ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd1i12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 977 0.0
2emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 700 0.0
3gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 694 0.0
4emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 654 0.0
5gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 654 0.0
6emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 630 e-177
7emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 547 e-152
8emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 452 e-124
9emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 444 e-121
10emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 440 e-120
11gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 391 e-105
12gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 391 e-105
13emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 365 1e-97
14gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 325 1e-85
15gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 240 5e-60
16gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 240 5e-60
17gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 240 5e-60
18emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 240 5e-60
19gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 232 1e-57
20gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 224 3e-55
21gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 224 3e-55
22gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 216 7e-53
23emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 190 4e-45
24emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 176 6e-41
25emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 117 5e-23
26gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 111 3e-21
27dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 111 3e-21
28dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 3e-21
29dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 3e-21
30gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 111 3e-21
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 107 4e-20
32emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 107 4e-20
33dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
34gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 107 4e-20
35emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 107 4e-20
36gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 100 1e-17
37emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 100 1e-17
38dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 1e-17
39dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 1e-17
40emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 100 1e-17
41gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 100 1e-17
42gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 92 3e-15
43gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 92 3e-15
44gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 80 1e-11
45emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 80 1e-11
46emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 80 1e-11
47emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 80 1e-11
48emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 80 1e-11
49dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
50dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 1e-11
51gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 80 1e-11
52gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 78 4e-11
53emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 76 2e-10
54dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 76 2e-10
55dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 76 2e-10
56gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 72 2e-09
57gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 72 2e-09
58gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 72 2e-09
59gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 72 2e-09
60gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 72 2e-09
61gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 2e-09
62gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 72 2e-09
63gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 72 2e-09
64gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 72 2e-09
65gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 72 2e-09
66gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 72 2e-09
67gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 72 2e-09
68gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 72 2e-09
69gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 72 2e-09
70gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 72 2e-09
71gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 72 2e-09
72gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 72 2e-09
73gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 72 2e-09
74gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 72 2e-09
75gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 2e-09
76gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 72 2e-09
77gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 2e-09
78gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 72 2e-09
79gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 2e-09
80gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 72 2e-09
81gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 72 2e-09
82gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 2e-09
83gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 72 2e-09
84gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 2e-09
85dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 1e-08
86dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
87dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
88dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
89dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 4e-08
90gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 64 6e-07
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 64 6e-07
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 64 6e-07
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 64 6e-07
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 64 6e-07
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 64 6e-07
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 64 6e-07
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 64 6e-07
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 64 6e-07
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 64 6e-07
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 64 6e-07
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 64 6e-07
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 64 6e-07
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 64 6e-07
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 64 6e-07
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 64 6e-07
106gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 56 1e-04
107gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 50 0.009
108gb|AC007023.3|AC007023 Homo sapiens clone DJ0635B05, complete se... 46 0.14
109gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta... 44 0.55
110gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, com... 44 0.55
111gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, com... 44 0.55
112gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom... 42 2.2
113emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch... 42 2.2
114dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
115dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
116gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth... 42 2.2
117dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
118dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
119dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
120gb|AY109327.1| Zea mays CL468_1 mRNA sequence 42 2.2
121gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 42 2.2
122gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.6
123ref|XM_638808.1| Dictyostelium discoideum hypothetical protein (... 40 8.6
124ref|XM_628905.1| Dictyostelium discoideum hypothetical protein (... 40 8.6
125gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromo... 40 8.6
126gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CI... 40 8.6
127gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, comp... 40 8.6
128dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130 40 8.6
129gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete... 40 8.6
130dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
131gb|AC127089.4| Homo sapiens BAC clone RP13-590E7 from 4, complet... 40 8.6
132gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041... 40 8.6
133gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, com... 40 8.6
134dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
135dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.6
136dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 8.6
137dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 8.6
138emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 8.6
139gb|AC158526.3| Mus musculus BAC clone RP23-288A9 from chromosome... 40 8.6
140dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen... 40 8.6 
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  977 bits (493), Expect = 0.0
 Identities = 493/493 (100%)
 Strand = Plus / Minus

                                                                        
Query: 142  aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 201
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1454 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 1395

                                                                        
Query: 202  tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 261
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1394 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 1335

                                                                        
Query: 262  gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 321
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 1275

                                                                        
Query: 322  gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 381
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1274 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 1215

                                                                        
Query: 382  gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 441
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1214 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 1155

                                                                        
Query: 442  taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 501
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1154 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 1095

                                                                        
Query: 502  gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 561
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1094 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 1035

