Clone Name | rbasd1j20 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ457980.1|TAE457980 Triticum aestivum mRNA for ferredoxin-NADP(H) oxidoreductase (fnr gene), clone 2 Length = 1092 Score = 161 bits (81), Expect = 2e-36 Identities = 125/139 (89%), Gaps = 1/139 (0%) Strand = Plus / Plus Query: 179 tcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcca 238 ||||||||| || |||||||||||||| |||||||||||||||||||||||||| | ||| Sbjct: 1 tcagtagacttcgacgttccactgctcggccttcttgagctgcttcttgtagtcgatcca 60 Query: 239 gttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatgc 298 || ||| ||||| ||||| |||||||||||||||||||| | | |||||||||||||||| Sbjct: 61 gtcgatcccgtctttggctgcgaggtcgaccatgatgtcgt-cgatgcccttctccatgc 119 Query: 299 ccttaagcccacacatgta 317 |||| ||||| |||||||| Sbjct: 120 ccttgagcccgcacatgta 138
>gb|AY103984.1| Zea mays PCO074888 mRNA sequence Length = 1629 Score = 147 bits (74), Expect = 3e-32 Identities = 124/140 (88%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| || |||||||| ||||| |||||||||||||||||||||||| | || Sbjct: 1348 atcagtagacttcgacgttccattgctcgctcttcttgagctgcttcttgtagtccaacc 1289 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||||||| ||||||||||| |||||||||| ||||||||| | | ||||||||||||||| Sbjct: 1288 agttgatcccgtccttggctgcgaggtcgagcatgatgtcgt-cgatgcccttctccatg 1230 Query: 298 cccttaagcccacacatgta 317 ||||| ||||| |||||||| Sbjct: 1229 cccttgagcccgcacatgta 1210
>dbj|AB035645.1| Zea mays L-FNRII mRNA for ferredoxin, complete cds Length = 1628 Score = 147 bits (74), Expect = 3e-32 Identities = 124/140 (88%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| || |||||||| ||||| |||||||||||||||||||||||| | || Sbjct: 1343 atcagtagacttcgacgttccattgctcgctcttcttgagctgcttcttgtagtccaacc 1284 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||||||| ||||||||||| |||||||||| ||||||||| | | ||||||||||||||| Sbjct: 1283 agttgatcccgtccttggctgcgaggtcgagcatgatgtcgt-cgatgcccttctccatg 1225 Query: 298 cccttaagcccacacatgta 317 ||||| ||||| |||||||| Sbjct: 1224 cccttgagcccgcacatgta 1205
>ref|XM_506676.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1435_F07.32-1 mRNA Length = 1426 Score = 131 bits (66), Expect = 1e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 1246 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 1187 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||| ||||||||| || || |||||||||| ||||||||| | | ||||| ||||||||| Sbjct: 1186 agtcgatgccgtcttttgcagcgaggtcgatcatgatgtcgt-cgatgcctttctccatg 1128 Query: 298 cccttaagcccacacatgta 317 ||||| || || |||||||| Sbjct: 1127 cccttgaggccgcacatgta 1108
>ref|XM_463801.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1315 Score = 131 bits (66), Expect = 1e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 1141 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 1082 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||| ||||||||| || || |||||||||| ||||||||| | | ||||| ||||||||| Sbjct: 1081 agtcgatgccgtcttttgcagcgaggtcgatcatgatgtcgt-cgatgcctttctccatg 1023 Query: 298 cccttaagcccacacatgta 317 ||||| || || |||||||| Sbjct: 1022 cccttgaggccgcacatgta 1003
>ref|XM_463800.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1346 Score = 131 bits (66), Expect = 1e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 1120 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 1061 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||| ||||||||| || || |||||||||| ||||||||| | | ||||| ||||||||| Sbjct: 1060 agtcgatgccgtcttttgcagcgaggtcgatcatgatgtcgt-cgatgcctttctccatg 1002 Query: 298 cccttaagcccacacatgta 317 ||||| || || |||||||| Sbjct: 1001 cccttgaggccgcacatgta 982
>dbj|AK106213.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-208-G10, full insert sequence Length = 1346 Score = 131 bits (66), Expect = 1e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 1120 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 1061 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||| ||||||||| || || |||||||||| ||||||||| | | ||||| ||||||||| Sbjct: 1060 agtcgatgccgtcttttgcagcgaggtcgatcatgatgtcgt-cgatgcctttctccatg 1002 Query: 298 cccttaagcccacacatgta 317 ||||| || || |||||||| Sbjct: 1001 cccttgaggccgcacatgta 982
