Clone Name | rbasd1k24 |
---|---|
Clone Library Name | barley_pub |
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 517 bits (261), Expect = e-143 Identities = 388/431 (90%), Gaps = 17/431 (3%) Strand = Plus / Minus Query: 100 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 152 ||||||||||||||||||||||| || ||||||||||||||||| |||||| || Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873 Query: 153 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 212 |||||||| ||||||||||| |||||||||||||||| ||||| ||||||| Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823 Query: 213 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 272 || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| ||||| Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763 Query: 273 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||| ||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703 Query: 333 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 392 | ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643 Query: 393 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 452 |||||| |||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583 Query: 453 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 512 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 582 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 523 Query: 513 ggtgtagacga 523 ||||||||||| Sbjct: 522 ggtgtagacga 512 Score = 67.9 bits (34), Expect = 3e-08 Identities = 44/48 (91%) Strand = Plus / Minus Query: 1 actcaactgnagnattctcaaaccccaacaacttcacaacatcacatt 48 ||||||||| | |||||||||||||| |||||||||||||||||||| Sbjct: 1014 actcaactgaaaaattctcaaaccccaccaacttcacaacatcacatt 967
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 502 bits (253), Expect = e-139 Identities = 283/293 (96%) Strand = Plus / Minus Query: 231 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 290 |||||||||||||| |||||||| | |||||| |||||||||||||| |||||||||||| Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742 Query: 291 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 350 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682 Query: 351 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 410 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622 Query: 411 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 470 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562 Query: 471 gccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 561 gccgagggaacccttcttggggtcggcggcggtggcgtacacggtgtagacga 509
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 498 bits (251), Expect = e-137 Identities = 284/295 (96%) Strand = Plus / Minus Query: 229 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 288 |||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741 Query: 289 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 348 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681 Query: 349 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 408 ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621 Query: 409 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 468 ||||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||| Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561 Query: 469 gtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 560 gtgccgagggaccccttcttggggtcggcggcggtggcgtacacggtgtagacga 506
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 494 bits (249), Expect = e-136 Identities = 285/297 (95%) Strand = Plus / Minus Query: 227 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 286 |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| |||| Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747 Query: 287 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 346 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687 Query: 347 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 406 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627 Query: 407 agaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 466 ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567 Query: 467 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 566 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 510
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 13250885 ccttcttggggtcggcggcggtggcgtacacggtgta 13250849
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 12695 ccttcttggggtcggcggcggtggcgtacacggtgta 12659
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 168073 ccttcttggggtcggcggcggtggcgtacacggtgta 168037
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 585 ccttcttggggtcggcggcggtggcgtacacggtgta 549
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 587 ccttcttggggtcggcggcggtggcgtacacggtgta 551
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 588 ccttcttggggtcggcggcggtggcgtacacggtgta 552
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 586 ccttcttggggtcggcggcggtggcgtacacggtgta 550
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 588 ccttcttggggtcggcggcggtggcgtacacggtgta 552
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 375 bits (189), Expect = e-100 Identities = 255/277 (92%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 586 ccttcttggggtcggcggcggtggcgtacacggtgta 550
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 367 bits (185), Expect = 2e-98 Identities = 254/277 (91%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 587 ccttcttggggtcggcggcggtggcgtacacggtgta 551
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 367 bits (185), Expect = 2e-98 Identities = 254/277 (91%) Strand = Plus / Minus Query: 242 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 301 ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| |||||||| Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646 Query: 302 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 361 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586 Query: 362 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 421 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526 Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgta 518 ||||||||||||||||||||||||||||||||||||| Sbjct: 465 ccttcttggggtcggcggcggtggcgtacacggtgta 429
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 254 bits (128), Expect = 3e-64 Identities = 214/240 (89%), Gaps = 2/240 (0%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 344 |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| || Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704 Query: 345 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 403 || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| |||| Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645 Query: 404 cggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 463 || |||||| || || ||||||||||||| |||||||||||||||||||||||||| | Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585 Query: 464 cgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 584 cgatggtgccgagggagcccttcttggggtcggcggcggtggcgtacacggtgtagacga 525
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 244 bits (123), Expect = 2e-61 Identities = 210/239 (87%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 344 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861 Query: 345 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 404 || ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801 Query: 405 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 464 | |||||| || || ||||||||||||| |||||||||||||||||||||||||| || Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741 Query: 465 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 740 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacacggtgtagacga 682
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 244 bits (123), Expect = 2e-61 Identities = 210/239 (87%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 344 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860 Query: 345 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 404 || ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800 Query: 405 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 464 | |||||| || || ||||||||||||| |||||||||||||||||||||||||| || Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740 Query: 465 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 739 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacacggtgtagacga 681
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Minus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 503 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 460
