ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd1l18 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016336.1| Zea mays clone Contig169 mRNA sequence Length = 576 Score = 280 bits (141), Expect = 5e-72 Identities = 222/249 (89%) Strand = Plus / Plus Query: 217 ttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttcttcttgg 276 ||||||||||||| ||||| ||||| |||||||||||||||||||| ||||||||||||| Sbjct: 236 ttcactcccctggagcggagaccccctgcttcagcttttccctcttcagcttcttcttgg 295 Query: 277 agactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgcatagt 336 |||| |||||||||||||| || |||||||||||||||||||||| || ||||| |||| Sbjct: 296 agaccggcttcttcttcttgggcgggagcgtcttctgcgcgtacacatacagcgcgtagt 355 Query: 337 tcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattccagggt 396 |||| | |||||||||||||||||| | |||||||| ||||| || | |||||| |||| Sbjct: 356 tcccggcgaagaagagcagcaggaagctggcaaccacgagcagaaccaccattcctgggt 415 Query: 397 tcaggcccttgttcacctcttcgatgatgacattgttcgctgactccgcgaactgctccg 456 ||||||||||||||||||| |||||||| || |||||||| || ||||||||||| |||| Sbjct: 416 tcaggcccttgttcacctcctcgatgatcacgttgttcgccgaatccgcgaactgatccg 475 Query: 457 ccatggcgg 465 ||||||||| Sbjct: 476 ccatggcgg 484
>gb|AY105563.1| Zea mays PCO095455 mRNA sequence Length = 645 Score = 280 bits (141), Expect = 5e-72 Identities = 222/249 (89%) Strand = Plus / Minus Query: 217 ttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttcttcttgg 276 ||||||||||||| ||||| || || |||||||||||||||||||| ||||||||||||| Sbjct: 367 ttcactcccctggcgcggagacaccctgcttcagcttttccctcttcagcttcttcttgg 308 Query: 277 agactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgcatagt 336 |||| ||||||||||||||||| |||||||||||||||||||||| || ||||| |||| Sbjct: 307 agaccggcttcttcttcttcggcgggagcgtcttctgcgcgtacacatacagcgcgtagt 248 Query: 337 tcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattccagggt 396 |||| |||||||||||||||||||| | |||||||| ||||| || | |||||| |||| Sbjct: 247 tcccggcaaagaagagcagcaggaagctggcaaccacgagcagaaccaccattcctgggt 188 Query: 397 tcaggcccttgttcacctcttcgatgatgacattgttcgctgactccgcgaactgctccg 456 |||| |||||||||||||| |||||||| || |||||||| || ||||||||||| |||| Sbjct: 187 tcagtcccttgttcacctcctcgatgatcacgttgttcgccgaatccgcgaactgatccg 128 Query: 457 ccatggcgg 465 ||||||||| Sbjct: 127 ccatggcgg 119
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 232 bits (117), Expect = 1e-57 Identities = 189/213 (88%) Strand = Plus / Plus Query: 212 atctcttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttctt 271 |||||||||||| || ||||| |||||||| |||||||||||||||||||| |||||||| Sbjct: 20238511 atctcttcactctccgggtgcagaaaccccctgcttcagcttttccctcttcagcttctt 20238570 Query: 272 cttggagactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgc 331 |||||||||||||||||||||| ||||| ||||||||||| || |||| ||||||||| Sbjct: 20238571 cttggagactggcttcttcttccgaggaggaagcgtcttctgagcatacatgtagagcgc 20238630 Query: 332 atagttcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattcc 391 |||||| ||||||||||| || | ||||| || ||||||||||| ||||| ||| |||| Sbjct: 20238631 atagtttccaacaaagaaaagaatcaggagagttgcaaccacaagaaggactatcgttcc 20238690 Query: 392 agggttcaggcccttgttcacctcttcgatgat 424 |||||||||||||||||| ||||| |||||||| Sbjct: 20238691 agggttcaggcccttgttgacctcctcgatgat 20238723 Score = 194 bits (98), Expect = 2e-46 Identities = 191/222 (86%) Strand = Plus / Plus Query: 213 tctcttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttcttc 272 ||||||||||| ||||| || || || ||||||||||| ||||||||||| | ||||||| Sbjct: 20234168 tctcttcactctcctggggcagagacaccttgcttcagtttttccctcttcatcttcttc 20234227 Query: 273 ttggagactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgca 332 || |||||||||||||| || ||||| ||||||||||| ||||||| ||||| || Sbjct: 20234228 ttcgagactggcttctttttgcgaggaggaagcgtcttctgagcgtacacatagagagcg 