>dbj|AK065309.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002O13, full insert sequence Length = 1425 Score = 131 bits (66), Expect = 1e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 1245 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 1186 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||| ||||||||| || || |||||||||| ||||||||| | | ||||| ||||||||| Sbjct: 1185 agtcgatgccgtcttttgcagcgaggtcgatcatgatgtcgt-cgatgcctttctccatg 1127 Query: 298 cccttaagcccacacatgta 317 ||||| || || |||||||| Sbjct: 1126 cccttgaggccgcacatgta 1107
>dbj|AK061774.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D02, full insert sequence Length = 1315 Score = 131 bits (66), Expect = 1e-27 Identities = 122/140 (87%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 1141 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 1082 Query: 238 agttgatgccgtccttggcggcgaggtcgaccatgatgtcntacnatgcccttctccatg 297 ||| ||||||||| || || |||||||||| ||||||||| | | ||||| ||||||||| Sbjct: 1081 agtcgatgccgtcttttgcagcgaggtcgatcatgatgtcgt-cgatgcctttctccatg 1023 Query: 298 cccttaagcccacacatgta 317 ||||| || || |||||||| Sbjct: 1022 cccttgaggccgcacatgta 1003
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 83.8 bits (42), Expect = 3e-13 Identities = 63/70 (90%) Strand = Plus / Plus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 183835 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 183894 Query: 238 agttgatgcc 247 ||| |||||| Sbjct: 183895 agtcgatgcc 183904 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Plus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| ||||||||| | | ||||| |||||||||||||| || || |||||||| Sbjct: 183997 gcgaggtcgatcatgatgtcgt-cgatgcctttctccatgcccttgaggccgcacatgta 184055 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 28132456 ccttcttgagctgcttcttg 28132437
>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1435_F07 Length = 139041 Score = 83.8 bits (42), Expect = 3e-13 Identities = 63/70 (90%) Strand = Plus / Plus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagcc 237 |||||||||| ||||| ||||| ||||| | |||||| |||||||||||||||||||||| Sbjct: 132862 atcagtagacttccacattccattgctccgacttcttcagctgcttcttgtagtcaagcc 132921 Query: 238 agttgatgcc 247 ||| |||||| Sbjct: 132922 agtcgatgcc 132931 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Plus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| ||||||||| | | ||||| |||||||||||||| || || |||||||| Sbjct: 133024 gcgaggtcgatcatgatgtcgt-cgatgcctttctccatgcccttgaggccgcacatgta 133082
>gb|M25528.1|CIPFNRA Mesembryanthemum crystallinum ferredoxin-NADP+ reductase precursor, mRNA, complete cds Length = 1419 Score = 69.9 bits (35), Expect = 5e-09 Identities = 50/55 (90%) Strand = Plus / Minus Query: 178 atcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtc 232 |||||||||| |||||||||||||| || |||||||| | ||||||||||||||| Sbjct: 1173 atcagtagacttccacgttccactgttctgccttcttcaactgcttcttgtagtc 1119 Score = 42.1 bits (21), Expect = 1.1 Identities = 27/29 (93%) Strand = Plus / Minus Query: 289 ttctccatgcccttaagcccacacatgta 317 ||||||||||| || |||||||||||||| Sbjct: 1063 ttctccatgcctttcagcccacacatgta 1035
>ref|NM_101857.3| Arabidopsis thaliana oxidoreductase AT1G20020 mRNA, complete cds Length = 1303 Score = 65.9 bits (33), Expect = 7e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 176 tgatcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaag 235 |||||||||||| || |||||||| ||||| |||||||| | |||||||||||| |||| Sbjct: 1159 tgatcagtagacttcaacgttccattgctctgccttcttcaactgcttcttgtaatcaaa 1100 Query: 236 ccagt 240 ||||| Sbjct: 1099 ccagt 1095
>gb|AY114663.1| Arabidopsis thaliana unknown protein (At1g20020) mRNA, complete cds Length = 1181 Score = 65.9 bits (33), Expect = 7e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 176 tgatcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaag 235 |||||||||||| || |||||||| ||||| |||||||| | |||||||||||| |||| Sbjct: 1113 tgatcagtagacttcaacgttccattgctctgccttcttcaactgcttcttgtaatcaaa 1054 Query: 236 ccagt 240 ||||| Sbjct: 1053 ccagt 1049