                                                                        
Query: 562  gccatttcgatcacaagctagcaatagtagtggtggtgagctaagccggagatgatgaga 621
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1034 gccatttcgatcacaagctagcaatagtagtggtggtgagctaagccggagatgatgaga 975

                         
Query: 622  tagctagatttgc 634
            |||||||||||||
Sbjct: 974  tagctagatttgc 962



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 59/62 (95%), Gaps = 1/62 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1    ttaattataacatncgntacaacagtgtgccggccatgcagngctggctcaacgtacgta 60
            ||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1593 ttaattataacat-cgatacaacagtgtgccggccatgcagagctggctcaacgtacgta 1535

              
Query: 61   ct 62
            ||
Sbjct: 1534 ct 1533



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 40/41 (97%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                     
Query: 83   ccacatggnagataatatatgagagcatttattcatatata 123
            |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1512 ccacatgg-agataatatatgagagcatttattcatatata 1473
to top
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  700 bits (353), Expect = 0.0
 Identities = 413/433 (95%)
 Strand = Plus / Minus

                                                                       
Query: 142 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 201
           ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 439 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagcaagga 380

                                                                       
Query: 202 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 261
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 320

                                                                       
Query: 262 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 321
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 319 gggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccc 260

                                                                       
Query: 322 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 381
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 259 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccg 200

                                                                       
Query: 382 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 441
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 199 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 140

                                                                       
Query: 442 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 501
           ||||| ||||| |||| ||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 139 taggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcg 80

                                                                       
Query: 502 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 561
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||  || 
Sbjct: 79  gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagaacgg 20

                        
Query: 562 gccatttcgatca 574
           |||||||||||||
Sbjct: 19  gccatttcgatca 7



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 40/41 (97%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 83  ccacatggnagataatatatgagagcatttattcatatata 123
           |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 510 ccacatgg-agataatatatgagagcatttattcatatata 471



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 18  tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 62
           |||||||| |||  |||||||||| ||||||||||||||||||||
Sbjct: 571 tacaacagagtgttggccatgcagagctggctcaacgtacgtact 527
to top
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  694 bits (350), Expect = 0.0
 Identities = 458/493 (92%), Gaps = 2/493 (0%)
 Strand = Plus / Minus

                                                                       
Query: 142 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 201
           ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || ||
Sbjct: 510 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagaaacga 451

                                                                       
Query: 202 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 261
            | |||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||
Sbjct: 450 cggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtag 391

                                                                       
Query: 262 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 321
           |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | 
Sbjct: 390 gggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcg 331

                                                                       
Query: 322 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 381
           |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccg 271

                                                                       
Query: 382 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 441
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 270 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 211

                                                                       
Query: 442 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtg 501
           ||||| ||||| |||| ||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 210 taggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcg 151

                                                                       
Query: 502 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcga 561
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||  || 
Sbjct: 150 gctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagaacgg 91

                                                                       
Query: 562 gccatttcgatcacaagctagcaatagtagtggtggtgagctaagccggagatgatgaga 621
           |||||||||||  ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 90  gccatttcgat--caagctagcaatagtagtggtggtgagctaagccgcagatgatgaga 33

                        
Query: 622 tagctagatttgc 634
           |||||||||||||
Sbjct: 32  tagctagatttgc 20



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 92  agataatatatgagagcatttattcatatata 123
           ||||||||||||||| ||||||||||||||||
Sbjct: 571 agataatatatgagatcatttattcatatata 540
to top
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  654 bits (330), Expect = 0.0
 Identities = 354/362 (97%)
 Strand = Plus / Minus

                                                                        
Query: 205  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 264
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967

                                                                        
Query: 265  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 324
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 966  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907

                                                                        
Query: 325  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 384
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 847

                                                                        
Query: 385  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 444
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 846  agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 787

                                                                        
Query: 445  gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 504
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 786  gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagct 727

                                                                        
Query: 505  acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 564
            |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 726  acgatgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 667

              
Query: 565  at 566
            ||
Sbjct: 666  at 665
to top
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  654 bits (330), Expect = 0.0
 Identities = 354/362 (97%)
 Strand = Plus / Minus

                                                                        
Query: 205  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 264
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363

                                                                        
Query: 265  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 324
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303

                                                                        
Query: 325  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 384
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 2243

                                                                        
Query: 385  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 444
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2242 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 2183

                                                                        
Query: 445  gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 504
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2182 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagct 2123

                                                                        
Query: 505  acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 564
            |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2122 acgatgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 2063

              
Query: 565  at 566
            ||
Sbjct: 2062 at 2061
to top
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  630 bits (318), Expect = e-177
 Identities = 351/362 (96%)
 Strand = Plus / Minus

                                                                       
Query: 205 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 264
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362