20234287 Query: 333 tagttcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattcca 392 |||||||| |||||||| ||||||||||||||||| ||||||| |||||| ||||||||| Sbjct: 20234288 tagttcccgacaaagaaaagcagcaggaaggtcgcgaccacaatcaggactatcattcca 20234347 Query: 393 gggttcaggcccttgttcacctcttcgatgatgacattgttc 434 |||||||| |||||||| ||||| || |||| ||||||||| Sbjct: 20234348 gggttcagtcccttgttgacctcctcaatgactacattgttc 20234389 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Plus Query: 31 cacaacagctcaatttaggctaaggtttatcagttcgctgaaataaggtgtccaata 87 ||||| || ||||||| |||||||||| | | ||| ||||||||||| ||||||||| Sbjct: 20233977 cacaatagatcaatttgggctaaggttcaaccgtttgctgaaataagttgtccaata 20234033
>dbj|AK072291.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023018N16, full insert sequence Length = 1930 Score = 232 bits (117), Expect = 1e-57 Identities = 189/213 (88%) Strand = Plus / Minus Query: 212 atctcttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttctt 271 |||||||||||| || ||||| |||||||| |||||||||||||||||||| |||||||| Sbjct: 1755 atctcttcactctccgggtgcagaaaccccctgcttcagcttttccctcttcagcttctt 1696 Query: 272 cttggagactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgc 331 |||||||||||||||||||||| ||||| ||||||||||| || |||| ||||||||| Sbjct: 1695 cttggagactggcttcttcttccgaggaggaagcgtcttctgagcatacatgtagagcgc 1636 Query: 332 atagttcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattcc 391 |||||| ||||||||||| || | ||||| || ||||||||||| ||||| ||| |||| Sbjct: 1635 atagtttccaacaaagaaaagaatcaggagagttgcaaccacaagaaggactatcgttcc 1576 Query: 392 agggttcaggcccttgttcacctcttcgatgat 424 |||||||||||||||||| ||||| |||||||| Sbjct: 1575 agggttcaggcccttgttgacctcctcgatgat 1543
>dbj|AK121205.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023087P18, full insert sequence Length = 773 Score = 228 bits (115), Expect = 2e-56 Identities = 217/251 (86%) Strand = Plus / Minus Query: 213 tctcttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttcttc 272 ||||||||||| ||||| || || || ||||||||||| ||||||||||| | ||||||| Sbjct: 598 tctcttcactctcctggggcagagacaccttgcttcagtttttccctcttcatcttcttc 539 Query: 273 ttggagactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgca 332 || |||||||||||||| || ||||| ||||||||||| ||||||| ||||| || Sbjct: 538 ttcgagactggcttctttttgcgaggaggaagcgtcttctgagcgtacacatagagagcg 479 Query: 333 tagttcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattcca 392 |||||||| |||||||| ||||||||||||||||| ||||||| |||||| ||||||||| Sbjct: 478 tagttcccgacaaagaaaagcagcaggaaggtcgcgaccacaatcaggactatcattcca 419 Query: 393 gggttcaggcccttgttcacctcttcgatgatgacattgttcgctgactccgcgaactgc 452 |||||||| |||||||| ||||| || |||| ||||||||||| || ||||||||||| Sbjct: 418 gggttcagtcccttgttgacctcctcaatgactacattgttcgcagagtccgcgaactga 359 Query: 453 tccgccatggc 463 ||||||||||| Sbjct: 358 tccgccatggc 348 Score = 40.1 bits (20), Expect = 7.7 Identities = 35/40 (87%) Strand = Plus / Minus Query: 48 ggctaaggtttatcagttcgctgaaataaggtgtccaata 87 |||||||||| | | ||| ||||||||||| ||||||||| Sbjct: 772 ggctaaggttcaaccgtttgctgaaataagttgtccaata 733
>dbj|AK058627.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-C04, full insert sequence Length = 554 Score = 224 bits (113), Expect = 2e-55 Identities = 188/213 (88%) Strand = Plus / Minus Query: 212 atctcttcactcccctggtgcggaaaccccttgcttcagcttttccctcttgagcttctt 271 |||||||||||| || ||||| |||||||| |||||||||||||||||||| |||||||| Sbjct: 385 atctcttcactctccgggtgcagaaaccccctgcttcagcttttccctcttcagcttctt 326 Query: 272 cttggagactggcttcttcttcttcggagggagcgtcttctgcgcgtacaggtagagcgc 331 |||||||||||||||||||| | ||||| ||||||||||| || |||| ||||||||| Sbjct: 325 cttggagactggcttcttctcccgaggaggaagcgtcttctgagcatacatgtagagcgc 266 Query: 332 atagttcccaacaaagaagagcagcaggaaggtcgcaaccacaagcaggacgatcattcc 391 |||||| ||||||||||| || | ||||| || ||||||||||| ||||| ||| |||| Sbjct: 265 atagtttccaacaaagaaaagaatcaggagagttgcaaccacaagaaggactatcgttcc 206 Query: 392 agggttcaggcccttgttcacctcttcgatgat 424 |||||||||||||||||| ||||| |||||||| Sbjct: 205 agggttcaggcccttgttgacctcctcgatgat 173
