sequence from clone RP23-160K5 on chr... 40 2.8 
>gb|BC076744.1| Xenopus laevis MGC82241 protein, mRNA (cDNA clone MGC:82241
            IMAGE:4031212), complete cds
          Length = 2961

 Score = 61.9 bits (31), Expect = 8e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 92   aagtagggatgcaccaaatccaatattttgggatt 126
            |||||||||||||||||||||| ||||||||||||
Sbjct: 2356 aagtagggatgcaccaaatccactattttgggatt 2322
to top
>gb|BC072192.1| Xenopus laevis hypothetical protein MGC80376, mRNA (cDNA clone
            MGC:80376 IMAGE:5074675), complete cds
          Length = 3308

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            |||||||||||||||||||||||||||||
Sbjct: 3029 gtagggatgcaccaaatccaatattttgg 3001
to top
>gb|AC147203.2| Xenopus tropicalis clone Ch216-104J11, complete sequence
          Length = 148959

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 95    tagggatgcaccaaatccaatattttgggattnggc 130
             ||||||||||||||||||| |||||||||||| |||
Sbjct: 17050 tagggatgcaccaaatccactattttgggattcggc 17085
to top
>gb|AC147825.2| Xenopus tropicalis clone CH216-135H10, complete sequence
          Length = 174462

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                       
Query: 97     gggatgcaccaaatccaatattttgggattnggctgnaccc 137
              ||||||||||||| ||| |||||||||||| ||||| ||||
Sbjct: 164121 gggatgcaccaaaaccactattttgggatttggctgaaccc 164081
to top
>gb|BC070637.1| Xenopus laevis hypothetical protein MGC81481, mRNA (cDNA clone
            MGC:81481 IMAGE:6636554), complete cds
          Length = 3885

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 40/44 (90%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                        
Query: 95   tagggatgcaccaaatccaatattttgggattnggctgnacccc 138
            ||||||||||||||||||| |||||| ||||| ||||| |||||
Sbjct: 3521 tagggatgcaccaaatccactatttt-ggattcggctgaacccc 3479
to top
>gb|AC147885.2| Xenopus tropicalis clone CH216-12C9, complete sequence
          Length = 222162

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 95    tagggatgcaccaaatccaatattttgggattnggctgnacccc 138
             |||||||||||  |||||||||||||| |||| ||||| |||||
Sbjct: 62951 tagggatgcactgaatccaatattttgtgattcggctgaacccc 62994
to top
>gb|AC145802.2| Xenopus tropicalis clone CH216-80C17, complete sequence
          Length = 163910

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 94   gtagggatgcaccaaatccaatattttgggattnggc 130
            ||||||||||||||||| || |||||||||||| |||
Sbjct: 7663 gtagggatgcaccaaatacactattttgggatttggc 7627
to top
>gb|BC054284.1| Xenopus laevis hypothetical protein MGC64530, mRNA (cDNA clone
           MGC:64530 IMAGE:6878232), complete cds
          Length = 1523

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 93  agtagggatgcaccaaatccaatattttgg 122
           ||||||||||||||||||||| ||||||||
Sbjct: 921 agtagggatgcaccaaatccactattttgg 950
to top
>gb|AC149877.2| Xenopus tropicalis clone CH216-23F19, complete sequence
          Length = 176807

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 95     tagggatgcaccaaatccaatattttgggattnggctgnacccc 138
              |||||||||||||||||||  |||||||||||  |||| |||||
Sbjct: 149014 tagggatgcaccaaatccacaattttgggattttgctgaacccc 148971
to top
>gb|BC084955.1| Xenopus laevis hypothetical LOC495497, mRNA (cDNA clone MGC:83733
            IMAGE:6639817), complete cds
          Length = 5732

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 93   agtagggatgcaccaaatccaatattttgggatt 126
            |||| |||||||||||||||| ||||||||||||
Sbjct: 2448 agtaaggatgcaccaaatccactattttgggatt 2415
to top
>gb|BC080386.1| Xenopus laevis MGC81962 protein, mRNA (cDNA clone MGC:81962
            IMAGE:7010196), complete cds
          Length = 2672

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            |||||||||||||||||||| ||||||||
Sbjct: 1889 gtagggatgcaccaaatccactattttgg 1917
to top
>gb|BC070691.1| Xenopus laevis hypothetical protein MGC83145, mRNA (cDNA clone
            MGC:83145 IMAGE:6318912), complete cds
          Length = 3145

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            |||||| ||||||||||||||||||||||
Sbjct: 2715 gtagggctgcaccaaatccaatattttgg 2687
to top
>gb|BC044077.1| Xenopus laevis hypothetical protein MGC52668, mRNA (cDNA clone
            MGC:52668 IMAGE:4682427), complete cds
          Length = 2281