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Plus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 26627363 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 26627406
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Plus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 169744 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 169787
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Plus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 61524 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 61567
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Minus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 576 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 533
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Minus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 378 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 335
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 198 bits (100), Expect = 1e-47 Identities = 193/224 (86%) Strand = Plus / Minus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 354 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592 Query: 355 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 414 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532 Query: 415 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 474 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472 Query: 475 agggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || ||||||||||| ||||| || || ||||||||||| ||||| Sbjct: 250471 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgta 250428 Score = 131 bits (66), Expect = 3e-27 Identities = 111/126 (88%) Strand = Plus / Plus Query: 393 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 452 |||||| |||||| ||| |||||||| ||||||||||||| ||||||||||||||||| Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154 Query: 453 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 512 |||||||| |||||||||||||| ||||||||||| ||||| || || ||||||||||| Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtccgccgccgtggcgtacac 332214 Query: 513 ggtgta 518 ||||| Sbjct: 332215 cgtgta 332220
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 194 bits (98), Expect = 2e-46 Identities = 188/218 (86%) Strand = Plus / Minus Query: 301 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 360 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698 Query: 361 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 420 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638 Query: 421 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 480 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578 Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgta 518 |||||||| |||||||| |||||||||||||||||||| Sbjct: 577 cccttcttcgggtcggccgcggtggcgtacacggtgta 540
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 194 bits (98), Expect = 2e-46 Identities = 188/218 (86%) Strand = Plus / Minus Query: 301 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 360 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680 Query: 361 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 420 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620 Query: 421 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 480 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560 Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgta 518 |||||||| |||||||| |||||||||||||||||||| Sbjct: 559 cccttcttcgggtcggccgcggtggcgtacacggtgta 522
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 186 bits (94), Expect = 5e-44 Identities = 187/218 (85%) Strand = Plus / Minus Query: 301 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 360 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| ||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621 Query: 361 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 420 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561 Query: 421 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 480 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501 Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgta 518 |||||||| |||||||| |||||||||||||||||||| Sbjct: 500 cccttcttcgggtcggccgcggtggcgtacacggtgta 463
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 186 bits (94), Expect = 5e-44 Identities = 187/218 (85%) Strand = Plus / Minus Query: 301 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 360 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| ||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689 Query: 361 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 420 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629 Query: 421 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 480 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569 Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgta 518 |||||||| |||||||| |||||||||||||||||||| Sbjct: 568 cccttcttcgggtcggccgcggtggcgtacacggtgta 531
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 163 bits (82), Expect = 7e-37 Identities = 199/238 (83%) Strand = Plus / Minus Query: 283 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 342 ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| || Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716 Query: 343 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 402 | ||||||||| ||||| |||| || ||| |||| ||||| || ||||||||||| ||| Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656 Query: 403 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 462 || ||||||||||| || | | ||||||||| || ||||||||||| || || ||||| Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596 Query: 463 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtaga 520 ||||||||||| ||| |||||||| |||||||| ||||||||||| |||||||||| Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtcggctgcggtggcgtagacggtgtaga 538
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 161 bits (81), Expect = 3e-36 Identities = 135/153 (88%) Strand = Plus / Minus Query: 366 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 425 |||||||||||| ||| || ||||||||||| |||||||||||| |||| | ||||| Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622 Query: 426 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 485 ||||||||| |||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 562 Query: 486 cttggggtcggcggcggtggcgtacacggtgta 518 |||||||||| |||||||||||||||| ||||| Sbjct: 561 cttggggtcgacggcggtggcgtacaccgtgta 529 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 344 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637 Query: 345 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 404 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577 Query: 405 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 464 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517 Query: 465 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| Sbjct: 516 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgta 463
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Plus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 344 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542 Query: 345 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 404 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602 Query: 405 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 464 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662 Query: 465 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| Sbjct: 92663 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgta 92716
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 155 bits (78), Expect = 2e-34 Identities = 195/234 (83%) Strand = Plus / Plus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 344 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566 Query: 345 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 404 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626 Query: 405 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 464 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686 Query: 465 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgta 518 || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgta 27568740 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 491 ggtcggcggcggtggcgtacacggtgtagacga 523 ||||| |||||||||||||||||||||| |||| Sbjct: 26354650 ggtcgacggcggtggcgtacacggtgtacacga 26354618 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 536 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 477 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 476 tacacggtgtagacga 461 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Plus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 2544946 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545005 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 2545006 tacacggtgtagacga 2545021 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 125148 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 125089 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 125088 tacacggtgtagacga 125073 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Plus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 2545056 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545115 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 2545116 tacacggtgtagacga 2545131 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 614 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 555 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 554 tacacggtgtagacga 539 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Plus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 355 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 414 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 415 tacacggtgtagacga 430