>ref|NM_115197.2| Arabidopsis thaliana DNA binding AT3G53370 mRNA, complete cds Length = 602 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 |||||||| ||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 315 ccttgctttagcttctcccgcttgagcttctttttggaaacgggcttcttcttc 262
>gb|AY059136.1| Arabidopsis thaliana unknown protein (At3g53370) mRNA, complete cds Length = 262 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 |||||||| ||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 209 ccttgctttagcttctcccgcttgagcttctttttggaaacgggcttcttcttc 156
>gb|AF370176.1| Arabidopsis thaliana unknown protein (At3g53370) mRNA, complete cds Length = 550 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 |||||||| ||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 312 ccttgctttagcttctcccgcttgagcttctttttggaaacgggcttcttcttc 259
>emb|BX826119.1|CNS0A68J Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL85ZE06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 586 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 |||||||| ||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 298 ccttgctttagcttctcccgcttgagcttctttttggaaacgggcttcttcttc 245
>gb|AY088845.1| Arabidopsis thaliana clone 97045 mRNA, complete sequence Length = 594 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 |||||||| ||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 311 ccttgctttagcttctcccgcttgagcttctttttggaaacgggcttcttcttc 258
>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12 Length = 144628 Score = 60.0 bits (30), Expect = 8e-06 Identities = 48/54 (88%) Strand = Plus / Plus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 |||||||| ||||| |||| |||||||||||| ||||| || |||||||||||| Sbjct: 28851 ccttgctttagcttctcccgcttgagcttctttttggaaacgggcttcttcttc 28904
>ref|NM_129268.3| Arabidopsis thaliana DNA binding AT2G37120 mRNA, complete cds Length = 597 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 352 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 302
>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete sequence Length = 80736 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 44684 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 44634
>gb|AF372892.1|AF372892 Arabidopsis thaliana At2g37120/T2N18.12 mRNA, complete cds Length = 462 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 290 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 240
>emb|BX822046.1|CNS0AAA4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL94ZC05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 453 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 281 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 231
>emb|BX821858.1|CNS0A98R Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL7ZE09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 521 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 276 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 226
>emb|BX821993.1|CNS0A91W Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL90ZF06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 848 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 628 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 578
>gb|AY085439.1| Arabidopsis thaliana clone 1517 mRNA, complete sequence Length = 514 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 352 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 302