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 90   tcaagtagggatgcaccaaatccaatattttgg 122
            ||||||||||||||||| |||||| ||||||||
Sbjct: 2043 tcaagtagggatgcaccgaatccactattttgg 2011
to top
>gb|BC108784.1| Xenopus laevis cDNA clone MGC:132108 IMAGE:6949024, complete cds
          Length = 2174

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||||||||||||||||| ||||||||
Sbjct: 1890 tagggatgcaccaaatccactattttgg 1863
to top
>gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequence
          Length = 88948

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 95    tagggatgcaccaaatccaatattttgggatt 126
             ||||||||||||||||||| | ||||||||||
Sbjct: 45254 tagggatgcaccaaatccactgttttgggatt 45285
to top
>gb|BC080012.1| Xenopus laevis MGC81893 protein, mRNA (cDNA clone MGC:81893
           IMAGE:7008902), complete cds
          Length = 1229

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 95  tagggatgcaccaaatccaatattttgg 122
           ||||||||||||||||||| ||||||||
Sbjct: 897 tagggatgcaccaaatccattattttgg 870
to top
>gb|AC145807.2| Xenopus tropicalis clone CH216-9P15, complete sequence
          Length = 225808

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 41/46 (89%), Gaps = 1/46 (2%)
 Strand = Plus / Plus

                                                            
Query: 92     aagtagggatgcaccaaatccaatattttgggattnggctgnaccc 137
              ||||||||||||||| ||||| | ||||||||||| ||||| ||||
Sbjct: 130561 aagtagggatgcaccgaatcc-acattttgggatttggctgaaccc 130605
to top
>gb|BC044312.1| Xenopus laevis hypothetical protein MGC52634, mRNA (cDNA clone
            MGC:52634 IMAGE:4681372), complete cds
          Length = 5657

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||||||||||||||||| ||||||||
Sbjct: 4268 tagggatgcaccaaatccactattttgg 4295



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 3298 tagggatgcaccgaatccactattttgg 3325
to top
>gb|BC057716.1| Xenopus laevis hypothetical protein MGC68865, mRNA (cDNA clone
            MGC:68865 IMAGE:4680752), complete cds
          Length = 3248

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||||||||||||||||| ||||||||
Sbjct: 2841 tagggatgcaccaaatccactattttgg 2868
to top
>gb|AC145790.2| Xenopus tropicalis clone CH216-12L5, complete sequence
          Length = 192318

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 95    tagggatgcaccaaatccaatattttgggatt 126
             ||||||||||||||||||| |||||| |||||
Sbjct: 74488 tagggatgcaccaaatccactattttcggatt 74457
to top
>gb|BC083039.1| Xenopus laevis hypothetical LOC494867, mRNA (cDNA clone
            IMAGE:3401708), partial cds
          Length = 3296

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||||||||||||||||| ||||||||
Sbjct: 2453 tagggatgcaccaaatccactattttgg 2426
to top
>gb|AC157701.2| Xenopus tropicalis clone ISB1-213C6, complete sequence
          Length = 61021

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 95   tagggatgcaccaaatccaatattttgggatt 126
            ||||| ||||||||||||| ||||||||||||
Sbjct: 6025 tagggctgcaccaaatccattattttgggatt 6056
to top
>gb|AC149156.3| Xenopus tropicalis clone ISB-258L19, complete sequence
          Length = 70067

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 93    agtagggatgcaccaaatccaatattttggg 123
             ||||||||||||||||||||| | |||||||
Sbjct: 66374 agtagggatgcaccaaatccacttttttggg 66344
to top
>gb|AC147893.2| Xenopus tropicalis clone CH216-36J13, complete sequence
          Length = 159658

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 95    tagggatgcaccaaatccaatattttg 121
             ||||||||||||||||||| |||||||
Sbjct: 11599 tagggatgcaccaaatccactattttg 11573
to top
>gb|AC147826.2| Xenopus tropicalis clone CH216-138M21, complete sequence
          Length = 145416

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 95    tagggatgcaccaaatccaatattttgggat 125
             ||||||| ||||||||||| |||||||||||
Sbjct: 64929 tagggatacaccaaatccactattttgggat 64899
to top
>emb|CT030471.1| Xenopus tropicalis finished cDNA, clone TGas056c05
          Length = 5736

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 95   tagggatgcaccaaatccaatattttgggat 125
            ||||||||||||||||||| |||||| ||||
Sbjct: 4025 tagggatgcaccaaatccactattttaggat 4055
to top
>gb|AC155997.2| Xenopus tropicalis clone ISB1-312F22, complete sequence
          Length = 43201