                                                                       
Query: 265 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 324
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302

                                                                       
Query: 325 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 384
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 242

                                                                       
Query: 385 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 444
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 241 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 182

                                                                       
Query: 445 gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggct 504
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 181 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggct 122

                                                                       
Query: 505 acgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcc 564
           ||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||
Sbjct: 121 acgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagcc 62

             
Query: 565 at 566
           ||
Sbjct: 61  at 60



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 99  atatgagagcatttattcatatata 123
           |||||||||||||||||||||||||
Sbjct: 498 atatgagagcatttattcatatata 474
to top
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  547 bits (276), Expect = e-152
 Identities = 282/284 (99%)
 Strand = Plus / Minus

                                                                       
Query: 327 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 386
           |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 387 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 446
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 447 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 506
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106

                                                                       
Query: 507 gaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 566
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 105 gaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 46

                                                       
Query: 567 ttcgatcacaagctagcaatagtagtggtggtgagctaagccgg 610
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 45  ttcgatcacaagctagcaatagtagtggtggtgagctaagccgg 2
to top
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  452 bits (228), Expect = e-124
 Identities = 384/435 (88%), Gaps = 2/435 (0%)
 Strand = Plus / Minus

                                                                        
Query: 200  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 259
            |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577

                                                                        
Query: 260  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 319
            |||||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517

                                                                        
Query: 320  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 379
            | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 1457

                                                                        
Query: 380  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 439
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1456 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1397

                                                                        
Query: 440  cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 499
            ||||||||||||| ||||||||||||||||||||||||||||| || |  ||||| || |
Sbjct: 1396 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccg 1337

                                                                        
Query: 500  tggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgc 559
            || || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  |
Sbjct: 1336 tgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaac 1277

                                                                        
Query: 560  gagccatttcgatcacaagctagcaatagtagtggtggtgagctaagccggagatgatga 619
            | ||||| |||||  ||||||||||||||||||||| ||||||| || | ||||||||| 
Sbjct: 1276 gggccatctcgat--caagctagcaatagtagtggtagtgagctcaggcagagatgatgg 1219

                           
Query: 620  gatagctagatttgc 634
            |||||||||||||||
Sbjct: 1218 gatagctagatttgc 1204



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 99   atatgagagcatttattcata 119
            |||||||||||||||||||||
Sbjct: 1745 atatgagagcatttattcata 1725
to top
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  444 bits (224), Expect = e-121
 Identities = 383/435 (88%), Gaps = 2/435 (0%)
 Strand = Plus / Minus

                                                                        
Query: 200  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 259
            |||| ||||||||| |||||||| ||||||||||||||||||| |||| |||||||||||
Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565

                                                                        
Query: 260  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 319
            |||||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| 
Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505

                                                                        
Query: 320  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 379
            | |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||
Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagc 1445

                                                                        
Query: 380  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 439
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1444 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1385

                                                                        
Query: 440  cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 499
            ||||||||||||| ||||||||||||||||||||||||||||| || | |||||| || |
Sbjct: 1384 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacggccgcctccg 1325

                                                                        
Query: 500  tggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgc 559
            || || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  |
Sbjct: 1324 tgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaac 1265

                                                                        
Query: 560  gagccatttcgatcacaagctagcaatagtagtggtggtgagctaagccggagatgatga 619
            | ||||| |||||  ||||||||||||||||||||| ||||||| || | ||||||||||
Sbjct: 1264 gggccatctcgat--caagctagcaatagtagtggtagtgagctcaggcagagatgatga 1207

                           
Query: 620  gatagctagatttgc 634
            |||||||||||||||
Sbjct: 1206 gatagctagatttgc 1192



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 99   atatgagagcatttattcatatata 123
            |||||||||||||||||||||||||
Sbjct: 1733 atatgagagcatttattcatatata 1709
to top
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  440 bits (222), Expect = e-120
 Identities = 381/433 (87%), Gaps = 2/433 (0%)
 Strand = Plus / Minus

                                                                       
Query: 200 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 259
           |||| ||||| ||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 433 gatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 374

                                                                       
Query: 260 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 319
           |||||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 373 aggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 314

                                                                       
Query: 320 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 379
           | |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 313 cagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 254

                                                                       
Query: 380 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 439
            ||| || ||| | |||||||||||||||||| ||| |||  |||||||||||||||| |
Sbjct: 253 tggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtg 194

                                                                       
Query: 440 cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 499
           ||||||||||||| ||||||||||||||||||||||||||||| || |  ||||| || |
Sbjct: 193 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccg 134

                                                                       
Query: 500 tggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgc 559
           || || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  |
Sbjct: 133 tgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaac 74