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 623 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 564 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 563 tacacggtgtagacga 548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 625 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 566 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 565 tacacggtgtagacga 550 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 149 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 90 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 89 tacacggtgtagacga 74 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 151 bits (76), Expect = 3e-33 Identities = 121/136 (88%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 621 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 562 Query: 508 tacacggtgtagacga 523 |||||||||||||||| Sbjct: 561 tacacggtgtagacga 546 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 149 bits (75), Expect = 1e-32 Identities = 135/155 (87%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 ||||| || ||||| ||||| || ||||||||||| |||||| |||||| ||||| || Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| ||| Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagccc 44724 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgta 518 |||||||||||||| || || |||||||| ||||| Sbjct: 44723 ttcttggggtcggccgccgtcgcgtacaccgtgta 44689 Score = 40.1 bits (20), Expect = 7.1 Identities = 44/52 (84%) Strand = Plus / Minus Query: 347 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 398 |||||||||||||| |||| || || ||||| || || || ||||||||||| Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 133 bits (67), Expect = 6e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||||| |||| | |||||||||||||| || ||||||||| Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||| ||| ||||||||||||||| | ||||||||| Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgaccgcggtggcg 556 Query: 508 tacacggtgta 518 ||||| ||||| Sbjct: 555 tacacagtgta 545
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 129 bits (65), Expect = 1e-26 Identities = 131/153 (85%) Strand = Plus / Minus Query: 366 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 425 |||||||||||| ||| || ||||||||||| |||||||||||| |||| | || || Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653 Query: 426 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 485 ||||||||| || ||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 593 Query: 486 cttggggtcggcggcggtggcgtacacggtgta 518 ||||||||| |||| ||||||||||| ||||| Sbjct: 592 cttggggtccacggccgtggcgtacaccgtgta 560 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 127 bits (64), Expect = 4e-26 Identities = 136/160 (85%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 504 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||| || | ||||||||||||||||||||||||| Sbjct: 503 ttcttgggatccaccgcggtggcgtacacggtgtagacga 464
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 127 bits (64), Expect = 4e-26 Identities = 136/160 (85%) Strand = Plus / Plus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 43108923 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||| || | ||||||||||||||||||||||||| Sbjct: 43108924 ttcttgggatccaccgcggtggcgtacacggtgtagacga 43108963 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 429 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412 Query: 430 ttggccccgacgatgaagccga 451 ||||| ||||||| || ||||| Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 492 gtcggcggcggtggcgtacacggtg 516 ||||||||||| ||||||||||||| Sbjct: 8192882 gtcggcggcggcggcgtacacggtg 8192858
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 127 bits (64), Expect = 4e-26 Identities = 136/160 (85%) Strand = Plus / Plus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 105952 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||| || | ||||||||||||||||||||||||| Sbjct: 105953 ttcttgggatccaccgcggtggcgtacacggtgtagacga 105992
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 127 bits (64), Expect = 4e-26 Identities = 136/160 (85%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 528 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||| || | ||||||||||||||||||||||||| Sbjct: 527 ttcttgggatccaccgcggtggcgtacacggtgtagacga 488
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 127 bits (64), Expect = 4e-26 Identities = 136/160 (85%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 577 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||| || | ||||||||||||||||||||||||| Sbjct: 576 ttcttgggatccaccgcggtggcgtacacggtgtagacga 537
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 127 bits (64), Expect = 4e-26 Identities = 136/160 (85%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 423 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574 Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 514 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||| || | ||||||||||||||||||||||||| Sbjct: 513 ttcttgggatccaccgcggtggcgtacacggtgtagacga 474
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 109 bits (55), Expect = 9e-21 Identities = 112/131 (85%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||||||||||||||||||||| ||| |||||||| ||||| | || |||||| Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 478 Query: 508 tacacggtgta 518 ||||| ||||| Sbjct: 477 tacaccgtgta 467 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Minus Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||| Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||||| |||| ||||||||||| ||||| |||| Sbjct: 517 ttcttggggtccacggccgtggcgtacaccgtgtacacga 478
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 103 bits (52), Expect = 6e-19 Identities = 88/100 (88%) Strand = Plus / Plus Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 ||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||| Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||||| |||| ||||||||||| ||||| |||| Sbjct: 494 ttcttggggtccacggccgtggcgtacaccgtgtacacga 533
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 101 bits (51), Expect = 2e-18 Identities = 111/131 (84%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 |||||||| ||||||||||||||||| ||| |||||||| ||||| | || |||||| Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 570 Query: 508 tacacggtgta 518 ||||| ||||| Sbjct: 569 tacaccgtgta 559 Score = 48.1 bits (24), Expect = 0.029 Identities = 42/48 (87%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 590 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 589 gtggcgtagacagtgtagac 570
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Plus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 1285 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 1286 gtggcgtagacagtgtagac 1305
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 95.6 bits (48), Expect = 1e-16 Identities = 87/100 (87%) Strand = Plus / Minus Query: 424 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 483 |||||||||||||| |||||||||||||| |||||||| ||||| || || ||| ||| Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgatcgtccccaggctcccc 497 Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||| ||||| |||||||||||||||||||||||||| Sbjct: 496 ttcttcgggtcaatggcggtggcgtacacggtgtagacga 457
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 480 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 479 gtggcgtagacagtgtagac 460
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 551 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 550 gtggcgtagacagtgtagac 531
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 528 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 527 gtggcgtagacagtgtagac 508