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 95    tagggatgcaccaaatccaatattttgggat 125
             ||||||||||||||||||| |||||| ||||
Sbjct: 27817 tagggatgcaccaaatccactattttaggat 27847
to top
>gb|AC149149.3| Xenopus tropicalis clone ISB-175F5, complete sequence
          Length = 116498

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 100   atgcaccaaatccaatattttgggatt 126
             |||||||||||||| ||||||||||||
Sbjct: 86696 atgcaccaaatccactattttgggatt 86722
to top
>gb|BC097818.1| Xenopus laevis cDNA clone IMAGE:3377466
          Length = 2087

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 95   tagggatgcaccaaatccaatattttg 121
            ||||||||||||||||||| |||||||
Sbjct: 1677 tagggatgcaccaaatccactattttg 1703
to top
>gb|BC044299.1| Xenopus laevis, clone IMAGE:5570153, mRNA
          Length = 6142

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 92   aagtagggatgcaccaaatccaatattttgg 122
            |||||||||||||||||||||| || |||||
Sbjct: 5024 aagtagggatgcaccaaatccactactttgg 4994
to top
>gb|BC110763.1| Xenopus laevis cDNA clone MGC:131088 IMAGE:7981931, complete cds
          Length = 2304

 Score = 46.1 bits (23), Expect = 0.045
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 96   agggatgcaccaaatccaatattttgggatt 126
            |||||||||||||||||| |||||| |||||
Sbjct: 2056 agggatgcaccaaatccactattttaggatt 2026
to top
>gb|BC081064.1| Xenopus laevis MGC81964 protein, mRNA (cDNA clone MGC:81964
            IMAGE:7010204), complete cds
          Length = 1247

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 39/44 (88%), Gaps = 1/44 (2%)
 Strand = Plus / Minus

                                                        
Query: 95   tagggatgcaccaaatccaatattttgggattnggctgnacccc 138
            |||||||||||| |||||| |||||| ||||| ||||| |||||
Sbjct: 1077 tagggatgcaccgaatccactatttt-ggatttggctgaacccc 1035
to top
>gb|BC072149.1| Xenopus laevis hypothetical protein MGC80075, mRNA (cDNA clone
            MGC:80075 IMAGE:4680108), complete cds
          Length = 4390

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 93   agtagggatgcaccaaatccaatattttgg 122
            |||||||||||||| |||||| ||||||||
Sbjct: 2129 agtagggatgcaccgaatccactattttgg 2158



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 3425 tagggatgcaccgaatccactattttgg 3452
to top
>gb|AC148455.2| Xenopus tropicalis clone CH216-165I8, complete sequence
          Length = 170350

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 92    aagtagggatgcaccaaatcca 113
             ||||||||||||||||||||||
Sbjct: 81096 aagtagggatgcaccaaatcca 81075
to top
>gb|BC061649.1| Xenopus laevis hypothetical protein MGC68551, mRNA (cDNA clone
            MGC:68551 IMAGE:4031333), complete cds
          Length = 2337

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 92   aagtagggatgcaccaaatccaatattttg 121
            ||||||||||||||| |||||| |||||||
Sbjct: 1645 aagtagggatgcaccgaatccactattttg 1674



 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 95   tagggatgcaccaaatccaatattt 119
            ||||||||||||||||||| |||||
Sbjct: 1924 tagggatgcaccaaatccactattt 1948
to top
>gb|AC156003.2| Xenopus tropicalis clone ISB1-353C11, complete sequence
          Length = 78198

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 95    tagggatgcaccaaatccaatatttt 120
             ||||||||||||||||||| ||||||
Sbjct: 64075 tagggatgcaccaaatccattatttt 64050



 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 92   aagtagggatgcaccaaatcc 112
            |||||||||||||||||||||
Sbjct: 1825 aagtagggatgcaccaaatcc 1845
to top
>gb|BC056059.1| Xenopus laevis cathepsin S, mRNA (cDNA clone MGC:69026
            IMAGE:4964455), complete cds
          Length = 2248

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 95   tagggatgcaccaaatccaatatttt 120
            ||||||||||||||||||| ||||||
Sbjct: 1745 tagggatgcaccaaatccactatttt 1770
to top
>gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete sequence
          Length = 178580

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 95    tagggatgcaccaaatccaatatttt 120
             ||||||||||||||||||| ||||||
Sbjct: 30798 tagggatgcaccaaatccactatttt 30773



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 92    aagtagggatgcaccaaatcca 113
             ||||||||||||||||||||||
Sbjct: 30541 aagtagggatgcaccaaatcca 30562