>gb|AY062739.1| Arabidopsis thaliana Unknown protein (At1g20020; T20H2.20) mRNA, complete cds Length = 1274 Score = 65.9 bits (33), Expect = 7e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 176 tgatcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaag 235 |||||||||||| || |||||||| ||||| |||||||| | |||||||||||| |||| Sbjct: 1131 tgatcagtagacttcaacgttccattgctctgccttcttcaactgcttcttgtaatcaaa 1072 Query: 236 ccagt 240 ||||| Sbjct: 1071 ccagt 1067
>gb|AC022472.2|T20H2 Sequence of BAC T20H2 from Arabidopsis thaliana chromosome 1, complete sequence Length = 92710 Score = 65.9 bits (33), Expect = 7e-08 Identities = 57/65 (87%) Strand = Plus / Plus Query: 176 tgatcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaag 235 |||||||||||| || |||||||| ||||| |||||||| | |||||||||||| |||| Sbjct: 67065 tgatcagtagacttcaacgttccattgctctgccttcttcaactgcttcttgtaatcaaa 67124 Query: 236 ccagt 240 ||||| Sbjct: 67125 ccagt 67129
>emb|BX815757.1|CNS0AEML Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS90ZG11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1007 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 176 tgatcagtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaag 235 ||||||| |||| || |||||||| ||||| |||||||| | |||||||||||| |||| Sbjct: 900 tgatcaggagacttcaacgttccattgctctgccttcttcaactgcttcttgtaatcaaa 841 Query: 236 ccagt 240 ||||| Sbjct: 840 ccagt 836
>emb|AJ457979.1|TAE457979 Triticum aestivum partial mRNA for ferredoxin-NADP(H) oxidoreductase (fnr gene), clone 1 Length = 1062 Score = 56.0 bits (28), Expect = 7e-05 Identities = 31/32 (96%) Strand = Plus / Plus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||||||||| |||||||||||||| Sbjct: 107 cccttctccatgcccttcagcccacacatgta 138
>emb|AJ234899.1|HVU234899 Hordeum vulgare genomic DNA fragment; clone MWG2318.uni Length = 132 Score = 54.0 bits (27), Expect = 3e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 283 atgcccttctccatgcccttaagcccacacatgta 317 |||||||||||||||||||| ||||| |||||||| Sbjct: 14 atgcccttctccatgcccttgagcccgcacatgta 48
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| | ||||||| | | |||||||||||||||||||| || || |||||||| Sbjct: 10124657 gcgaggtcgatcgtgatgtcgt-cgatgcccttctccatgcccttgagaccgcacatgta 10124599 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 217 gctgcttcttgtagtcaagccagttgatgcc 247 |||||||||||||||| ||||||| |||||| Sbjct: 10124810 gctgcttcttgtagtccagccagtcgatgcc 10124780
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| ||||||||| | |||||||||||||||||||| || || |||||||| Sbjct: 8677250 gcgaggtcgatcatgatgtcgc-cgatgcccttctccatgcccttgagaccgcacatgta 8677192 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Plus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 478426 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 478474 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 217 gctgcttcttgtagtcaagccagttgatgcc 247 |||||||||||||||| ||||||| |||||| Sbjct: 8677410 gctgcttcttgtagtccagccagtcgatgcc 8677380 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 478625 cccttctccatgcctttcagtccacacatgta 478656
>dbj|AP004993.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0037N01 Length = 174085 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| ||||||||| | |||||||||||||||||||| || || |||||||| Sbjct: 92232 gcgaggtcgatcatgatgtcgc-cgatgcccttctccatgcccttgagaccgcacatgta 92174 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 217 gctgcttcttgtagtcaagccagttgatgcc 247 |||||||||||||||| ||||||| |||||| Sbjct: 92392 gctgcttcttgtagtccagccagtcgatgcc 92362
>dbj|AP004630.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0031A09 Length = 162511 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| ||||||||| | |||||||||||||||||||| || || |||||||| Sbjct: 152069 gcgaggtcgatcatgatgtcgc-cgatgcccttctccatgcccttgagaccgcacatgta 152011 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 217 gctgcttcttgtagtcaagccagttgatgcc 247 |||||||||||||||| ||||||| |||||| Sbjct: 152229 gctgcttcttgtagtccagccagtcgatgcc 152199
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Minus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| | ||||||| | | |||||||||||||||||||| || || |||||||| Sbjct: 10124542 gcgaggtcgatcgtgatgtcgt-cgatgcccttctccatgcccttgagaccgcacatgta 10124484 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 217 gctgcttcttgtagtcaagccagttgatgcc 247 |||||||||||||||| ||||||| |||||| Sbjct: 10124695 gctgcttcttgtagtccagccagtcgatgcc 10124665
