ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd1l05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK121844.1| Oryza sativa (japonica cultivar-group) cDNA clon... 133 8e-28
2gb|AC111016.2| Oryza sativa (japonica cultivar-group) chromosome... 84 7e-13
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
4gb|AC145574.5| Mus musculus BAC clone RP24-411C16 from chromosom... 46 0.15
5gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig co... 46 0.15
6gb|AC174081.1| Mus musculus BAC clone RP24-376P15 from chromosom... 46 0.15
7gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 44 0.61
8gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 44 0.61
9gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 44 0.61
10gb|AC159139.9| Mus musculus 10 BAC RP24-370M23 (Roswell Park Can... 44 0.61
11gb|CP000001.1| Bacillus cereus E33L, complete genome 44 0.61
12gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 44 0.61
13gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 44 0.61
14gb|AE010368.1| Methanopyrus kandleri AV19 section 67 of 157 of t... 42 2.4
15emb|AL157831.29| Human DNA sequence from clone RP11-108B14 on ch... 42 2.4
16emb|AL122058.19|HSJ813D12 Human DNA sequence from clone RP4-813D... 42 2.4
17emb|CR378665.1| Photobacterium profundum SS9; segment 3/12 42 2.4
18emb|BX294128.19| Zebrafish DNA sequence from clone DKEYP-35F12 i... 42 2.4
19gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cance... 42 2.4
20gb|AC103691.2| Homo sapiens chromosome 15, clone RP11-959H21, co... 42 2.4
21gb|AC013553.14| Homo sapiens chromosome 15, clone RP11-325L12, c... 42 2.4
22dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 42 2.4
23gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cance... 42 2.4
24emb|BX005263.10| Mouse DNA sequence from clone RP23-395K13 on ch... 42 2.4
25emb|BX119978.6| Mouse DNA sequence from clone RP23-354H3 on chro... 42 2.4
26emb|CR388132.9| Zebrafish DNA sequence from clone DKEY-23A23 in ... 42 2.4
27gb|BC105767.1| Rattus norvegicus xylosyltransferase II, mRNA (cD... 40 9.5
28ref|NM_022296.2| Rattus norvegicus xylosyltransferase II (Xylt2)... 40 9.5
29gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500,... 40 9.5
30gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, com... 40 9.5
31gb|AC105323.28| Mus musculus chromosome 3, clone RP23-424L10, co... 40 9.5
32gb|AE013198.1| Thermoanaerobacter tengcongensis MB4, section 225... 40 9.5
33ref|XM_420162.1| PREDICTED: Gallus gallus similar to Oligophreni... 40 9.5
34gb|AC146197.3| Pan troglodytes BAC clone CH251-450H3 from Y, com... 40 9.5
35gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl... 40 9.5
36gb|AC111128.24| Mus musculus chromosome 18, clone RP23-338I7, co... 40 9.5
37gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome... 40 9.5
38gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 40 9.5
39gb|AC132106.4| Mus musculus BAC clone RP24-240D2 from chromosome... 40 9.5
40emb|CT009577.5| Mouse DNA sequence from clone RP23-24C24 on chro... 40 9.5
41gb|AC125176.4| Mus musculus BAC clone RP24-574O24 from chromosom... 40 9.5
42gb|AC112256.4| Mus musculus BAC clone RP23-40C8 from 10, complet... 40 9.5
43gb|AC121576.2| Mus musculus BAC clone RP23-244D21 from 18, compl... 40 9.5
44gb|AC146173.2| Pan troglodytes BAC clone RP43-36F20 from 7, comp... 40 9.5
45gb|AC092098.3| Homo sapiens BAC clone RP11-533K11 from 7, comple... 40 9.5
46gb|AC146290.1| Pan troglodytes BAC clone CH251-549P23 from Y, co... 40 9.5
47emb|AL591604.6| Human DNA sequence from clone RP11-356F4 on chro... 40 9.5
48emb|AL139133.8| Human DNA sequence from clone RP11-185C19 on chr... 40 9.5
49emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 9.5
50gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Canc... 40 9.5
51gb|AC165442.1| Mus musculus BAC clone RP23-164P21 from chromosom... 40 9.5
52gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, com... 40 9.5
53dbj|BS000590.1| Pan troglodytes chromosome Y clone:PTB-194A24, c... 40 9.5
54gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 9.5
55dbj|AK126211.1| Homo sapiens cDNA FLJ44223 fis, clone THYMU30061... 40 9.5
56gb|AC010377.7| Homo sapiens chromosome 5 clone CTD-2060J20, comp... 40 9.5
57gb|AC158662.7| Mus musculus 6 BAC RP23-20K24 (Roswell Park Cance... 40 9.5
58gb|AC149092.6| Pan troglodytes BAC clone CH251-553I6 from chromo... 40 9.5
59gb|AC008966.9| Homo sapiens chromosome 5 clone CTD-2366F13, comp... 40 9.5
60gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53... 40 9.5
61gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53... 40 9.5
62gb|AC161019.3| Pan troglodytes BAC clone CH251-7O2 from chromoso... 40 9.5
63gb|AC155643.8| Mus musculus 10 BAC RP24-132F13 (Roswell Park Can... 40 9.5
64gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, comple... 40 9.5
65emb|CR387771.1| Gallus gallus finished cDNA, clone ChEST535m13 40 9.5
66gb|AC154736.2| Mus musculus BAC clone RP24-389J14 from chromosom... 40 9.5
67gb|AC022209.4|AC022209 Homo sapiens BAC clone RP11-588M21 from 1... 40 9.5
68gb|AC158623.5| Mus musculus 10 BAC RP23-302A11 (Roswell Park Can... 40 9.5
69emb|BX005167.12| Mouse DNA sequence from clone RP23-247K19 on ch... 40 9.5
70gb|AC126415.9| Mus musculus chromosome 5, clone RP24-476K21, com... 40 9.5
71gb|AC010726.4|AC010726 Homo sapiens BAC clone RP11-224C16 from Y... 40 9.5
72gb|AC015799.23| Homo sapiens chromosome 17, clone RP11-135N5, co... 40 9.5
73emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in ... 40 9.5
74emb|AJ969201.2| Helicobacter pullorum partial gyrB gene for gyra... 40 9.5
75emb|CR847514.13| Zebrafish DNA sequence from clone DKEYP-11D6 in... 40 9.5
76emb|AJ295749.2|RNO295749 Rattus norvegicus mRNA for xylosyltrans... 40 9.5
77gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45... 40 9.5
78gb|AC148935.6| Pan troglodytes BAC clone CH251-485J2 from chromo... 40 9.5
79emb|AL837516.14| Mouse DNA sequence from clone RP23-234L8 on chr... 40 9.5
80gb|AC132603.4| Mus musculus BAC clone RP24-66C10 from 1, complet... 40 9.5
81gb|AC140402.2| Mus musculus BAC clone RP24-90D2 from 10, complet... 40 9.5
82gb|AC004641.1|AC004641 Drosophila melanogaster DNA sequence (P1s... 40 9.5
83gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, comple... 40 9.5
84gb|AC118547.41| Mus musculus strain C57BL/6J clone rp23-3g4 map ... 40 9.5 
>dbj|AK121844.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033101G01, full
           insert sequence
          Length = 924