 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 93    agtagggatgcaccaaatcca 113
             |||||||||||||||||||||
Sbjct: 56041 agtagggatgcaccaaatcca 56021
to top
>gb|AC148599.2| Xenopus tropicalis clone CH216-2G20, complete sequence
          Length = 206059

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 92    aagtagggatgcaccaaatcca 113
             ||||||||||||||||||||||
Sbjct: 27978 aagtagggatgcaccaaatcca 27957



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 95    tagggatgcaccaaatccaatatttt 120
             ||||||||||||||||||| ||||||
Sbjct: 27721 tagggatgcaccaaatccactatttt 27746



 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 2478 agtagggatgcaccaaatcca 2498
to top
>gb|AC147912.2| Xenopus tropicalis clone CH216-83D6, complete sequence
          Length = 169803

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 95    tagggatgcaccaaatccaatatttt 120
             ||||||||||||||||||| ||||||
Sbjct: 70033 tagggatgcaccaaatccactatttt 70008
to top
>emb|CR942772.2| Xenopus tropicalis finished cDNA, clone TEgg036g05
          Length = 3867

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 90   tcaagtagggatgcaccaaatccaatattt 119
            |||| |||||||||||||||||| ||||||
Sbjct: 3231 tcaactagggatgcaccaaatcccatattt 3202
to top
>gb|AC140672.5| Mus musculus BAC clone RP24-208P4 from chromosome 8, complete sequence
          Length = 212819

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 174    ccgaatctgaatttgcacacgc 195
              ||||||||||||||||||||||
Sbjct: 156715 ccgaatctgaatttgcacacgc 156736
to top
>ref|NM_001017288.2| Xenopus tropicalis hypothetical protein LOC550042 (LOC550042), mRNA
          Length = 1221

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 88   tatcaagtagggatgcaccaaatccaatatttt 120
            |||||| ||||||||||| ||||||| ||||||
Sbjct: 973  tatcaattagggatgcactaaatccactatttt 1005
to top
>gb|BC085045.1| Xenopus laevis cDNA clone IMAGE:5513587, partial cds
          Length = 4555

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 95   tagggatgcaccaaatccaatattt 119
            ||||||||||||||||||| |||||
Sbjct: 3927 tagggatgcaccaaatccactattt 3951
to top
>gb|BC084599.1| Xenopus laevis cDNA clone IMAGE:3401855
          Length = 1899

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            ||||||||||||| |||||| ||||||||
Sbjct: 1194 gtagggatgcacccaatccactattttgg 1222
to top
>gb|BC106398.1| Xenopus laevis cDNA clone MGC:131019 IMAGE:7979750, complete cds
          Length = 1579

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 95  tagggatgcaccaaatccaatattt 119
           ||||||||||||||||||| |||||
Sbjct: 728 tagggatgcaccaaatccactattt 752
to top
>gb|BC081039.1| Xenopus laevis MGC81738 protein, mRNA (cDNA clone MGC:81738
            IMAGE:6865582), complete cds
          Length = 3842

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 95   tagggatgcaccaaatccaatattt 119
            ||||||||||||||||||| |||||
Sbjct: 2898 tagggatgcaccaaatccagtattt 2874
to top
>gb|BC081219.1| Xenopus laevis MGC85240 protein, mRNA (cDNA clone MGC:85240
            IMAGE:6873083), complete cds
          Length = 2159

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            ||||| |||||||||||||| ||||||||
Sbjct: 1628 gtaggaatgcaccaaatccactattttgg 1600
to top
>gb|BC076648.1| Xenopus tropicalis MGC79476 protein, mRNA (cDNA clone MGC:79476
            IMAGE:6976471), complete cds
          Length = 2950

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 1313 agtagggatgcaccaaatcca 1333
to top
>gb|BC081003.1| Xenopus laevis MGC81274 protein, mRNA (cDNA clone MGC:81274
            IMAGE:6631737), complete cds
          Length = 2842

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            ||||||||||||| |||||| ||||||||
Sbjct: 1268 gtagggatgcacccaatccactattttgg 1296
to top
>gb|BC079702.1| Xenopus laevis MGC81785 protein, mRNA (cDNA clone MGC:81785
            IMAGE:6866603), complete cds
          Length = 4439

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 95   tagggatgcaccaaatccaatattt 119
            |||||||||||| ||||||||||||
Sbjct: 2780 tagggatgcaccgaatccaatattt 2804
to top
>gb|AC147887.2| Xenopus tropicalis clone CH216-147L5, complete sequence
          Length = 176251

