ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd1k08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY827558.1| Trypanosoma congolense procyclin Sav2 mRNA, compl... 44 0.39
2gb|AY827557.1| Trypanosoma congolense procyclin Sav1 mRNA, compl... 44 0.39
3gb|AC115884.9| Mus musculus chromosome 18, clone RP24-396H6, com... 44 0.39
4gb|AC127229.3| Mus musculus BAC clone RP24-553F13 from chromosom... 44 0.39
5gb|AC161874.3| Mus musculus BAC clone RP24-177G20 from chromosom... 44 0.39
6emb|AL023875.2|HS1044O17 Human DNA sequence from clone RP5-1044O... 42 1.5
7gb|AC183287.1| Pan troglodytes chromosome X clone CH251-59K17 ma... 42 1.5
8gb|AY728232.1| Plethodon cinereus mitochondrion, complete genome 40 6.0
9gb|AY377151.1| Gulo gulo cytochrome oxidase subunit I (COX1) gen... 40 6.0
10emb|AL592504.6| Human DNA sequence from clone RP11-320J16 on chr... 40 6.0
11emb|BX248512.14| Zebrafish DNA sequence from clone CH211-284D12 ... 40 6.0
12emb|CT573096.4| RP43-083N14, complete sequence 40 6.0
13emb|CT476806.2| Pan troglodytes chromosome X BAC RP43-032D14, co... 40 6.0
14emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 40 6.0

>gb|AY827558.1| Trypanosoma congolense procyclin Sav2 mRNA, complete cds
          Length = 609

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 352 ctgcatttcaccatatcagtgc 373
           ||||||||||||||||||||||
Sbjct: 506 ctgcatttcaccatatcagtgc 485



to top

>gb|AY827557.1| Trypanosoma congolense procyclin Sav1 mRNA, complete cds
          Length = 659

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 352 ctgcatttcaccatatcagtgc 373
           ||||||||||||||||||||||
Sbjct: 548 ctgcatttcaccatatcagtgc 527



to top

>gb|AC115884.9| Mus musculus chromosome 18, clone RP24-396H6, complete sequence
          Length = 192449

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 145   acctggatgctcgctcctctcaactg 170
             |||||||| |||||||||||||||||
Sbjct: 92702 acctggatcctcgctcctctcaactg 92677



to top

>gb|AC127229.3| Mus musculus BAC clone RP24-553F13 from chromosome 18, complete sequence
          Length = 166995

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 145    acctggatgctcgctcctctcaactg 170
              |||||||| |||||||||||||||||
Sbjct: 154142 acctggatcctcgctcctctcaactg 154117



to top

>gb|AC161874.3| Mus musculus BAC clone RP24-177G20 from chromosome 18, complete
             sequence
          Length = 170891

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 145   acctggatgctcgctcctctcaactg 170
             |||||||| |||||||||||||||||
Sbjct: 36346 acctggatcctcgctcctctcaactg 36321



to top

>emb|AL023875.2|HS1044O17 Human DNA sequence from clone RP5-1044O17 on chromosome Xp11.3-11.4
             Contains the 5' end of a novel gene and a CpG island,
             complete sequence
          Length = 122325

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 219   cacataaccaagccaaaagcc 239
             |||||||||||||||||||||
Sbjct: 38407 cacataaccaagccaaaagcc 38427



to top

>gb|AC183287.1| Pan troglodytes chromosome X clone CH251-59K17 map human ortholog
            p11.4, complete sequence
          Length = 225601

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 219  cacataaccaagccaaaagcc 239
            |||||||||||||||||||||
Sbjct: 6515 cacataaccaagccaaaagcc 6535



to top

>gb|AY728232.1| Plethodon cinereus mitochondrion, complete genome
          Length = 20001

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 42   agccggcattaccatattac 61
            ||||||||||||||||||||
Sbjct: 5817 agccggcattaccatattac 5836



to top

>gb|AY377151.1| Gulo gulo cytochrome oxidase subunit I (COX1) gene, complete cds;
           mitochondrial gene for mitochondrial product
          Length = 1545

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  agccggcattaccatattac 61
           ||||||||||||||||||||
Sbjct: 609 agccggcattaccatattac 628



to top

>emb|AL592504.6| Human DNA sequence from clone RP11-320J16 on chromosome X Contains part
              of a novel gene, complete sequence
          Length = 173828

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 358    ttcaccatatcagtgctgca 377
              ||||||||||||||||||||
Sbjct: 138623 ttcaccatatcagtgctgca 138642



to top

>emb|BX248512.14| Zebrafish DNA sequence from clone CH211-284D12 in linkage group 2,
              complete sequence
          Length = 146757

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 241    gccgttatttacacatgatc 260
              ||||||||||||||||||||
Sbjct: 118415 gccgttatttacacatgatc 118396



to top

>emb|CT573096.4| RP43-083N14, complete sequence
          Length = 169666

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 358    ttcaccatatcagtgctgca 377
              ||||||||||||||||||||
Sbjct: 166529 ttcaccatatcagtgctgca 166510



to top

>emb|CT476806.2| Pan troglodytes chromosome X BAC RP43-032D14, complete sequence
          Length = 145919

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   ttcaccatatcagtgctgca 377
             ||||||||||||||||||||
Sbjct: 45181 ttcaccatatcagtgctgca 45162



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 105    acatataactgagcagcaat 124
              ||||||||||||||||||||
Sbjct: 176679 acatataactgagcagcaat 176660


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,973,590
Number of Sequences: 3902068
Number of extensions: 2973590
Number of successful extensions: 46499
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46471
Number of HSP's gapped (non-prelim): 28
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top