 Score =  133 bits (67), Expect = 8e-28
 Identities = 150/177 (84%), Gaps = 3/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 497 ccgtaatgcacagacgaaccaaaataaggcgactctgaggactcgtttgggtaaaattgt 556
           |||||||||||||| || |||||||| |||||||| || ||||||||||| ||  |||||
Sbjct: 521 ccgtaatgcacagaagagccaaaatatggcgactccgatgactcgtttggatatgattgt 462

                                                                       
Query: 557 tttccatctttgtaagcaacacgacctttagcagggcttccttgggatttgccatctgca 616
           || ||||| ||||| ||| ||||| |||||| ||||||    || |||||||||||||||
Sbjct: 461 ttaccatccttgtatgcaccacgagctttagtagggct---gtgcgatttgccatctgca 405

                                                                    
Query: 617 gtgcccccaccgctctgccctttggggttctgcttgttcagcatcgtgtacaggtcc 673
             ||| || ||  |||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 404 aagccaccgccattctgccctttggagttctgcttgttcagcatcgcgtacaggtcc 348



 Score =  113 bits (57), Expect = 8e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 340 acaataggagagtccactgcaaagtatttagtagtacagtgaaccttgccaccaatcacc 399
           |||| ||||||| || |||||||||| |||||| || |||||||||||||||||||||||
Sbjct: 684 acaaaaggagagccctctgcaaagtacttagtaatagagtgaaccttgccaccaatcacc 625