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 533 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 532 gtggcgtagacagtgtagac 513
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 530 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 529 gtggcgtagacagtgtagac 510
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 552 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 551 gtggcgtagacagtgtagac 532
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 19379 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 19378 gtggcgtagacagtgtagac 19359
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 497 Query: 502 gtggcgtacacggtgtagac 521 |||||||| || |||||||| Sbjct: 496 gtggcgtagacagtgtagac 477
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 441 ||||| ||||||||||| || || ||||| || ||||| | ||||||||||| |||||| Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581 Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 |||| || ||||||| ||| |||||||| ||||| || ||||| ||||| || |||||| Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttgggatcagcggcg 521 Query: 502 gtggcgtacacggtgtagac 521 |||| ||| ||||||||||| Sbjct: 520 gtggggtagacggtgtagac 501
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 93.7 bits (47), Expect = 5e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||||| |||| | || ||||||||||| || ||||||||| Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 494 |||||||||||||||||||||||||| ||| |||||||| ||||| Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 587 Score = 48.1 bits (24), Expect = 0.029 Identities = 42/48 (87%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 93.7 bits (47), Expect = 5e-16 Identities = 92/107 (85%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 494 |||||||| ||||||||||||||||| ||| |||||||| ||||| Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 586 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 332 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 91.7 bits (46), Expect = 2e-15 Identities = 91/106 (85%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||| | Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638 Query: 386 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 431 | |||||||| || || |||||||| ||||||||| | |||||||| Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 89.7 bits (45), Expect = 9e-15 Identities = 156/193 (80%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 ||||||||||||| ||| | |||||||||| || || || || || ||||| ||||| | Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633 Query: 386 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 445 | ||||||||||| || || ||||| || || || | | ||||||||| || || |||| Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573 Query: 446 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 505 |||||||||| ||||| || ||||| ||||| ||||||||||| ||||| || ||||| | Sbjct: 572 agccgatggcaatgggtgcaatggtcccgagtgatcccttctttgggtcagctgcggttg 513 Query: 506 cgtacacggtgta 518 | ||||| ||||| Sbjct: 512 catacactgtgta 500
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 85.7 bits (43), Expect = 1e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 367 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 426 ||||| ||||||||||| || ||||||||||| || || ||||| |||||||| | | | Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637 Query: 427 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 486 |||||||| || || ||||| || || || |||||||| |||||||| | || ||| || Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577 Query: 487 ttggggtcggcggcggtggcgtacacggtgtagac 521 |||||||| | ||||||||||| ||||||||||| Sbjct: 576 ttggggtcaactgcggtggcgtagacggtgtagac 542
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 83.8 bits (42), Expect = 5e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||| | Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596 Query: 386 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 431 | |||||||| || || |||||||| ||||| ||| | |||||||| Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 79.8 bits (40), Expect = 8e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagac 521 | ||||| || || || || |||||||| ||||||||||| Sbjct: 537 ctttctttggatcagctgctgtggcgtaaacggtgtagac 498
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 79.8 bits (40), Expect = 8e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagac 521 | ||||| || || || || |||||||| ||||||||||| Sbjct: 499 ctttctttggatcagctgctgtggcgtaaacggtgtagac 460
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 79.8 bits (40), Expect = 8e-12 Identities = 85/100 (85%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagac 521 | ||||| || || || || |||||||| ||||||||||| Sbjct: 527 ctttctttggatcagctgctgtggcgtaaacggtgtagac 488
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 79.8 bits (40), Expect = 8e-12 Identities = 85/100 (85%) Strand = Plus / Plus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagac 521 | ||||| || || || || |||||||| ||||||||||| Sbjct: 8707 ctttctttggatcagctgctgtggcgtaaacggtgtagac 8746
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 447 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggc 506 ||||||||||| ||| ||||| ||||||| || ||| |||||||||||| ||||||||| Sbjct: 616 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggc 557 Query: 507 gtacacggtgtagac 521 ||| ||||||||||| Sbjct: 556 gtagacggtgtagac 542 Score = 40.1 bits (20), Expect = 7.1 Identities = 47/56 (83%) Strand = Plus / Minus Query: 284 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||||||||||| | | | |||| || |||||| |||||||||||||| Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 77.8 bits (39), Expect = 3e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 447 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggc 506 ||||||||||| ||| ||||| ||||||| || ||| |||||||||||| ||||||||| Sbjct: 304 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggc 245 Query: 507 gtacacggtgtagac 521 ||| ||||||||||| Sbjct: 244 gtagacggtgtagac 230
>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial cds Length = 2235 Score = 77.8 bits (39), Expect = 3e-11 Identities = 99/119 (83%) Strand = Plus / Minus Query: 403 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 462 |||||||| || ||||| ||||||||||||| || ||||| | || ||||||| || Sbjct: 2228 ccggagaatggaccggcggcgaggatgttggcaccaacgataagaccaatggcgagagga 2169 Query: 463 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagac 521 |||||||| ||||| || ||||||||||| || |||||||||||||| || |||||||| Sbjct: 2168 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgtagacagtgtagac 2110
>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds Length = 316 Score = 73.8 bits (37), Expect = 5e-10 Identities = 79/93 (84%) Strand = Plus / Minus Query: 426 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 485 ||||||||| || || |||||||||||||| ||||| || ||||| ||||| |||||||| Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230 Query: 486 cttggggtcggcggcggtggcgtacacggtgta 518 ||| ||||| || ||||| || ||||| ||||| Sbjct: 229 ctttgggtcagctgcggttgcatacactgtgta 197
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 71.9 bits (36), Expect = 2e-09 Identities = 84/100 (84%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||||||||| || |||||||| || || ||||| || |||||||| ||||| |||| Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagac 521 | ||||| || || || || |||||||| ||||||||||| Sbjct: 123683 ctttctttggatcagcagctgtggcgtaaacggtgtagac 123644
>dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds Length = 992 Score = 71.9 bits (36), Expect = 2e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 429 ||||||||||| || || |||||||| || || ||| ||| ||||| ||| | | ||| Sbjct: 639 gggccgaatgatcgggccgggttcattgagccaccgctgaatgggccagcagccaaaatg 580 Query: 430 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 489 ||||| || |||||||| || ||||| ||||| || |||||||| || || ||||| ||| Sbjct: 579 ttggcaccaacgatgaaaccaatggcaatgggtgcaatggtgcctagtgagccctttttg 520 Query: 490 gggtcggcggcggtggcgtacacggtgtagac 521 || || ||||| |||||||| ||||||||||| Sbjct: 519 ggatccgcggctgtggcgtaaacggtgtagac 488
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 69.9 bits (35), Expect = 8e-09 Identities = 41/43 (95%) Strand = Plus / Minus Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||||||||| ||||||||||||||||||||||||||| Sbjct: 588 cccttcttggggtcaacggcggtggcgtacacggtgtagacga 546 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 285 gtagacgatgccggcgaggccaccgccgatg 315 ||||| || |||||||||||||||||||||| Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 67.9 bits (34), Expect = 3e-08 Identities = 85/102 (83%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | | Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 388 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 347