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 92     aagtagggatgcaccaaatccaatatttt 120
              ||||| |||||||||||||||| ||||||
Sbjct: 143110 aagtaaggatgcaccaaatccactatttt 143082
to top
>gb|BC072946.1| Xenopus laevis MGC80529 protein, mRNA (cDNA clone MGC:80529
            IMAGE:5157302), complete cds
          Length = 4403

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 94   gtagggatgcaccaaatccaatattttgg 122
            ||||||||||||| |||||| ||||||||
Sbjct: 3925 gtagggatgcaccgaatccactattttgg 3897



 Score = 42.1 bits (21), Expect = 0.70
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 94   gtagggatgcaccaaatccaatattttgggatt 126
            ||||||||||||| |||||| |||||| |||||
Sbjct: 3791 gtagggatgcaccgaatccactatttttggatt 3759
to top
>gb|AC155972.2| Xenopus tropicalis clone CH216-33N3, complete sequence
          Length = 66217

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 92    aagtagggatgcaccaaatcc 112
             |||||||||||||||||||||
Sbjct: 48904 aagtagggatgcaccaaatcc 48884
to top
>gb|BC072928.1| Xenopus laevis cDNA clone MGC:80440 IMAGE:5155640, complete cds
          Length = 6060

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 95   tagggatgcaccaaatccaatattt 119
            ||||||||||||||||||| |||||
Sbjct: 4789 tagggatgcaccaaatccactattt 4813
to top
>gb|BC054253.1| Xenopus laevis hypothetical protein MGC64464, mRNA (cDNA clone
            MGC:64464 IMAGE:6880991), complete cds
          Length = 1556

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 1450 agtagggatgcaccaaatcca 1430
to top
>gb|AC156250.2| Xenopus tropicalis clone ISB1-258K10, complete sequence
          Length = 79665

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 96    agggatgcaccaaatccaatatttt 120
             |||||||||||||||||| ||||||
Sbjct: 41651 agggatgcaccaaatccactatttt 41675
to top
>gb|AC156251.2| Xenopus tropicalis clone ISB1-273O4, complete sequence
          Length = 52150

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 96    agggatgcaccaaatccaatatttt 120
             |||||||||||||||||| ||||||
Sbjct: 26862 agggatgcaccaaatccactatttt 26838
to top
>ref|NM_001015921.2| Xenopus tropicalis matrix metallopeptidase 15 (membrane-inserted)
            (mmp15), mRNA
          Length = 3499

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 2839 agtagggatgcaccaaatcca 2859
to top
>gb|AC149518.2| Xenopus tropicalis clone CH216-59A18, complete sequence
          Length = 210140

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                  
Query: 95     tagggatgcaccaaatccaatattttgggattnggc 130
              |||||||||||| |||||| |||||| ||||| |||
Sbjct: 139393 tagggatgcaccgaatccactattttcggatttggc 139428
to top
>gb|AC147889.2| Xenopus tropicalis clone CH216-168F2, complete sequence
          Length = 150457

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 95    tagggatgcaccaaatccaatattt 119
             ||||||||||||||||||| |||||
Sbjct: 43932 tagggatgcaccaaatccactattt 43956
to top
>gb|AC151346.2| Xenopus tropicalis clone ISB-384J24, complete sequence
          Length = 81038

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 93    agtagggatgcaccaaatcca 113
             |||||||||||||||||||||
Sbjct: 65312 agtagggatgcaccaaatcca 65332
to top
>gb|AC155990.2| Xenopus tropicalis clone ISB1-282D1, complete sequence
          Length = 95725

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 93    agtagggatgcaccaaatcca 113
             |||||||||||||||||||||
Sbjct: 21588 agtagggatgcaccaaatcca 21608



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 91    caagtagggatgcaccaaatccaatattttgg 122
             |||||||||||||||| |||||| | ||||||
Sbjct: 65087 caagtagggatgcaccgaatccacttttttgg 65056
to top
>ref|XM_393893.2| PREDICTED: Apis mellifera similar to GA17752-PA (LOC410413), mRNA
          Length = 5031

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 163  tgaaaatcaaaccgaatctga 183
            |||||||||||||||||||||
Sbjct: 2261 tgaaaatcaaaccgaatctga 2281
to top
>gb|AC152932.2| Xenopus tropicalis clone ISB1-31M3, complete sequence
          Length = 78419

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 93    agtagggatgcaccaaatcca 113
             |||||||||||||||||||||
Sbjct: 52531 agtagggatgcaccaaatcca 52551
to top
>ref|NM_001005002.1| Xenopus tropicalis MGC79476 protein (MGC79476), mRNA
          Length = 2950