                                
Query: 400 tctggtagccagggagccatc 420
           |||||||||||||||||||||
Sbjct: 624 tctggtagccagggagccatc 604
to top
>gb|AC111016.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_D06,
            complete sequence
          Length = 145323

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 101/120 (84%), Gaps = 3/120 (2%)
 Strand = Plus / Plus

                                                                        
Query: 497  ccgtaatgcacagacgaaccaaaataaggcgactctgaggactcgtttgggtaaaattgt 556
            |||||||||||||| || |||||||| |||||||| || ||||||||||| ||  |||||
Sbjct: 3364 ccgtaatgcacagaagagccaaaatatggcgactccgatgactcgtttggatatgattgt 3423

                                                                        
Query: 557  tttccatctttgtaagcaacacgacctttagcagggcttccttgggatttgccatctgca 616
            || ||||| ||||| ||| ||||| |||||| ||||||    || |||||||||||||||
Sbjct: 3424 ttaccatccttgtatgcaccacgagctttagtagggctg---tgcgatttgccatctgca 3480



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                   
Query: 382  accttgccaccaatcacctctggtagccagggagccatc 420
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 3156 accttgccaccaatcacctctggtagccagggagccatc 3194



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                        
Query: 630  tctgccctttggggttctgcttgttcagcatcgtgtacaggtcc 673
            |||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 3826 tctgccctttggagttctgcttgttcagcatcgcgtacaggtcc 3869
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 101/120 (84%), Gaps = 3/120 (2%)
 Strand = Plus / Plus

                                                                            
Query: 497      ccgtaatgcacagacgaaccaaaataaggcgactctgaggactcgtttgggtaaaattgt 556
                |||||||||||||| || |||||||| |||||||| || ||||||||||| ||  |||||
Sbjct: 22160099 ccgtaatgcacagaagagccaaaatatggcgactccgatgactcgtttggatatgattgt 22160158

                                                                            
Query: 557      tttccatctttgtaagcaacacgacctttagcagggcttccttgggatttgccatctgca 616
                || ||||| ||||| ||| ||||| |||||| ||||||    || |||||||||||||||
Sbjct: 22160159 ttaccatccttgtatgcaccacgagctttagtagggctg---tgcgatttgccatctgca 22160215



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                       
Query: 382      accttgccaccaatcacctctggtagccagggagccatc 420
                |||||||||||||||||||||||||||||||||||||||
Sbjct: 22159891 accttgccaccaatcacctctggtagccagggagccatc 22159929



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Plus

                                                            
Query: 630      tctgccctttggggttctgcttgttcagcatcgtgtacaggtcc 673
                |||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 22160561 tctgccctttggagttctgcttgttcagcatcgcgtacaggtcc 22160604
to top
>gb|AC145574.5| Mus musculus BAC clone RP24-411C16 from chromosome 6, complete sequence
          Length = 147836

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 159   gggcaaacaaaagggaaatacatatatatgt 189
             ||||||||| |||||||||||| ||||||||
Sbjct: 49175 gggcaaacagaagggaaatacagatatatgt 49205
to top
>gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig containing Eve, the hox
             cluster, cholinesterase, and COLP5alpha genes, complete
             sequence
          Length = 796348

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 262   cttcttctttttatgcctgatga 284
             |||||||||||||||||||||||
Sbjct: 81631 cttcttctttttatgcctgatga 81609
to top
>gb|AC174081.1| Mus musculus BAC clone RP24-376P15 from chromosome 6, complete sequence
          Length = 153392

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 159    gggcaaacaaaagggaaatacatatatatgt 189
              ||||||||| |||||||||||| ||||||||
Sbjct: 130419 gggcaaacagaagggaaatacagatatatgt 130449
to top
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 163     aaacaaaagggaaatacatata 184
               ||||||||||||||||||||||
Sbjct: 1624461 aaacaaaagggaaatacatata 1624440
to top
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 163     aaacaaaagggaaatacatata 184
               ||||||||||||||||||||||
Sbjct: 1595401 aaacaaaagggaaatacatata 1595380
to top
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 163     aaacaaaagggaaatacatata 184
               ||||||||||||||||||||||
Sbjct: 1595353 aaacaaaagggaaatacatata 1595332
to top
>gb|AC159139.9| Mus musculus 10 BAC RP24-370M23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 185202