>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds Length = 1049 Score = 63.9 bits (32), Expect = 5e-07 Identities = 155/196 (79%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 |||||||||||||| ||| | |||||| ||||| | || || || ||||| ||||| | Sbjct: 736 cccagtagatccagttgtcgtggaagtcaccgcttaccacagctggcccgaaggagcggg 677 Query: 386 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 445 | |||| |||||| || || ||||| ||||| ||| | | |||||||| || || |||| Sbjct: 676 ctgggtacatggatccaccagagaatgggcctgcagccaaaatgttggcaccaacaatga 617 Query: 446 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 505 | || ||||| ||||| || |||||||| || ||||| ||||||||||| || ||||| | Sbjct: 616 aaccaatggcaatgggagcaatggtgcctagtgatcctttcttggggtcagctgcggttg 557 Query: 506 cgtacacggtgtagac 521 | || || |||||||| Sbjct: 556 catatactgtgtagac 541
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 61.9 bits (31), Expect = 2e-06 Identities = 112/139 (80%) Strand = Plus / Minus Query: 307 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 366 ||||||| ||||||||| |||||||| |||| ||| || |||| ||| |||| | | Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766 Query: 367 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 426 || |||||||| |||||||| ||||||||||| |||||| |||| |||| | ||||| Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706 Query: 427 atgttggccccgacgatga 445 ||||||| |||||||||| Sbjct: 705 ctgttggcgccgacgatga 687
>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 61.9 bits (31), Expect = 2e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 463 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagac 521 |||||||| ||||| || ||||||||||| || |||||||||||||| || |||||||| Sbjct: 573 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgtagacagtgtagac 515
>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water channel AT3G26520 (TIP2) mRNA, complete cds Length = 1201 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 680 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 621 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 620 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 579
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 429 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549 Query: 430 ttggccccgacgatgaagccga 451 ||||| ||||||| || ||||| Sbjct: 548 ttggcgccgacgacgaggccga 527
>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 762 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 568 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 509 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 508 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 467
>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds Length = 1072 Score = 60.0 bits (30), Expect = 8e-06 Identities = 81/98 (82%) Strand = Plus / Minus Query: 322 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 381 ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660 Query: 382 cgtgcagggttcatggaaccgccggagaaggggccggc 419 || || || ||||| || || |||||||| |||||||| Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622
>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1061 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 630 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 571 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 570 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 529
>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1066 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 635 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 576 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 575 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 534
>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic protein mRNA, complete cds Length = 1072 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 642 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 583 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 582 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 541
>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1010 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 618 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 559 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 558 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 517
>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1020 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 515
>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 515
>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1054 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 607 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 548 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 547 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 506
>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 625 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 566 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 565 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 524
>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 439 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 380 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 379 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 338
>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1012 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 515
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 429 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842 Query: 430 ttggccccgacgatgaagccga 451 ||||| ||||||| || ||||| Sbjct: 98841 ttggcgccgacgacgaggccga 98820
>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16 Length = 82646 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Plus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 15558 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 15617 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 15618 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 15659
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 60.0 bits (30), Expect = 8e-06 Identities = 69/82 (84%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 429 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552 Query: 430 ttggccccgacgatgaagccga 451 ||||| ||||||| || ||||| Sbjct: 551 ttggcgccgacgacgaggccga 530
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 577 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 518 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 517 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 476
>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence Length = 1054 Score = 60.0 bits (30), Expect = 8e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || ||||| || || ||||| || ||||| | Sbjct: 638 cgaggatgttagctccaacgatgaaacctatggcaattggtgcgattgttccgagactac 579 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | |||||||||||| |||| |||||||| ||||||||||||| Sbjct: 578 cgttcttggggtcgacggctgtggcgtaaacggtgtagacga 537
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 58.0 bits (29), Expect = 3e-05 Identities = 77/93 (82%) Strand = Plus / Minus Query: 426 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 485 ||||||||| |||||||| |||||||||||||| || || || ||||| | | ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262 Query: 486 cttggggtcggcggcggtggcgtacacggtgta 518 ||||||||| ||||||||||| |||||||| Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgta 229
>gb|AC183495.1| Brassica oleracea Contig A, complete sequence Length = 356505 Score = 56.0 bits (28), Expect = 1e-04 Identities = 82/100 (82%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 ||||||| ||||| || |||||||| || || ||||| || || ||||| ||||| |||| Sbjct: 101446 cgaggatattggcaccaacgatgaaaccaatagcgatcggagcaatggttccgagcgatc 101387 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagac 521 |||| || || || || ||||||||||| ||||| ||||| Sbjct: 101386 ccttttttggatcagcagcggtggcgtaaacggtatagac 101347
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 367 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 426 ||||||||||| ||||| || ||||||||||| ||||||||||||| ||| | |||| Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649 Query: 427 atgttggccccgacga 442 | |||||| ||||||| Sbjct: 648 acgttggcgccgacga 633