>emb|AL731739.4|CNS08C7O Oryza sativa chromosome 12, . BAC OSJNBa0056I18 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 145890 Score = 52.0 bits (26), Expect = 0.001 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Plus Query: 258 gcgaggtcgaccatgatgtcntacnatgcccttctccatgcccttaagcccacacatgta 317 |||||||||| | ||||||| | | |||||||||||||||||||| || || |||||||| Sbjct: 37964 gcgaggtcgatcgtgatgtcgt-cgatgcccttctccatgcccttgagaccgcacatgta 38022 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Plus Query: 217 gctgcttcttgtagtcaagccagttgatgcc 247 |||||||||||||||| ||||||| |||||| Sbjct: 37811 gctgcttcttgtagtccagccagtcgatgcc 37841
>dbj|AB035644.1| Zea mays L-FNRI mRNA for ferredoxin, complete cds Length = 1380 Score = 52.0 bits (26), Expect = 0.001 Identities = 59/70 (84%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtcaagccagt 240 ||||||||||||| ||||| || || || |||| ||||||||||||||||| | ||||| Sbjct: 1184 agtagacctccacattccattgatctcccctcttcagctgcttcttgtagtcgaaccagt 1125 Query: 241 tgatgccgtc 250 ||| ||||| Sbjct: 1124 cgattccgtc 1115
>ref|NM_185345.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1301 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 1137 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 1089 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 1033 cccttctccatgcctttcagtccacacatgta 1002
>dbj|AP000616.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0514G12 Length = 138929 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Plus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 23934 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 23982 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 24133 cccttctccatgcctttcagtccacacatgta 24164
>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0644B06 Length = 194509 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Plus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 188379 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 188427 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 188578 cccttctccatgcctttcagtccacacatgta 188609
>dbj|AK104865.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-G11, full insert sequence Length = 1301 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 1137 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 1089 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 1033 cccttctccatgcctttcagtccacacatgta 1002
>dbj|AK065063.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001J18, full insert sequence Length = 1361 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 1134 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 1086 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 1030 cccttctccatgcctttcagtccacacatgta 999
>dbj|D17790.1|RICFNADPR0 Oryza sativa (japonica cultivar-group) mRNA for ferredoxin-NADP+ reductase, complete cds Length = 1400 Score = 50.1 bits (25), Expect = 0.004 Identities = 43/49 (87%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgta 229 ||||||| ||||||||||| ||||| ||||||| || ||||||||||| Sbjct: 1168 agtagacttccacgttccattgctcgcccttcttcagttgcttcttgta 1120 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || || ||||||||||| Sbjct: 1064 cccttctccatgcctttcagtccacacatgta 1033
>ref|NM_126017.4| Arabidopsis thaliana oxidoreductase AT5G66190 mRNA, complete cds Length = 1679 Score = 48.1 bits (24), Expect = 0.017 Identities = 30/32 (93%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||| |||||||| ||||||||||| Sbjct: 1127 cccttctccatacccttaagaccacacatgta 1096
>gb|AY096665.1| Arabidopsis thaliana putative ferredoxin-NADP+ reductase (At5g66190) mRNA, complete cds Length = 1114 Score = 48.1 bits (24), Expect = 0.017 Identities = 30/32 (93%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||| |||||||| ||||||||||| Sbjct: 977 cccttctccatacccttaagaccacacatgta 946
>gb|AY072112.1| Arabidopsis thaliana putative ferredoxin-NADP+ reductase (At5g66190) mRNA, complete cds Length = 1374 Score = 48.1 bits (24), Expect = 0.017 Identities = 30/32 (93%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||| |||||||| ||||||||||| Sbjct: 1055 cccttctccatacccttaagaccacacatgta 1024