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 176    atacatatatatgtctacatct 197
              ||||||||||||||||||||||
Sbjct: 150063 atacatatatatgtctacatct 150042
to top
>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 163     aaacaaaagggaaatacatata 184
               ||||||||||||||||||||||
Sbjct: 1621516 aaacaaaagggaaatacatata 1621495
to top
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 163     aaacaaaagggaaatacatata 184
               ||||||||||||||||||||||
Sbjct: 1595278 aaacaaaagggaaatacatata 1595257
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 163     aaacaaaagggaaatacatata 184
               ||||||||||||||||||||||
Sbjct: 1720668 aaacaaaagggaaatacatata 1720647
to top
>gb|AE010368.1| Methanopyrus kandleri AV19 section 67 of 157 of the complete genome
          Length = 12015

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 303  cctaccagctcgacctgctcc 323
            |||||||||||||||||||||
Sbjct: 7778 cctaccagctcgacctgctcc 7758
to top
>emb|AL157831.29| Human DNA sequence from clone RP11-108B14 on chromosome 10 Contains a
             ribosomal protein L29 (RPL29)(HIP,HUMRPL29) pseudogene, a
             CGI-45 protein (CGI-45) pseudogene, a novel pseudogene, a
             pseudogene similar to part of PSME2
             (PA28B,REGbeta,PA28beta) (proteasome (prosome, macropain)
             activator subunit 2 (PA28 beta)) and a CpG island,
             complete sequence
          Length = 176577

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 26    aaggatacataaagcatgcag 46
             |||||||||||||||||||||
Sbjct: 33741 aaggatacataaagcatgcag 33761
to top
>emb|AL122058.19|HSJ813D12 Human DNA sequence from clone RP4-813D12 on chromosome 20 Contains the
             5' end of the BMP7 gene for bone morphogenetic protein 7
             (osteogenic protein 1), two novel genes and a CpG island,
             complete sequence
          Length = 101473

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 612   ctgcagtgcccccaccgctctgccc 636
             |||||| ||||||||||||||||||
Sbjct: 59652 ctgcagagcccccaccgctctgccc 59628
to top
>emb|CR378665.1| Photobacterium profundum SS9; segment 3/12
          Length = 347213

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 564    ctttgtaagcaacacgacctt 584
              |||||||||||||||||||||
Sbjct: 168270 ctttgtaagcaacacgacctt 168250
to top
>emb|BX294128.19| Zebrafish DNA sequence from clone DKEYP-35F12 in linkage group 10,
             complete sequence
          Length = 160042

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 539   tcgtttgggtaaaattgtttt 559
             |||||||||||||||||||||
Sbjct: 19864 tcgtttgggtaaaattgtttt 19884
to top
>gb|AC153928.5| Mus musculus 6 BAC RP23-66O20 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 241211

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 547   gtaaaattgttttccatcttt 567
             |||||||||||||||||||||
Sbjct: 61408 gtaaaattgttttccatcttt 61428
to top
>gb|AC103691.2| Homo sapiens chromosome 15, clone RP11-959H21, complete sequence
          Length = 82781

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   aaaagggaaatacatatatat 187
             |||||||||||||||||||||
Sbjct: 74475 aaaagggaaatacatatatat 74495
to top
>gb|AC013553.14| Homo sapiens chromosome 15, clone RP11-325L12, complete sequence
          Length = 184864

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   aaaagggaaatacatatatat 187
             |||||||||||||||||||||
Sbjct: 12999 aaaagggaaatacatatatat 13019
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 251     ccccactatgacttcttcttt 271
               |||||||||||||||||||||
Sbjct: 3720250 ccccactatgacttcttcttt 3720270
to top
>gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 197401

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 547   gtaaaattgttttccatcttt 567
             |||||||||||||||||||||
Sbjct: 34759 gtaaaattgttttccatcttt 34739
to top
>emb|BX005263.10| Mouse DNA sequence from clone RP23-395K13 on chromosome X, complete
           sequence
          Length = 175998

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 543 ttgggtaaaattgttttccat 563
           |||||||||||||||||||||
Sbjct: 337 ttgggtaaaattgttttccat 357
to top
>emb|BX119978.6| Mouse DNA sequence from clone RP23-354H3 on chromosome X, complete
             sequence
          Length = 72115