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 1313 agtagggatgcaccaaatcca 1333
to top
>gb|AC157689.2| Xenopus tropicalis clone ISB1-171O22, complete sequence
          Length = 80070

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 98    ggatgcaccaaatccaatattttgggatt 126
             ||||||||| |||||| ||||||||||||
Sbjct: 64561 ggatgcaccgaatccactattttgggatt 64589
to top
>gb|BC092315.1| Xenopus laevis cDNA clone IMAGE:6946280, partial cds
          Length = 2780

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 1183 agtagggatgcaccaaatcca 1163
to top
>emb|CR855692.2| Xenopus tropicalis finished cDNA, clone TGas092h03
          Length = 1221

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 88   tatcaagtagggatgcaccaaatccaatatttt 120
            |||||| ||||||||||| ||||||| ||||||
Sbjct: 973  tatcaattagggatgcactaaatccactatttt 1005
to top
>emb|CR942569.2| Xenopus tropicalis finished cDNA, clone TGas043a13
          Length = 3633

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                   
Query: 100  atgcaccaaatccaatattttgggattnggctgnacccc 138
            |||||||||||||| |||||| || || ||||| |||||
Sbjct: 1503 atgcaccaaatccactatttttgggttcggctgaacccc 1541
to top
>emb|CR942710.2| Xenopus tropicalis finished cDNA, clone TNeu055i10
          Length = 3061

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                       
Query: 96   agggatgcaccaaatccaatattttgggattnggctgnacccc 138
            ||||||||||  |||||| |||||||||||  ||||| |||||
Sbjct: 2434 agggatgcactgaatccactattttgggatacggctgaacccc 2392
to top
>emb|CR926404.2| Xenopus tropicalis finished cDNA, clone TGas120b12
          Length = 3499

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 2839 agtagggatgcaccaaatcca 2859
to top
>gb|AC147839.2| Xenopus tropicalis clone CH216-9N23, complete sequence
          Length = 184473

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                       
Query: 95   tagggatgcaccaaatccaatattttgggattnggctgnaccc 137
            |||||||||||   ||||| |||||||||||| ||||| ||||
Sbjct: 6869 tagggatgcacgggatccactattttgggatttggctgaaccc 6911
to top
>gb|BC084929.1| Xenopus laevis hypothetical LOC495419, mRNA (cDNA clone MGC:81579
            IMAGE:6863348), complete cds
          Length = 4129

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 93   agtagggatgcaccaaatcca 113
            |||||||||||||||||||||
Sbjct: 1827 agtagggatgcaccaaatcca 1847
to top
>gb|AC151309.2| Xenopus tropicalis clone CH216-97A24, complete sequence
          Length = 103750

 Score = 42.1 bits (21), Expect = 0.70
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                            
Query: 92    aagtagggatgcaccaaatccaatattttgggattnggctgnacccc 138
             ||||||| |||||| |||| || ||||||||||||  |||| |||||
Sbjct: 74547 aagtaggtatgcactaaattcactattttgggattcagctgaacccc 74593
to top
>gb|DP000015.1| Xenopus tropicalis target 1 genomic scaffold
          Length = 292204

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 95    tagggatgcaccaaatccaatatt 118
             ||||||||||||||||||| ||||
Sbjct: 77258 tagggatgcaccaaatccattatt 77235
to top
>gb|BC077765.1| Xenopus laevis TFIIS elongation factor, mRNA (cDNA clone MGC:79952
            IMAGE:6863720), complete cds
          Length = 2627

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 1761 tagggatgcaccgaatccactattttgg 1734
to top
>gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669, complete cds
          Length = 2723

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 2526 tagggatgcaccgaatccactattttgg 2499
to top
>gb|BC070612.1| Xenopus laevis hypothetical protein MGC81341, mRNA (cDNA clone
            MGC:81341 IMAGE:6633275), complete cds
          Length = 4789

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 2675 tagggatgcaccgaatccactattttgg 2648
to top
>gb|AC151324.2| Xenopus tropicalis clone ISB-266M19, complete sequence
          Length = 72079

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    gtagggatgcaccaaatcca 113
             ||||||||||||||||||||
Sbjct: 43570 gtagggatgcaccaaatcca 43551
to top
>gb|BC046272.1| Xenopus laevis speckle-type POZ protein, mRNA (cDNA clone MGC:53469
            IMAGE:5572132), complete cds
          Length = 3077

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 2669 tagggatgcaccgaatccactattttgg 2696
to top
>gb|AC146801.2| Xenopus tropicalis clone CH216-59H14, complete sequence
          Length = 97204

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    tagggatgcaccaaatccaa 114
             ||||||||||||||||||||
Sbjct: 67578 tagggatgcaccaaatccaa 67597
to top
>gb|AC148453.2| Xenopus tropicalis clone CH216-147I21, complete sequence
          Length = 158285