>emb|AJ243705.1|ATH243705 Arabidopsis thaliana mRNA for ferredoxin-NADP+ reductase precursor (petH gene) Length = 1377 Score = 48.1 bits (24), Expect = 0.017 Identities = 30/32 (93%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||| |||||||| ||||||||||| Sbjct: 1098 cccttctccatacccttaagaccacacatgta 1067
>emb|BX829704.1|CNS09YUL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB30ZA11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1327 Score = 48.1 bits (24), Expect = 0.017 Identities = 30/32 (93%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||| |||||||| ||||||||||| Sbjct: 1118 cccttctccatacccttaagaccacacatgta 1087
>dbj|AB011474.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18 Length = 79899 Score = 48.1 bits (24), Expect = 0.017 Identities = 30/32 (93%) Strand = Plus / Plus Query: 286 cccttctccatgcccttaagcccacacatgta 317 ||||||||||| |||||||| ||||||||||| Sbjct: 67876 cccttctccatacccttaagaccacacatgta 67907
>emb|AJ250378.1|CAN250378 Capsicum annuum mRNA for chloroplast ferredoxin-NADP+ oxidoreductase precursor (fnr gene) Length = 1089 Score = 48.1 bits (24), Expect = 0.017 Identities = 45/52 (86%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtc 232 ||||||| || |||||||| ||||| |||||||| | |||||||||||||| Sbjct: 1087 agtagacttcaacgttccattgctctgccttcttcaattgcttcttgtagtc 1036
>emb|BX831987.1|CNS09YT6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1390 Score = 46.1 bits (23), Expect = 0.068 Identities = 29/31 (93%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgt 316 ||||||||||| |||||||| |||||||||| Sbjct: 1128 cccttctccatacccttaagaccacacatgt 1098
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 44.1 bits (22), Expect = 0.27 Identities = 22/22 (100%) Strand = Plus / Minus Query: 242 gatgccgtccttggcggcgagg 263 |||||||||||||||||||||| Sbjct: 1659047 gatgccgtccttggcggcgagg 1659026
>gb|AC022068.6| Homo sapiens chromosome 8, clone RP11-523C15, complete sequence Length = 202043 Score = 44.1 bits (22), Expect = 0.27 Identities = 22/22 (100%) Strand = Plus / Minus Query: 3 aacaattggtttaacatttgat 24 |||||||||||||||||||||| Sbjct: 36493 aacaattggtttaacatttgat 36472
>gb|DQ377780.1| Pseudomonas mandelii PD 8 nitrous oxide reductase (nosZ), partial cds Length = 591 Score = 44.1 bits (22), Expect = 0.27 Identities = 22/22 (100%) Strand = Plus / Minus Query: 240 ttgatgccgtccttggcggcga 261 |||||||||||||||||||||| Sbjct: 360 ttgatgccgtccttggcggcga 339
>gb|DQ377774.1| Pseudomonas mandelii PD 2 nitrous oxide reductase (nosZ), partial cds Length = 589 Score = 44.1 bits (22), Expect = 0.27 Identities = 22/22 (100%) Strand = Plus / Minus Query: 240 ttgatgccgtccttggcggcga 261 |||||||||||||||||||||| Sbjct: 347 ttgatgccgtccttggcggcga 326
>emb|AL354830.8| Human DNA sequence from clone RP11-193G17 on chromosome 13 Contains the gene for a novel protein similar to prothymosin, complete sequence Length = 152555 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 131 aaacattagcatgcatgtcct 151 ||||||||||||||||||||| Sbjct: 113114 aaacattagcatgcatgtcct 113134
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 247 cgtccttggcggcgaggtcga 267 ||||||||||||||||||||| Sbjct: 3871138 cgtccttggcggcgaggtcga 3871158
>emb|AL122020.5|CNS01DSV Human chromosome 14 DNA sequence BAC C-3035D6 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 149904 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 8 ttggtttaacatttgatgatc 28 ||||||||||||||||||||| Sbjct: 102574 ttggtttaacatttgatgatc 102594