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 543   ttgggtaaaattgttttccat 563
             |||||||||||||||||||||
Sbjct: 70452 ttgggtaaaattgttttccat 70472
to top
>emb|CR388132.9| Zebrafish DNA sequence from clone DKEY-23A23 in linkage group 4,
             complete sequence
          Length = 206525

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 539   tcgtttgggtaaaattgttttccat 563
             |||||||||||||||| ||||||||
Sbjct: 63918 tcgtttgggtaaaattattttccat 63894
to top
>gb|BC105767.1| Rattus norvegicus xylosyltransferase II, mRNA (cDNA clone MGC:124608
            IMAGE:7930580), complete cds
          Length = 3375

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 398  cctctggtagccagggagcc 417
            ||||||||||||||||||||
Sbjct: 3127 cctctggtagccagggagcc 3146
to top
>ref|NM_022296.2| Rattus norvegicus xylosyltransferase II (Xylt2), mRNA
          Length = 3375

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 398  cctctggtagccagggagcc 417
            ||||||||||||||||||||
Sbjct: 3127 cctctggtagccagggagcc 3146
to top
>gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500, complete sequence
          Length = 132678

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 655    cagcatcgtgtacaggtcca 674
              ||||||||||||||||||||
Sbjct: 101936 cagcatcgtgtacaggtcca 101955
to top
>gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, complete sequence
          Length = 172336

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 361    aagtatttagtagtacagtgaacc 384
              |||||||||| |||||||||||||
Sbjct: 154461 aagtatttagaagtacagtgaacc 154484
to top
>gb|AC105323.28| Mus musculus chromosome 3, clone RP23-424L10, complete sequence
          Length = 183897

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   aaagggaaatacatatatat 187
             ||||||||||||||||||||
Sbjct: 71983 aaagggaaatacatatatat 72002
to top
>gb|AE013198.1| Thermoanaerobacter tengcongensis MB4, section 225 of 244 of the
            complete genome
          Length = 10429

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 319  gctcctttttattccttgtt 338
            ||||||||||||||||||||
Sbjct: 4811 gctcctttttattccttgtt 4830
to top
>ref|XM_420162.1| PREDICTED: Gallus gallus similar to Oligophrenin 1 (LOC422163), mRNA
          Length = 1928

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 104  tttgctgctgccctgccagtccca 127
            ||||||||||||||||||| ||||
Sbjct: 1412 tttgctgctgccctgccagcccca 1389
to top
>gb|AC146197.3| Pan troglodytes BAC clone CH251-450H3 from Y, complete sequence
          Length = 182113

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 177    tacatatatatgtctacatc 196
              ||||||||||||||||||||
Sbjct: 166273 tacatatatatgtctacatc 166292
to top
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 667     caggtccatctgcctggcgt 686
               ||||||||||||||||||||
Sbjct: 3226540 caggtccatctgcctggcgt 3226559
to top
>gb|AC111128.24| Mus musculus chromosome 18, clone RP23-338I7, complete sequence
          Length = 209784

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 165   acaaaagggaaatacatatatatg 188
             |||||||||||||| |||||||||
Sbjct: 28576 acaaaagggaaatatatatatatg 28599
to top
>gb|AC142167.4| Mus musculus BAC clone RP24-117F4 from chromosome 3, complete sequence
          Length = 190937

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 535    ggactcgtttgggtaaaatt 554
              ||||||||||||||||||||
Sbjct: 130777 ggactcgtttgggtaaaatt 130796
to top
>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 556     ttttccatctttgtaagcaa 575
               ||||||||||||||||||||
Sbjct: 6341316 ttttccatctttgtaagcaa 6341335
to top
>gb|AC132106.4| Mus musculus BAC clone RP24-240D2 from chromosome 17, complete sequence
          Length = 169722

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 176   atacatatatatgtctacat 195
             ||||||||||||||||||||
Sbjct: 58248 atacatatatatgtctacat 58267
to top
>emb|CT009577.5| Mouse DNA sequence from clone RP23-24C24 on chromosome 16, complete
              sequence
          Length = 258862