>gb|BT002669.1| Arabidopsis thaliana At2g37120/T2N18.12 gene, complete cds Length = 231 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 243 tgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttc 293 ||||||||||| || | |||||||||||| ||||| | |||||||||||| Sbjct: 206 tgcttcagcttctcacgcttgagcttctttttggaaagaggcttcttcttc 156
>gb|AC006282.4| Arabidopsis thaliana chromosome 2 clone F13K3 map g6825, complete sequence Length = 92376 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 270 ttcttggagactggcttcttcttctt 295 ||||||||||||| |||||||||||| Sbjct: 30947 ttcttggagactgacttcttcttctt 30922
>gb|AC005895.1|AC005895 Homo sapiens chromosome 5, Bac clone 5m9 (LBNL H220), complete sequence Length = 87857 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 141 ccagctggtatgtcttttttat 162 |||||||||||||||||||||| Sbjct: 60124 ccagctggtatgtcttttttat 60145
>gb|BT015309.1| Drosophila melanogaster AT07233 full insert cDNA Length = 4569 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 3740 caacaaagaagagcagcagga 3760
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 346 agaagagcagcaggaaggtcg 366 ||||||||||||||||||||| Sbjct: 3227064 agaagagcagcaggaaggtcg 3227084
>gb|AC125348.3| Mus musculus BAC clone RP23-377H20 from chromosome 7, complete sequence Length = 188610 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 513 agagagattggatggattagg 533 ||||||||||||||||||||| Sbjct: 181939 agagagattggatggattagg 181959
>gb|AC113603.6| Homo sapiens chromosome 8, clone RP11-101N9, complete sequence Length = 161374 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 252 ttttccctcttgagcttcttc 272 ||||||||||||||||||||| Sbjct: 89533 ttttccctcttgagcttcttc 89553
>ref|NM_165556.1| Drosophila melanogaster CG30497-RC, transcript variant C (CG30497), mRNA Length = 4342 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 2180 caacaaagaagagcagcagga 2200
>ref|NM_165555.1| Drosophila melanogaster CG30497-RB, transcript variant B (CG30497), mRNA Length = 4853 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 2691 caacaaagaagagcagcagga 2711
>ref|NM_136477.2| Drosophila melanogaster CG30497-RA, transcript variant A (CG30497), mRNA Length = 6470 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 4308 caacaaagaagagcagcagga 4328
>gb|AY089511.1| Drosophila melanogaster GH21034 full insert cDNA Length = 4853 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 2691 caacaaagaagagcagcagga 2711
>gb|AC068102.5| Homo sapiens chromosome 8, clone RP11-333M8, complete sequence Length = 174742 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 252 ttttccctcttgagcttcttc 272 ||||||||||||||||||||| Sbjct: 89606 ttttccctcttgagcttcttc 89626
>gb|AC007301.8|AC007301 Drosophila melanogaster, chromosome 2R, region 43E12-44F1, BAC clone BACR04B09, complete sequence Length = 174707 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 131780 caacaaagaagagcagcagga 131800
>gb|AE003840.3| Drosophila melanogaster chromosome 2R, section 10 of 73 of the complete sequence Length = 272100 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 223503 caacaaagaagagcagcagga 223483
>gb|AC004283.1|AC004283 Drosophila melanogaster DNA sequence (P1 DS05557 (D152)), complete sequence Length = 80095 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 340 caacaaagaagagcagcagga 360 ||||||||||||||||||||| Sbjct: 19245 caacaaagaagagcagcagga 19265
>gb|AC134330.3| Mus musculus BAC clone RP24-311K19 from 7, complete sequence Length = 142053 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 513 agagagattggatggattagg 533 ||||||||||||||||||||| Sbjct: 15236 agagagattggatggattagg 15256
>dbj|AP004389.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1995B9 Length = 161124 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 252 ttttccctcttgagcttcttc 272 ||||||||||||||||||||| Sbjct: 152263 ttttccctcttgagcttcttc 152243