>gb|DQ103454.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7277b allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103453.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7277a allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103452.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7276b allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103451.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7276a allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103450.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7275b allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103449.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7275a allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103448.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7274b allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103447.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7274a allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103446.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7272b allele, partial cds Length = 2619 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2375 ccctgctccatgcccttgagtccacacatgta 2344
>gb|DQ103445.1| Lycopersicon pimpinellifolium putative ferredoxin NADP reductase (CT166) gene, CT166-7272a allele, partial cds Length = 2614 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2370 ccctgctccatgcccttgagtccacacatgta 2339
>gb|DQ103444.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7205b allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103443.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7205a allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103442.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7204b allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103441.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7204a allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103440.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7203b allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103439.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7203a allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103438.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7201b allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103437.1| Lycopersicon chmielewskii putative ferredoxin NADP reductase (CT166) gene, CT166-7201a allele, partial cds Length = 2638 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2400 ccctgctccatgcccttgagtccacacatgta 2369
>gb|DQ103436.1| Solanum ochranthum putative ferredoxin NADP reductase (CT166) gene, partial cds Length = 2577 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2348 ccctgctccatgcccttgagtccacacatgta 2317
>gb|AY377918.1| Prunus armeniaca clone PacD12 microsatellite sequence Length = 421 Score = 40.1 bits (20), Expect = 4.2 Identities = 44/52 (84%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtc 232 ||||||| ||||| ||||| ||||| || ||||| | || |||||||||||| Sbjct: 156 agtagacttccacattccattgctctgctttcttcaacttcttcttgtagtc 105
>ref|XM_467194.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2141 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 275 ccttcttgagctgcttcttg 256
>ref|XM_507519.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1717_A09.34 mRNA Length = 2163 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 275 ccttcttgagctgcttcttg 256
>ref|XM_506897.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1717_A09.34 mRNA Length = 2199 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 333 ccttcttgagctgcttcttg 314
>gb|AY532606.1| Rock bream iridovirus strain RBIV-KOR-TY1 from South Korea, complete genome Length = 112080 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 ccttccatggcaatgacacg 168 |||||||||||||||||||| Sbjct: 11474 ccttccatggcaatgacacg 11455
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 242 gatgccgtccttggcggcgaggtc 265 ||||||||| |||||||||||||| Sbjct: 2497544 gatgccgtcgttggcggcgaggtc 2497567
>gb|BT013070.1| Lycopersicon esculentum clone 114327F, mRNA sequence Length = 1461 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 1212 ccctgctccatgcccttgagtccacacatgta 1181
>emb|AL355581.14| Human DNA sequence from clone RP11-73O6 on chromosome 6 Contains the 3' end of the gene for KIAA1798 protein, a novel genen and the 3' end of a novel gene, complete sequence Length = 140446 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 gtaaaaatgaaaactaggtg 126 |||||||||||||||||||| Sbjct: 68035 gtaaaaatgaaaactaggtg 68054