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    agtcccattacacttcagca 140
              ||||||||||||||||||||
Sbjct: 205688 agtcccattacacttcagca 205669
to top
>gb|AC125176.4| Mus musculus BAC clone RP24-574O24 from chromosome 3, complete sequence
          Length = 162693

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 535    ggactcgtttgggtaaaatt 554
              ||||||||||||||||||||
Sbjct: 108432 ggactcgtttgggtaaaatt 108451
to top
>gb|AC112256.4| Mus musculus BAC clone RP23-40C8 from 10, complete sequence
          Length = 157928

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    atacatatatatgtctacat 195
              ||||||||||||||||||||
Sbjct: 126583 atacatatatatgtctacat 126564
to top
>gb|AC121576.2| Mus musculus BAC clone RP23-244D21 from 18, complete sequence
          Length = 158243

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 165   acaaaagggaaatacatatatatg 188
             |||||||||||||| |||||||||
Sbjct: 21887 acaaaagggaaatatatatatatg 21864
to top
>gb|AC146173.2| Pan troglodytes BAC clone RP43-36F20 from 7, complete sequence
          Length = 197121

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 166   caaaagggaaatacatatatatgt 189
             |||||||||| |||||||||||||
Sbjct: 40075 caaaagggaattacatatatatgt 40098
to top
>gb|AC092098.3| Homo sapiens BAC clone RP11-533K11 from 7, complete sequence
          Length = 198786

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 166    caaaagggaaatacatatatatgt 189
              |||||||||| |||||||||||||
Sbjct: 104749 caaaagggaattacatatatatgt 104772
to top
>gb|AC146290.1| Pan troglodytes BAC clone CH251-549P23 from Y, complete sequence
          Length = 176345

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   tacatatatatgtctacatc 196
             ||||||||||||||||||||
Sbjct: 95967 tacatatatatgtctacatc 95986
to top
>emb|AL591604.6| Human DNA sequence from clone RP11-356F4 on chromosome 1 Contains the 5'
              end of the SLICK gene for a sodium- and chloride-activated
              ATP-sensitive potassium channel, complete sequence
          Length = 185560

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 173    gaaatacatatatatgtcta 192
              ||||||||||||||||||||
Sbjct: 154498 gaaatacatatatatgtcta 154517
to top
>emb|AL139133.8| Human DNA sequence from clone RP11-185C19 on chromosome 1q31.1-31.3
            Contains the 3' end of the HRPT2 gene for
            hyperparathyroidism 2 (with jaw tumor), complete sequence
          Length = 19720

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 354  cactgcaaagtatttagtag 373
            ||||||||||||||||||||
Sbjct: 6289 cactgcaaagtatttagtag 6270
to top
>emb|CR382123.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome C of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1753957

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 142    tcaaatcaggtaacatagggcaaa 165
              ||||||||||||||||||| ||||
Sbjct: 205968 tcaaatcaggtaacataggccaaa 205991
to top
>gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 214578

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 381    aaccttgccaccaatcacct 400
              ||||||||||||||||||||
Sbjct: 169230 aaccttgccaccaatcacct 169249
to top
>gb|AC165442.1| Mus musculus BAC clone RP23-164P21 from chromosome 10, complete
             sequence
          Length = 209583

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   atacatatatatgtctacat 195
             ||||||||||||||||||||
Sbjct: 42345 atacatatatatgtctacat 42326
to top
>gb|AC119840.12| Mus musculus chromosome 3, clone RP24-112E5, complete sequence
          Length = 206159

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    aaagggaaatacatatatat 187
              ||||||||||||||||||||
Sbjct: 205625 aaagggaaatacatatatat 205644
to top
>dbj|BS000590.1| Pan troglodytes chromosome Y clone:PTB-194A24, complete sequence
          Length = 219969

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 177    tacatatatatgtctacatc 196
              ||||||||||||||||||||
Sbjct: 115385 tacatatatatgtctacatc 115404
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 177      tacatatatatgtctacatc 196
                ||||||||||||||||||||
Sbjct: 20843615 tacatatatatgtctacatc 20843596
to top
>dbj|AK126211.1| Homo sapiens cDNA FLJ44223 fis, clone THYMU3006118, highly  similar
            to Homo sapiens molybdenum cofactor synthesis 2 (MOCS2)
          Length = 2848

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 551  aattgttttccatctttgta 570
            ||||||||||||||||||||
Sbjct: 1336 aattgttttccatctttgta 1355
to top
>gb|AC010377.7| Homo sapiens chromosome 5 clone CTD-2060J20, complete sequence
          Length = 139476