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 ||||| |||||||| ||||||||||||||||||||| Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 56.0 bits (28), Expect = 1e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 426 gatgttggccccgacgatgaagccgatggcgatggg 461 ||||||||| |||||||||||||||||||| ||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 430 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 489 ||||| |||||||| |||||||||||||| || || ||||| || || |||||||| || Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258 Query: 490 gggtcggcggcggtggcgtacacggtgtagac 521 ||||| || || || ||||| || |||||||| Sbjct: 257 gggtcagctgcagtcgcgtaaactgtgtagac 226
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 436 ccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 494 |||||||||||||||||||||| || || ||||| |||| || |||||||||||||| Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253
>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340 (DELTA-TIP2/TIP2;2) mRNA, complete cds Length = 977 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 598 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 539 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 538 tagactgtgtagac 525
>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8 Length = 207674 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 64801 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 64742 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 64741 tagactgtgtagac 64728
>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46 Length = 198788 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 54166 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 54107 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 54106 tagactgtgtagac 54093
>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 753 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 533 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 474 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 473 tagactgtgtagac 460
>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 972 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 595 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 536 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 535 tagactgtgtagac 522
>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 628 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| ||| |||||||| ||||||||||||| Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacga 81
>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 931 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| | |||||||| || ||||| ||||||| | Sbjct: 604 cgaggatgttcgctccaacgatgaaacttatggcgattggtgcgattttgccgagaatac 545 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 544 cgttcttggggtcaacggctgtggcgtagacggtgtagacga 503
>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 954 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 581 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 522 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 521 tagactgtgtagac 508
>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 936 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 556 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 497 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 496 tagactgtgtagac 483
>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence Length = 969 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 388 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 447 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600 Query: 448 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 507 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 599 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 540 Query: 508 tacacggtgtagac 521 || || |||||||| Sbjct: 539 tagactgtgtagac 526
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 491 ggtcggcggcggtggcgtacacggtgtagacga 523 ||||| |||||||||||||||||||||| |||| Sbjct: 517 ggtcgacggcggtggcgtacacggtgtacacga 485
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Minus Query: 427 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 486 |||||||| ||||||||||| ||||| || ||||| |||||||| || | |||||| Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggttccaatatcccccttc 521 Query: 487 ttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||| ||| | || || |||||||| |||||||||| Sbjct: 520 ttgggatcgacagcagtagcgtacacagtgtagacga 484
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 491 ggtcggcggcggtggcgtacacggtgtagacga 523 ||||| |||||||||||||||||||||| |||| Sbjct: 131227 ggtcgacggcggtggcgtacacggtgtacacga 131195
>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1, complete cds Length = 1001 Score = 50.1 bits (25), Expect = 0.007 Identities = 133/169 (78%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 |||||||||||||| |||||||||||| ||| | |||| ||||||||||| || | Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648 Query: 386 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 445 | |||||||| |||||||| || ||||||||| | | ||||||||| || || |||| Sbjct: 647 ccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatga 588 Query: 446 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 494 |||| || || ||||| || || |||| | |||||||| |||||||| Sbjct: 587 agcctattgcaatgggtgcaataatgcccaatgatccctttttggggtc 539
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 491 ggtcggcggcggtggcgtacacggtgtagacga 523 ||||| |||||||||||||||||||||| |||| Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacga 551
>emb|Z48232.1|PCRB7PRJ P.crispum mRNA for membrane intrinsic protein Length = 954 Score = 48.1 bits (24), Expect = 0.029 Identities = 66/80 (82%) Strand = Plus / Minus Query: 442 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 501 |||||||| || || ||||| || ||||| || || || |||||||||||||| || || Sbjct: 586 atgaagccaattgcaatgggtgcaatggttccaagtgagcccttcttggggtctgcagca 527 Query: 502 gtggcgtacacggtgtagac 521 |||||||| | ||||||||| Sbjct: 526 gtggcgtagaaggtgtagac 507
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene tip1-1) Length = 1104 Score = 48.1 bits (24), Expect = 0.029 Identities = 33/36 (91%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 ||||| ||||| || ||||||||||||||||||||| Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720
>emb|AJ843991.1| Plantago major partial mRNA for aquaporin 1 (aqp1 gene) Length = 871 Score = 48.1 bits (24), Expect = 0.029 Identities = 120/152 (78%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 429 ||||||||||| || || ||||||||||| || || ||| ||||||||| | | ||| Sbjct: 565 gggccgaatgatcgggctgggttcatggatccaccactgaatgggccggcagccaaaatg 506 Query: 430 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 489 ||||| || || ||||| || || || || ||||| || || || || || ||||||||| Sbjct: 505 ttggctccaacaatgaatccaattgccattggggcaattgttccaagtgaacccttcttg 446 Query: 490 gggtcggcggcggtggcgtacacggtgtagac 521 ||||| || || ||||| ||||| |||||||| Sbjct: 445 gggtcagctgctgtggcatacacagtgtagac 414
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 48.1 bits (24), Expect = 0.029 Identities = 45/52 (86%) Strand = Plus / Minus Query: 347 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 398 |||||| ||||||| | ||||| |||||||| ||||| || ||||||||||| Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668
>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 48.1 bits (24), Expect = 0.029 Identities = 36/40 (90%) Strand = Plus / Minus Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 546 ttcttggggtcaacggctgtggcgtagacggtgtagacga 507
>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 921 Score = 48.1 bits (24), Expect = 0.029 Identities = 36/40 (90%) Strand = Plus / Minus Query: 484 ttcttggggtcggcggcggtggcgtacacggtgtagacga 523 ||||||||||| |||| |||||||| ||||||||||||| Sbjct: 554 ttcttggggtcaacggctgtggcgtagacggtgtagacga 515
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 48.1 bits (24), Expect = 0.029 Identities = 33/36 (91%) Strand = Plus / Minus Query: 431 tggccccgacgatgaagccgatggcgatgggggcga 466 |||| ||||||||||||||| || |||||||||||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 48.1 bits (24), Expect = 0.029 Identities = 78/96 (81%) Strand = Plus / Minus Query: 426 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 485 ||||||||| || |||||||| || ||||| || ||||| ||| | |||||| || | Sbjct: 612 gatgttggctccaacgatgaaaccaatggcaattggggcaatgattccgaggttgcctct 553 Query: 486 cttggggtcggcggcggtggcgtacacggtgtagac 521 |||| ||||| ||| |||||||||||||||||||| Sbjct: 552 cttgtggtcgatggccgtggcgtacacggtgtagac 517
>ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1812 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 877 agatgttggtgaagtcgccgctg 855
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11, complete sequence Length = 169728 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 59831 agatgttggtgaagtcgccgctg 59853
>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05, complete sequence Length = 158601 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 106408 agatgttggtgaagtcgccgctg 106430