>gb|AC159412.1| Trypanosoma brucei chromosome 7 clone RPCI93-21H15, complete sequence Length = 159636 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 ttttccctcttgagcttcttcttg 275 |||||||||||| ||||||||||| Sbjct: 61791 ttttccctcttgtgcttcttcttg 61768
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence Length = 2205233 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 252 ttttccctcttgagcttcttcttg 275 |||||||||||| ||||||||||| Sbjct: 2044807 ttttccctcttgtgcttcttcttg 2044830
>gb|AC159702.1| Trypanosoma brucei chromosome 7 clone RPCI93-30D13, complete sequence Length = 171752 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 ttttccctcttgagcttcttcttg 275 |||||||||||| ||||||||||| Sbjct: 160397 ttttccctcttgtgcttcttcttg 160374
>ref|XM_539672.2| PREDICTED: Canis familiaris similar to Telomerase protein component 1 (Telomerase-associated protein 1) (Telomerase protein 1) (p240) (p80 telomerase homolog) (LOC482555), mRNA Length = 7812 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 244 gcttcagcttttccctcttgagct 267 ||||||||||||||| |||||||| Sbjct: 1849 gcttcagcttttcccacttgagct 1826
>ref|XM_806115.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506797.30) partial mRNA Length = 1860 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 284 cttcttcttcttcggagggagcgtcttc 311 |||||||||||||||| |||||| |||| Sbjct: 835 cttcttcttcttcggacggagcggcttc 808
>gb|AC121806.3| Mus musculus BAC clone RP23-448L10 from chromosome 7, complete sequence Length = 182011 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 241 cttgcttcagcttttccctc 260 |||||||||||||||||||| Sbjct: 42519 cttgcttcagcttttccctc 42538
>ref|XM_802912.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508319.79) partial mRNA Length = 494 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 341 aacaaagaagagcagcagga 360 |||||||||||||||||||| Sbjct: 167 aacaaagaagagcagcagga 186
>emb|AL512600.5| Human DNA sequence from clone RP11-452A14 on chromosome 6, complete sequence Length = 141172 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 399 aggcccttgttcacctcttc 418 |||||||||||||||||||| Sbjct: 42665 aggcccttgttcacctcttc 42646
>emb|Y11901.1|LLABIKORF L.lactis abiN gene, gene encoding dUTPase and 8 ORF's Length = 7275 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcttgagcttcttcttggag 278 |||||||||||||||||||| Sbjct: 4938 tcttgagcttcttcttggag 4919
>gb|AF398517.1| Danio rerio homeobox protein Hox11 (hox11) mRNA, complete cds, alternatively spliced Length = 2223 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 ggcttcttcttcttcggagg 301 |||||||||||||||||||| Sbjct: 648 ggcttcttcttcttcggagg 629
>emb|BX950184.7| Zebrafish DNA sequence from clone CH211-103O12 in linkage group 12, complete sequence Length = 150475 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 ggcttcttcttcttcggagg 301 |||||||||||||||||||| Sbjct: 115720 ggcttcttcttcttcggagg 115701
>gb|AC107983.3| Homo sapiens chromosome 17, clone CTD-2303H24, complete sequence Length = 130561 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 259 tcttgagcttcttcttggagactg 282 ||||||||||||||||||| |||| Sbjct: 34310 tcttgagcttcttcttggacactg 34287
>ref|NM_170765.1| Danio rerio T-cell leukemia, homeobox 1 (tlx1), mRNA Length = 2223 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 ggcttcttcttcttcggagg 301 |||||||||||||||||||| Sbjct: 648 ggcttcttcttcttcggagg 629
>gb|AF304433.1|AF304433 Bacteriophage TP901-1, complete sequence Length = 37667 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcttgagcttcttcttggag 278 |||||||||||||||||||| Sbjct: 13755 tcttgagcttcttcttggag 13736