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 551   aattgttttccatctttgta 570
             ||||||||||||||||||||
Sbjct: 90632 aattgttttccatctttgta 90651
to top
>gb|AC158662.7| Mus musculus 6 BAC RP23-20K24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 250218

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 381   aaccttgccaccaatcacct 400
             ||||||||||||||||||||
Sbjct: 97913 aaccttgccaccaatcacct 97932
to top
>gb|AC149092.6| Pan troglodytes BAC clone CH251-553I6 from chromosome 7, complete
             sequence
          Length = 194702

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   aaagggaaatacatatatat 187
             ||||||||||||||||||||
Sbjct: 73251 aaagggaaatacatatatat 73270
to top
>gb|AC008966.9| Homo sapiens chromosome 5 clone CTD-2366F13, complete sequence
          Length = 174831

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 551   aattgttttccatctttgta 570
             ||||||||||||||||||||
Sbjct: 41643 aattgttttccatctttgta 41662
to top
>gb|AC099030.1| Drosophila melanogaster, chromosome 2R, region 53F-54X, BAC clone
             BACR09M08, complete sequence
          Length = 179283

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 571   agcaacacgacctttagcag 590
             ||||||||||||||||||||
Sbjct: 34143 agcaacacgacctttagcag 34162
to top
>gb|AC099021.1| Drosophila melanogaster, chromosome 2R, region 53E-54X, BAC clone
              BACR03E17, complete sequence
          Length = 160338

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 571    agcaacacgacctttagcag 590
              ||||||||||||||||||||
Sbjct: 138792 agcaacacgacctttagcag 138811
to top
>gb|AC161019.3| Pan troglodytes BAC clone CH251-7O2 from chromosome 7, complete
             sequence
          Length = 165769

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 168   aaagggaaatacatatatat 187
             ||||||||||||||||||||
Sbjct: 62235 aaagggaaatacatatatat 62216
to top
>gb|AC155643.8| Mus musculus 10 BAC RP24-132F13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 187480

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    atacatatatatgtctacat 195
              ||||||||||||||||||||
Sbjct: 143501 atacatatatatgtctacat 143482
to top
>gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, complete sequence
          Length = 178105

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 168    aaagggaaatacatatatat 187
              ||||||||||||||||||||
Sbjct: 163652 aaagggaaatacatatatat 163633
to top
>emb|CR387771.1| Gallus gallus finished cDNA, clone ChEST535m13
          Length = 1425

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 104 tttgctgctgccctgccagtccca 127
           ||||||||||||||||||| ||||
Sbjct: 889 tttgctgctgccctgccagcccca 866
to top
>gb|AC154736.2| Mus musculus BAC clone RP24-389J14 from chromosome 16, complete sequence
          Length = 141092

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    agtcccattacacttcagca 140
              ||||||||||||||||||||
Sbjct: 128605 agtcccattacacttcagca 128586
to top
>gb|AC022209.4|AC022209 Homo sapiens BAC clone RP11-588M21 from 11, complete sequence
          Length = 177314

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 173   gaaatacatatatatgtcta 192
             ||||||||||||||||||||
Sbjct: 76956 gaaatacatatatatgtcta 76975
to top
>gb|AC158623.5| Mus musculus 10 BAC RP23-302A11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 191932

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    atacatatatatgtctacat 195
              ||||||||||||||||||||
Sbjct: 112899 atacatatatatgtctacat 112918
to top
>emb|BX005167.12| Mouse DNA sequence from clone RP23-247K19 on chromosome X, complete
              sequence
          Length = 212046

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    atacatatatatgtctacat 195
              ||||||||||||||||||||
Sbjct: 176469 atacatatatatgtctacat 176488
to top
>gb|AC126415.9| Mus musculus chromosome 5, clone RP24-476K21, complete sequence
          Length = 168525

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 361   aagtatttagtagtacagtgaacc 384
             |||||||||| |||||||||||||
Sbjct: 42697 aagtatttagaagtacagtgaacc 42720
to top
>gb|AC010726.4|AC010726 Homo sapiens BAC clone RP11-224C16 from Y, complete sequence
          Length = 176524