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 294 gccggcgaggccaccgccgatga 316 ||||||||||||||||||||||| Sbjct: 505313 gccggcgaggccaccgccgatga 505291 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 gccggcgaggccaccgccga 313 |||||||||||||||||||| Sbjct: 1274146 gccggcgaggccaccgccga 1274165
>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1062 Score = 46.1 bits (23), Expect = 0.11 Identities = 80/99 (80%) Strand = Plus / Minus Query: 425 ggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccct 484 ||||||| || || |||||||| || |||||||| || ||||| || ||||| || | Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554 Query: 485 tcttggggtcggcggcggtggcgtacacggtgtagacga 523 |||||||||| |||| |||||||| |||||| |||||| Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacga 515
>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full insert sequence Length = 1679 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 338 agatgttggtgaagtcgccgctg 360 ||||||||||||||||||||||| Sbjct: 794 agatgttggtgaagtcgccgctg 816
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 366 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 411 |||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 44.1 bits (22), Expect = 0.45 Identities = 40/46 (86%) Strand = Plus / Minus Query: 366 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 411 |||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528
>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip gene) Length = 1101 Score = 44.1 bits (22), Expect = 0.45 Identities = 43/50 (86%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 419 ||||||||||| || || |||||||| ||||| || ||||| |||||||| Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664
>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZB01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 676 Score = 44.1 bits (22), Expect = 0.45 Identities = 82/102 (80%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || | |||||| || ||||| || ||||| | Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | ||||||||||| |||| ||||||| ||||||||||||| Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacga 136
>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2) mRNA, complete cds Length = 1035 Score = 44.1 bits (22), Expect = 0.45 Identities = 82/102 (80%) Strand = Plus / Minus Query: 422 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 481 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactag 562 Query: 482 ccttcttggggtcggcggcggtggcgtacacggtgtagacga 523 | |||||||| || |||| |||||||| ||||||||||||| Sbjct: 561 cgttcttgggatcaacggctgtggcgtagacggtgtagacga 520
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 426 gatgttggccccgacgatgaagccgatggc 455 ||||||||| |||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 426 gatgttggccccgacgatgaagccgatggc 455 ||||||||| |||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>ref|NM_188789.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 639 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 492 gtcggcggcggtggcgtacacggtg 516 ||||||||||| ||||||||||||| Sbjct: 342 gtcggcggcggcggcgtacacggtg 318
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 295 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 339 ||||||| |||||||||| ||| || ||||||||||||| |||| Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661
>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaac 400 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaac 400 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551), mRNA Length = 1556 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 367 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 411 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750
>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence Length = 182756 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 492 gtcggcggcggtggcgtacacggtg 516 ||||||||||| ||||||||||||| Sbjct: 157003 gtcggcggcggcggcgtacacggtg 156979
>emb|BX470264.22| Zebrafish DNA sequence from clone CH211-252F13 in linkage group 7, complete sequence Length = 168673 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 33 ttcacaacatcacattatatt 53 ||||||||||||||||||||| Sbjct: 78807 ttcacaacatcacattatatt 78827
>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein mRNA, partial cds Length = 770 Score = 42.1 bits (21), Expect = 1.8 Identities = 69/85 (81%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 |||||||||||||| || |||||||| || ||| ||| || || || || ||||||| Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425 Query: 386 cagggttcatggaaccgccggagaa 410 |||||||||| || ||||| ||||| Sbjct: 424 cagggttcattgagccgccagagaa 400
>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA, partial cds Length = 684 Score = 42.1 bits (21), Expect = 1.8 Identities = 69/85 (81%) Strand = Plus / Minus Query: 326 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 385 |||||||||||||| || |||||||| || ||| ||| || || || || ||||||| Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338 Query: 386 cagggttcatggaaccgccggagaa 410 |||||||||| || ||||| ||||| Sbjct: 337 cagggttcattgagccgccagagaa 313
>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein Length = 991 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 319 gggccggcccagtagatccag 339 ||||||||||||||||||||| Sbjct: 655 gggccggcccagtagatccag 635
>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7 Length = 349213 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 482 ccttcttggggtcggcggcgg 502 ||||||||||||||||||||| Sbjct: 320884 ccttcttggggtcggcggcgg 320864
>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230090D02 product:aquaporin 6, full insert sequence Length = 2066 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaac 400 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
>dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0034C11 Length = 139399 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 492 gtcggcggcggtggcgtacacggtg 516 ||||||||||| ||||||||||||| Sbjct: 110600 gtcggcggcggcggcgtacacggtg 110576
>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI) mRNA, complete cds Length = 1035 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgtagac 521 |||||||||||||| | || |||||||| ||||||||||| Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagac 536
>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene) Length = 535 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Minus Query: 367 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 411 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490
>gb|AF133533.1|AF133533 Mesembryanthemum crystallinum water channel protein MipL (MipL) mRNA, partial cds Length = 768 Score = 42.1 bits (21), Expect = 1.8 Identities = 36/41 (87%) Strand = Plus / Minus Query: 481 cccttcttggggtcggcggcggtggcgtacacggtgtagac 521 |||||||| ||||| || |||||||| || ||||||||||| Sbjct: 368 cccttctttgggtcagctgcggtggcatagacggtgtagac 328
>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence Length = 2291 Score = 42.1 bits (21), Expect = 1.8 Identities = 39/45 (86%) Strand = Plus / Plus Query: 367 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 411 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271
>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence Length = 182415 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Plus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaac 400 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581
>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA Length = 2066 Score = 42.1 bits (21), Expect = 1.8 Identities = 33/37 (89%) Strand = Plus / Minus Query: 364 acggcggggccgaatgagcgtgcagggttcatggaac 400 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete sequence Length = 146712 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 489 ggggtcggcggcggtggcgt 508 |||||||||||||||||||| Sbjct: 72271 ggggtcggcggcggtggcgt 72290
>ref|NM_020416.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform (PPP2R2C), transcript variant 1, mRNA Length = 4117 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 3856 aaaccccaacaacttcacaa 3837
>ref|NM_181876.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform (PPP2R2C), transcript variant 2, mRNA Length = 4087 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 3826 aaaccccaacaacttcacaa 3807
>gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_B11, complete sequence Length = 162772 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 489 ggggtcggcggcggtggcgt 508 |||||||||||||||||||| Sbjct: 152085 ggggtcggcggcggtggcgt 152104