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 95    tagggatgcaccaaatccaatatt 118
             ||||||||||||||||||| ||||
Sbjct: 72382 tagggatgcaccaaatccattatt 72359
to top
>gb|BC060749.1| Xenopus laevis hypothetical protein MGC68966, mRNA (cDNA clone
            MGC:68966 IMAGE:4959695), complete cds
          Length = 5688

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 4818 tagggatgcaccgaatccactattttgg 4845
to top
>gb|AC131151.2| Homo sapiens 3 BAC RP11-219E24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 109988

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      ctatctatcttcaaaaagtt 25
              ||||||||||||||||||||
Sbjct: 101179 ctatctatcttcaaaaagtt 101160
to top
>gb|BC054268.1| Xenopus laevis inositol(myo)-1(or 4)-monophosphatase 1, mRNA (cDNA
            clone MGC:64501 IMAGE:6875343), complete cds
          Length = 1571

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 1082 tagggatgcaccgaatccactattttgg 1109
to top
>gb|BC056849.1| Xenopus laevis Chymotrypsinogen 2, mRNA (cDNA clone MGC:64417
            IMAGE:6879524), complete cds
          Length = 1700

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 99   gatgcaccaaatccaatattttgg 122
            ||||||||||||||| ||||||||
Sbjct: 1242 gatgcaccaaatccactattttgg 1219
to top
>emb|X81986.1|XLXSUG1 X.laevis XSUG1 mRNA
          Length = 1665

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 1395 tagggatgcaccgaatccactattttgg 1422
to top
>emb|X12525.1|XLACTA Xenopus laevis sarcomeric alpha 3-actin gene
          Length = 5954

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||||||||||||| ||| ||||||||
Sbjct: 2678 tagggatgcaccaaacccactattttgg 2705
to top
>gb|AC149594.2| Xenopus tropicalis chromosome CH216-62P2, complete sequence
          Length = 167602

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 95    tagggatgcaccaaatccaatattttgggatt 126
             |||||||||||| | |||| ||||||||||||
Sbjct: 50776 tagggatgcaccgattccactattttgggatt 50745
to top
>gb|AC148449.2| Xenopus tropicalis clone CH216-118D6, complete sequence
          Length = 165682

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 94   gtagggatgcaccaaatccaatattttgggat 125
            ||||||||||||||||| ||| ||||| ||||
Sbjct: 4068 gtagggatgcaccaaatgcaacattttaggat 4099
to top
>gb|BC099004.1| Xenopus laevis cDNA clone IMAGE:3746025, partial cds
          Length = 2926

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 92   aagtagggatgcaccaaatccaatattt 119
            ||||||||||||||| |||||| |||||
Sbjct: 1775 aagtagggatgcaccgaatccactattt 1748
to top
>gb|AC160834.3| Xenopus tropicalis clone ISB1-89K8, complete sequence
          Length = 49469

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 95    tagggatgcaccaaatccaatattttgg 122
             ||||||||||||||||||| | ||||||
Sbjct: 39185 tagggatgcaccaaatccacttttttgg 39158
to top
>gb|BC114211.1| Xenopus laevis cDNA clone IMAGE:7394716
          Length = 6445

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||||||||||||||||| | ||||||
Sbjct: 5977 tagggatgcaccaaatccacttttttgg 5950
to top
>gb|AC092673.3| Homo sapiens BAC clone RP11-624A4 from 4, complete sequence
          Length = 166339

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 8      atctatcttcaaaaagttcatgat 31
              ||||||||||| ||||||||||||
Sbjct: 153663 atctatcttcataaagttcatgat 153640
to top
>gb|AC151361.2| Xenopus tropicalis clone ISB-9I1, complete sequence
          Length = 100798

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    gtagggatgcaccaaatcca 113
             ||||||||||||||||||||
Sbjct: 57250 gtagggatgcaccaaatcca 57231
to top
>gb|AC145796.2| Xenopus tropicalis clone CH216-19K4, complete sequence
          Length = 140406

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 95    tagggatgcaccaaatccaatattttgggatt 126
             |||||||||||| |||||| |||||| |||||
Sbjct: 65728 tagggatgcaccgaatccactatttttggatt 65759
to top
>gb|AC149879.2| Xenopus tropicalis clone CH216-40M16, complete sequence
          Length = 177897

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 95     tagggatgcaccaaatccaa 114
              ||||||||||||||||||||
Sbjct: 130448 tagggatgcaccaaatccaa 130467
to top
>gb|BC097896.1| Xenopus laevis cDNA clone IMAGE:6325610
          Length = 956