>emb|Y14032.1|NTY14032 Nicotiana tabacum mRNA for ferredoxin-NADP reductase Length = 1333 Score = 40.1 bits (20), Expect = 4.2 Identities = 44/52 (84%) Strand = Plus / Minus Query: 181 agtagacctccacgttccactgctcagccttcttgagctgcttcttgtagtc 232 ||||||| || || ||||| ||||| |||||||| | |||||||||||||| Sbjct: 1105 agtagacttcaacattccattgctctgccttcttcaattgcttcttgtagtc 1054 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 1001 ccctgctccatgcccttgagtccacacatgta 970
>gb|AY894343.1| Orange-spotted grouper iridovirus, complete genome Length = 112636 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 ccttccatggcaatgacacg 168 |||||||||||||||||||| Sbjct: 11482 ccttccatggcaatgacacg 11463
>gb|AY941715.1| Solanum habrochaites putative ferredoxin-NADP reductase (CT166) gene, CT166-7223b allele, partial cds Length = 2634 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2390 ccctgctccatgcccttgagtccacacatgta 2359
>gb|AY941714.1| Solanum habrochaites putative ferredoxin-NADP reductase (CT166) gene, CT166-7223a allele, partial cds Length = 2634 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2390 ccctgctccatgcccttgagtccacacatgta 2359
>gb|AY941711.1| Solanum habrochaites putative ferredoxin-NADP reductase (CT166) gene, CT166-7216b allele, partial cds Length = 2631 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2387 ccctgctccatgcccttgagtccacacatgta 2356
>gb|AY941707.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7184b allele, partial cds Length = 2645 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2403 ccctgctccatgcccttgagtccacacatgta 2372
>gb|AY941706.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7184a allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941705.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7183b allele, partial cds Length = 2645 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2403 ccctgctccatgcccttgagtccacacatgta 2372
>gb|AY941704.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7183a allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941703.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7180b allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941702.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7180a allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941701.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7179b allele, partial cds Length = 2583 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2339 ccctgctccatgcccttgagtccacacatgta 2308
>gb|AY941700.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7179a allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941699.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7177b allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941698.1| Lycopersicon chilense putative ferredoxin-NADP reductase (CT166) gene, CT166-7177a allele, partial cds Length = 2649 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2405 ccctgctccatgcccttgagtccacacatgta 2374
>gb|AY941697.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7236b allele, partial cds Length = 2637 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2401 ccctgctccatgcccttgagtccacacatgta 2370
>gb|AY941696.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7236a allele, partial cds Length = 2642 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2398 ccctgctccatgcccttgagtccacacatgta 2367
>gb|AY941695.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7234b allele, partial cds Length = 2642 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2398 ccctgctccatgcccttgagtccacacatgta 2367
>gb|AY941694.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7234a allele, partial cds Length = 2646 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2402 ccctgctccatgcccttgagtccacacatgta 2371
>gb|AY941693.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7233b allele, partial cds Length = 2633 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2389 ccctgctccatgcccttgagtccacacatgta 2358
>gb|AY941692.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7233a allele, partial cds Length = 2633 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2389 ccctgctccatgcccttgagtccacacatgta 2358
>gb|AY941691.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7232b allele, partial cds Length = 2634 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2384 ccctgctccatgcccttgagtccacacatgta 2353