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 177    tacatatatatgtctacatc 196
              ||||||||||||||||||||
Sbjct: 160407 tacatatatatgtctacatc 160426
to top
>gb|AC015799.23| Homo sapiens chromosome 17, clone RP11-135N5, complete sequence
          Length = 180157

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 158   agggcaaacaaaagggaaatacat 181
             |||| |||||||||||||||||||
Sbjct: 89881 agggaaaacaaaagggaaatacat 89858
to top
>emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in linkage group 7,
             complete sequence
          Length = 199752

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   tgtcaactctacagcctacc 308
             ||||||||||||||||||||
Sbjct: 80725 tgtcaactctacagcctacc 80706
to top
>emb|AJ969201.2| Helicobacter pullorum partial gyrB gene for gyrase B, strain CCUG
           33842
          Length = 1098

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 158 agggcaaacaaaagggaaat 177
           ||||||||||||||||||||
Sbjct: 651 agggcaaacaaaagggaaat 670
to top
>emb|CR847514.13| Zebrafish DNA sequence from clone DKEYP-11D6 in linkage group 3, complete
              sequence
          Length = 165569

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 278    ctgatgactcatgtcaactc 297
              ||||||||||||||||||||
Sbjct: 102510 ctgatgactcatgtcaactc 102529
to top
>emb|AJ295749.2|RNO295749 Rattus norvegicus mRNA for xylosyltransferase II (XT-II gene)
          Length = 2806

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 398  cctctggtagccagggagcc 417
            ||||||||||||||||||||
Sbjct: 2669 cctctggtagccagggagcc 2688
to top
>gb|AE003805.3| Drosophila melanogaster chromosome 2R, section 45 of 73 of the complete
              sequence
          Length = 272948

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 571    agcaacacgacctttagcag 590
              ||||||||||||||||||||
Sbjct: 152640 agcaacacgacctttagcag 152659
to top
>gb|AC148935.6| Pan troglodytes BAC clone CH251-485J2 from chromosome 7, complete
             sequence
          Length = 215177

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 168   aaagggaaatacatatatat 187
             ||||||||||||||||||||
Sbjct: 84910 aaagggaaatacatatatat 84929
to top
>emb|AL837516.14| Mouse DNA sequence from clone RP23-234L8 on chromosome 2, complete
              sequence
          Length = 202046

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 548    taaaattgttttccatcttt 567
              ||||||||||||||||||||
Sbjct: 100531 taaaattgttttccatcttt 100512
to top
>gb|AC132603.4| Mus musculus BAC clone RP24-66C10 from 1, complete sequence
          Length = 218575

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 26    aaggatacataaagcatgcagcaa 49
             ||||||||||||||| ||||||||
Sbjct: 19985 aaggatacataaagcctgcagcaa 20008
to top
>gb|AC140402.2| Mus musculus BAC clone RP24-90D2 from 10, complete sequence
          Length = 237935

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 176    atacatatatatgtctacat 195
              ||||||||||||||||||||
Sbjct: 220732 atacatatatatgtctacat 220713
to top
>gb|AC004641.1|AC004641 Drosophila melanogaster DNA sequence (P1s DS07321 (D175), DS05993
             (D241), and DS06306 (D173)), complete sequence
          Length = 154985

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 571   agcaacacgacctttagcag 590
             ||||||||||||||||||||
Sbjct: 71654 agcaacacgacctttagcag 71635
to top
>gb|AC137555.4| Mus musculus BAC clone RP23-445B17 from 1, complete sequence
          Length = 174607

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 26     aaggatacataaagcatgcagcaa 49
              ||||||||||||||| ||||||||
Sbjct: 135151 aaggatacataaagcctgcagcaa 135174
to top
>gb|AC118547.41| Mus musculus strain C57BL/6J clone rp23-3g4 map 17, complete sequence
          Length = 234061

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 176    atacatatatatgtctacat 195
              ||||||||||||||||||||
Sbjct: 180014 atacatatatatgtctacat 180033


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,978,501
Number of Sequences: 3902068
Number of extensions: 6978501
Number of successful extensions: 187144
Number of sequences better than 10.0: 84
Number of HSP's better than 10.0 without gapping: 84
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 186395
Number of HSP's gapped (non-prelim): 748
length of query: 691
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 668
effective length of database: 17,143,297,704
effective search space: 11451722866272
effective search space used: 11451722866272
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top