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 95  tagggatgcaccaaatccaatattttgg 122
           |||||||||||| |||||| ||||||||
Sbjct: 226 tagggatgcaccgaatccactattttgg 253
to top
>gb|BC090056.1| Xenopus laevis cDNA clone MGC:69062 IMAGE:4965751, complete cds
          Length = 4453

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            ||||| ||||||||||||| ||||||||
Sbjct: 2253 taggggtgcaccaaatccactattttgg 2280
to top
>gb|BC094198.1| Xenopus laevis cDNA clone IMAGE:6956323, partial cds
          Length = 2570

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 1924 tagggatgcaccgaatccactattttgg 1897
to top
>gb|BC044965.1| Xenopus laevis, clone IMAGE:4889220, mRNA
          Length = 2384

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 95  tagggatgcaccaaatccaatattttgg 122
           |||||||||||| |||||| ||||||||
Sbjct: 970 tagggatgcaccgaatccagtattttgg 997
to top
>gb|BC093489.1| Xenopus laevis cDNA clone MGC:98819 IMAGE:3400699, complete cds
          Length = 4996

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 2390 tagggatgcaccgaatccactattttgg 2363
to top
>emb|AJ006236.1|NTA6236 Nicotiana tabacum DNA fragment for K81 left T-DNA border
          Length = 6056

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 99   gatgcaccaaatccaatatt 118
            ||||||||||||||||||||
Sbjct: 2350 gatgcaccaaatccaatatt 2369
to top
>gb|AC149515.2| Xenopus tropicalis clone CH216-35C7, complete sequence
          Length = 174535

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 95     tagggatgcaccaaatccaatatt 118
              ||||||||||||||||||| ||||
Sbjct: 110426 tagggatgcaccaaatccattatt 110449
to top
>gb|AC148600.2| Xenopus tropicalis clone CH216-62H10, complete sequence
          Length = 162075

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 95    tagggatgcaccaaatccaa 114
             ||||||||||||||||||||
Sbjct: 72198 tagggatgcaccaaatccaa 72217
to top
>gb|BC086458.1| Xenopus laevis hypothetical LOC495825, mRNA (cDNA clone MGC:98846
            IMAGE:3402222), complete cds
          Length = 2068

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 1961 tagggatgcaccgaatccactattttgg 1934
to top
>gb|BC084070.1| Xenopus laevis hypothetical LOC494987, mRNA (cDNA clone MGC:80536
            IMAGE:5161676), complete cds
          Length = 3727

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 2090 tagggatgcaccgaatccactattttgg 2117
to top
>gb|AC151318.2| Xenopus tropicalis clone ISB-241L4, complete sequence
          Length = 71260

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 94    gtagggatgcaccaaatcca 113
             ||||||||||||||||||||
Sbjct: 57339 gtagggatgcaccaaatcca 57358
to top
>gb|BC110955.1| Xenopus laevis cDNA clone IMAGE:6642407
          Length = 2889

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 92   aagtagggatgcaccaaatccaatattt 119
            ||||||||||||||| |||||| |||||
Sbjct: 1716 aagtagggatgcaccgaatccactattt 1689
to top
>gb|U63711.1|XLU63711 Xenopus laevis xefiltin mRNA, complete cds
          Length = 2125

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 2031 tagggatgcaccgaatccactattttgg 2058
to top
>gb|AC151352.2| Xenopus tropicalis clone ISB-48G11, complete sequence
          Length = 48240

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||  |||||||||||||||
Sbjct: 4169 tagggatgcactgaatccaatattttgg 4196
to top
>gb|AF078162.1| Xenopus laevis Xbr-1a/Xvent-2 protein (Xbr-1a/Xvent-2) gene, complete
            cds
          Length = 4524

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 95   tagggatgcaccaaatccaatattttgg 122
            |||||||||||| |||||| ||||||||
Sbjct: 3825 tagggatgcaccgaatccactattttgg 3852
to top
>emb|AL772217.10| Mouse DNA sequence from clone RP23-160K5 on chromosome 2, complete
              sequence
          Length = 202067

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      atctatctatcttcaaaaag 23
              ||||||||||||||||||||
Sbjct: 109932 atctatctatcttcaaaaag 109951


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,232,340
Number of Sequences: 3902068
Number of extensions: 3232340
Number of successful extensions: 204053
Number of sequences better than 10.0: 114
Number of HSP's better than 10.0 without gapping: 113
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 203547
Number of HSP's gapped (non-prelim): 507
length of query: 218
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 196
effective length of database: 17,147,199,772
effective search space: 3360851155312
effective search space used: 3360851155312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top