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence Length = 121598 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 ggcatcatggaaaccaaaca 205 |||||||||||||||||||| Sbjct: 113843 ggcatcatggaaaccaaaca 113824
>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507837.100) partial mRNA Length = 4953 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 447 gccgatggcgatgggggcgatggt 470 ||||||| |||||||||||||||| Sbjct: 4372 gccgatgacgatgggggcgatggt 4395
>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence Length = 138303 Score = 40.1 bits (20), Expect = 7.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 370 gggccgaatgagcgtgcagggttcatggaacc 401 |||||||||||||| || |||||||| ||||| Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913
>gb|AC117212.5| Mus musculus BAC clone RP23-302A24 from chromosome 6, complete sequence Length = 212735 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 57462 aaaccccaacaacttcacaa 57481
>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara) Length = 1398 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097
>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete cds Length = 787 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648
>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma, aquaporin (At2g36830) mRNA, complete cds Length = 1030 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706
>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene Length = 993 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690
>emb|BX640419.1| Bordetella pertussis strain Tohama I, complete genome; segment 9/12 Length = 349672 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 490 gggtcggcggcggtggcgta 509 |||||||||||||||||||| Sbjct: 330461 gggtcggcggcggtggcgta 330480
>gb|BC021735.2| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform, mRNA (cDNA clone IMAGE:4816112) Length = 1172 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 918 aaaccccaacaacttcacaa 899
>gb|BC045682.1| Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform, mRNA (cDNA clone IMAGE:5300526) Length = 2161 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 1900 aaaccccaacaacttcacaa 1881
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 gccggcgaggccaccgccga 313 |||||||||||||||||||| Sbjct: 4535021 gccggcgaggccaccgccga 4535040
>dbj|AK127386.1| Homo sapiens cDNA FLJ45468 fis, clone BRSTN2015788 Length = 1737 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 1499 aaaccccaacaacttcacaa 1480
>gb|AC068733.12| Homo sapiens chromosome 11, clone RP11-304C12, complete sequence Length = 191656 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 16 tctcaaaccccaacaacttcacaa 39 ||||||||||||||| |||||||| Sbjct: 107696 tctcaaaccccaacaccttcacaa 107719
>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence Length = 134151 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407
>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete sequence Length = 222430 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 107 tctgaaccaaacaacatgac 126 |||||||||||||||||||| Sbjct: 111593 tctgaaccaaacaacatgac 111574
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 296 cggcgaggccaccgccgatg 315 |||||||||||||||||||| Sbjct: 1656225 cggcgaggccaccgccgatg 1656206
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 489 ggggtcggcggcggtggcgt 508 |||||||||||||||||||| Sbjct: 12938957 ggggtcggcggcggtggcgt 12938938
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 483 cttcttggggtcggcggcgg 502 |||||||||||||||||||| Sbjct: 10869674 cttcttggggtcggcggcgg 10869655
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 489 ggggtcggcggcggtggcgt 508 |||||||||||||||||||| Sbjct: 25209430 ggggtcggcggcggtggcgt 25209449
>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZE04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 996 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687
>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB42ZA01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1009 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677
>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZD11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 950 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB91ZD10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 975 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693
>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB5ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 904 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB18ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692
>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZC03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 973 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691
>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS84ZH08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 961 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683
>gb|AC084327.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-367K14, complete sequence Length = 108667 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 32732 aaaccccaacaacttcacaa 32713
>gb|AC116317.4| Homo sapiens BAC clone RP11-1406H17 from 4, complete sequence Length = 160943 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 20 aaaccccaacaacttcacaa 39 |||||||||||||||||||| Sbjct: 82311 aaaccccaacaacttcacaa 82330
>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence Length = 1042 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete sequence Length = 90348 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 307 ccgccgatgagcgggccggc 326 |||||||||||||||||||| Sbjct: 7090 ccgccgatgagcgggccggc 7109
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 483 cttcttggggtcggcggcgg 502 |||||||||||||||||||| Sbjct: 93397 cttcttggggtcggcggcgg 93378
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 439 acgatgaagccgatggcgatgggggcga 466 |||||||||||||| |||| |||||||| Sbjct: 4744058 acgatgaagccgatcgcgacgggggcga 4744085
>dbj|AP005400.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0698G06 Length = 138282 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 483 cttcttggggtcggcggcgg 502 |||||||||||||||||||| Sbjct: 9379 cttcttggggtcggcggcgg 9360
>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 1143 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 ||||||||||| | || |||||||||||||||||| Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748
>dbj|AK101995.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033079I19, full insert sequence Length = 1652 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 483 cttcttggggtcggcggcgg 502 |||||||||||||||||||| Sbjct: 101 cttcttggggtcggcggcgg 82
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 caccgccgatgagcgggccg 324 |||||||||||||||||||| Sbjct: 557849 caccgccgatgagcgggccg 557868
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 40.1 bits (20), Expect = 7.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 438 gacgatgaagccgatggcgatggg 461 ||||||| |||||||||||||||| Sbjct: 1047164 gacgatgtagccgatggcgatggg 1047141
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region locus, strain C57BL/6 Length = 2500000 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 107 tctgaaccaaacaacatgac 126 |||||||||||||||||||| Sbjct: 1893522 tctgaaccaaacaacatgac 1893503
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 489 ggggtcggcggcggtggcgt 508 |||||||||||||||||||| Sbjct: 12893231 ggggtcggcggcggtggcgt 12893212
>emb|AL731883.4|CNS08C8N Oryza sativa chromosome 12, . BAC OSJNBa0024B03 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 148110 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 489 ggggtcggcggcggtggcgt 508 |||||||||||||||||||| Sbjct: 129013 ggggtcggcggcggtggcgt 129032
>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene, complete cds Length = 1398 Score = 40.1 bits (20), Expect = 7.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 304 ccaccgccgatgagcgggccggcccagtagatccag 339 |||||||||| ||| || ||||||||||||| |||| Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,559,932 Number of Sequences: 3902068 Number of extensions: 3559932 Number of successful extensions: 79033 Number of sequences better than 10.0: 220 Number of HSP's better than 10.0 without gapping: 223 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 77217 Number of HSP's gapped (non-prelim): 1780 length of query: 523 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 500 effective length of database: 17,143,297,704 effective search space: 8571648852000 effective search space used: 8571648852000 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)