>tpg|BK001591.1| TPA: TPA_exp: Homo sapiens chromosome 17 proximal SMS-REP low-copy repeat, genomic sequence Length = 255901 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 259 tcttgagcttcttcttggagactg 282 ||||||||||||||||||| |||| Sbjct: 128714 tcttgagcttcttcttggacactg 128737
>tpg|BK001590.1| TPA: TPA_exp: Homo sapiens chromosome 17 middle SMS-REP low-copy repeat, genomic sequence Length = 240806 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 259 tcttgagcttcttcttggagactg 282 ||||||||||||||||||| |||| Sbjct: 111706 tcttgagcttcttcttggacactg 111683
>emb|BX294659.9| Zebrafish DNA sequence from clone DKEYP-15D12 in linkage group 12, complete sequence Length = 171920 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 194 gacatgagaaatcaatggatctct 217 ||||||||||||||||| |||||| Sbjct: 101922 gacatgagaaatcaatgaatctct 101945
>gb|AC007317.3| Homo sapiens BAC clone RP11-414K7 from 2, complete sequence Length = 200709 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 258 ctcttgagcttcttcttgga 277 |||||||||||||||||||| Sbjct: 53276 ctcttgagcttcttcttgga 53257
>gb|AC015818.32| Homo sapiens chromosome 17, clone RP11-434D2, complete sequence Length = 194767 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 259 tcttgagcttcttcttggagactg 282 ||||||||||||||||||| |||| Sbjct: 63570 tcttgagcttcttcttggacactg 63593
>emb|X79543.1|SOSIFA S.oleracea s1fa mRNA Length = 696 Score = 40.1 bits (20), Expect = 7.7 Identities = 47/56 (83%) Strand = Plus / Minus Query: 240 ccttgcttcagcttttccctcttgagcttcttcttggagactggcttcttcttctt 295 |||||||| ||| | |||||||| | ||||||||| || | |||||||||||||| Sbjct: 280 ccttgcttgagcctctccctcttcatcttcttctttgaaataggcttcttcttctt 225
>emb|AL929231.3| Zebrafish DNA sequence from clone BUSM1-46P4, complete sequence Length = 85305 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 282 ggcttcttcttcttcggagg 301 |||||||||||||||||||| Sbjct: 52281 ggcttcttcttcttcggagg 52300
>emb|AL928816.2| Zebrafish DNA sequence from clone BUSM1-265N4, complete sequence Length = 98918 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 282 ggcttcttcttcttcggagg 301 |||||||||||||||||||| Sbjct: 15069 ggcttcttcttcttcggagg 15088
>gb|DQ093874.1| Lactococcus phage TP901-1C ORF25, ORF26, Alt (alt), TerS (terS), and TerL (terL) genes, complete cds Length = 3764 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 259 tcttgagcttcttcttggag 278 |||||||||||||||||||| Sbjct: 2154 tcttgagcttcttcttggag 2135
>emb|AL353997.3|HS37N07 Homo sapiens chromosome 17 from PAC RPCI-1 37N07 map 17p11.2 region D17S842-D17S953, complete sequence Length = 175103 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 259 tcttgagcttcttcttggagactg 282 ||||||||||||||||||| |||| Sbjct: 165578 tcttgagcttcttcttggacactg 165555
>dbj|AP006405.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT08E06, TM0296a, complete sequence Length = 66228 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 422 gatgacattgttcgctgactccgc 445 |||||| ||||||||||||||||| Sbjct: 32671 gatgactttgttcgctgactccgc 32694
>gb|AC012435.13| Homo sapiens chromosome 15, clone RP11-10O17, complete sequence Length = 132994 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 276 gagactggcttcttcttctt 295 |||||||||||||||||||| Sbjct: 67711 gagactggcttcttcttctt 67692 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,389,413 Number of Sequences: 3902068 Number of extensions: 5389413 Number of successful extensions: 97032 Number of sequences better than 10.0: 62 Number of HSP's better than 10.0 without gapping: 62 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 96853 Number of HSP's gapped (non-prelim): 177 length of query: 569 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 546 effective length of database: 17,143,297,704 effective search space: 9360240546384 effective search space used: 9360240546384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