>gb|AY941690.1| Lycopersicon peruvianum putative ferredoxin-NADP reductase (CT166) gene, CT166-7232a allele, partial cds Length = 2637 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||| |||||||||||| || ||||||||||| Sbjct: 2401 ccctgctccatgcccttgagtccacacatgta 2370
>gb|AF332093.1|AF332093 White spot syndrome virus, complete genome Length = 305107 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ttcttgagctgcttcttgta 229 |||||||||||||||||||| Sbjct: 54286 ttcttgagctgcttcttgta 54267
>gb|AF369029.2| White spot syndrome virus, complete genome Length = 292967 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ttcttgagctgcttcttgta 229 |||||||||||||||||||| Sbjct: 103238 ttcttgagctgcttcttgta 103219
>gb|AC149900.2| Xenopus tropicalis clone ISB-357K7, complete sequence Length = 87677 Score = 40.1 bits (20), Expect = 4.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 60 ggcgtatatatggccgaagcttgagctt 87 ||||||| | |||||||||||||||||| Sbjct: 64336 ggcgtatttttggccgaagcttgagctt 64309
>dbj|AB119257.1| Danio rerio dcan mRNA for dermacan, complete cds Length = 5614 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 gcttcttgtagtcaagccag 239 |||||||||||||||||||| Sbjct: 2428 gcttcttgtagtcaagccag 2409
>dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1717_A09 Length = 203132 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 122103 ccttcttgagctgcttcttg 122084
>dbj|AK119608.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-F07, full insert sequence Length = 2199 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 333 ccttcttgagctgcttcttg 314
>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome Length = 307287 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ttcttgagctgcttcttgta 229 |||||||||||||||||||| Sbjct: 87867 ttcttgagctgcttcttgta 87848
>dbj|AK100516.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100E07, full insert sequence Length = 2600 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 694 ccttcttgagctgcttcttg 675
>gb|AC154557.2| Mus musculus BAC clone RP23-425M9 from 17, complete sequence Length = 186378 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 197 ccactgctcagccttcttga 216 |||||||||||||||||||| Sbjct: 89630 ccactgctcagccttcttga 89649
>dbj|AK098984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013093E04, full insert sequence Length = 2140 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 274 ccttcttgagctgcttcttg 255
>dbj|AK068513.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013154D06, full insert sequence Length = 2160 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 ccttcttgagctgcttcttg 227 |||||||||||||||||||| Sbjct: 272 ccttcttgagctgcttcttg 253
>gb|AY109747.1| Zea mays CL1192_2 mRNA sequence Length = 1380 Score = 40.1 bits (20), Expect = 4.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 286 cccttctccatgcccttaagcccacacatgta 317 |||||||||||||| || | |||||||||||| Sbjct: 1080 cccttctccatgcctttcaacccacacatgta 1049
>ref|NM_214688.1| Danio rerio chondroitin sulfate proteoglycan 2b (cspg2b), mRNA Length = 5614 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 gcttcttgtagtcaagccag 239 |||||||||||||||||||| Sbjct: 2428 gcttcttgtagtcaagccag 2409
>emb|CT030155.10| Mouse DNA sequence from clone RP23-425N11 on chromosome 17, complete sequence Length = 189713 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 197 ccactgctcagccttcttga 216 |||||||||||||||||||| Sbjct: 123519 ccactgctcagccttcttga 123538 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,140,417 Number of Sequences: 3902068 Number of extensions: 3140417 Number of successful extensions: 62603 Number of sequences better than 10.0: 111 Number of HSP's better than 10.0 without gapping: 113 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 62217 Number of HSP's gapped (non-prelim): 377 length of query: 320 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 298 effective length of database: 17,147,199,772 effective search space: 5109865532056 effective search space used: 5109865532056 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)