                                                                       
Query: 560 gagccatttcgatcacaagctagcaatagtagtggtggtgagctaagccggagatgatga 619
           | ||||| |||||  ||||||||||||||||||||| ||||||| || | ||||||||||
Sbjct: 73  gggccatctcgat--caagctagcaatagtagtggtagtgagctcaggcagagatgatga 16

                        
Query: 620 gatagctagattt 632
           |||||||||||||
Sbjct: 15  gatagctagattt 3



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 97  atatatgagagcatttattcatatata 123
           |||||||||||||||||||||||||||
Sbjct: 542 atatatgagagcatttattcatatata 516
to top
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 278
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 279 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 338
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 339 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 398
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 399 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 458
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 459 caaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagc 518
           |||||||||||||||||||||||| || | |||||| || |||||| |||||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                        
Query: 519 ggccaccatggcgaccagcacgagctgag 547
           |||||||| |||||| ||||||| |||||
Sbjct: 48  ggccaccacggcgacgagcacgacctgag 20
to top
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  391 bits (197), Expect = e-105
 Identities = 296/329 (89%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 278
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 279 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 338
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 339 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 398
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 399 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 458
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 459 caaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagc 518
           |||||||||||||||||||||||| || | |||||| || |||||| |||||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcatagc 49

                                        
Query: 519 ggccaccatggcgaccagcacgagctgag 547
           |||||||| |||||| ||||||| |||||
Sbjct: 48  ggccaccacggcgacgagcacgacctgag 20
to top
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  365 bits (184), Expect = 1e-97
 Identities = 295/332 (88%)
 Strand = Plus / Minus

                                                                       
Query: 200 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 259
           |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273

                                                                       
Query: 260 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 319
           | |||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213

                                                                       
Query: 320 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 379
           | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 153

                                                                       
Query: 380 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 439
            ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 152 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 93

                                                                       
Query: 440 cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcgg 499
           ||||||||||||| ||||||||||||||||||||||||||||| || |  ||||| || |
Sbjct: 92  cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacagccgcctccg 33

                                           
Query: 500 tggctacgaggagcatagcggccaccatggcg 531
           || || ||||||||||||| ||||||| ||||
Sbjct: 32  tgactgcgaggagcatagcagccaccacggcg 1



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 99  atatgagagcatttattcatatata 123
           |||||||||||||||||||||||||
Sbjct: 437 atatgagagcatttattcatatata 413
to top
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  325 bits (164), Expect = 1e-85
 Identities = 302/348 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 278
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 279 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 338
           | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 339 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 398
           ||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 399 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 458
            |||||||||||| |||| ||  ||| |||| ||||||| |||||||||||||| |||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 459 caaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagc 518
           |||||||||||||||||| || |||||||| || ||||| ||||||  ||||| ||| ||
Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtctgtggctgtgaggaccattgc 49

                                                           
Query: 519 ggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 566
            ||||| | || || || |||||| |||| ||||||||| || |||||
Sbjct: 48  tgccacgagggtgaacaacacgagttgagcagctgcagcacgggccat 1
to top
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  240 bits (121), Expect = 5e-60
 Identities = 298/357 (83%)
 Strand = Plus / Minus

                                                                        
Query: 215  tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 274
            |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149

                                                                        
Query: 275  cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 334
            ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089

                                                                        
Query: 335  tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 394
            ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 3029

                                                                        
Query: 395  cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 454
            | |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||| |
Sbjct: 3028 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 2969

                                                                        
Query: 455  ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 514
             |  || ||||||| ||||||||||||||||||| |||||||||| |||||| |||||||
Sbjct: 2968 aggccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagca 2909

                                                                     
Query: 515  tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 571
            | || ||||||| |||||||||||||||||  || ||||||| ||||||||| ||||
Sbjct: 2908 ttgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatctcga 2852



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                         
Query: 18   tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 62
            |||||||||| |||||| |||||| |||||||| |||||||||||
Sbjct: 3392 tacaacagtg-gccggctatgcagagctggctcgacgtacgtact 3349
to top
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  240 bits (121), Expect = 5e-60
 Identities = 298/357 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 274
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 372

                                                                       
Query: 275 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 334
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 371 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 312

                                                                       
Query: 335 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 394
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 311 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 252

                                                                       
Query: 395 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 454
           ||||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || ||| |
Sbjct: 251 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 192

                                                                       
Query: 455 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 514
           || ||||||||||||||||||| ||||||  |||||||||||||| |||| |||||| ||
Sbjct: 191 gggtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatca 132

                                                                    
Query: 515 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 571
           | || ||||||| ||||||||||||||||| ||||||||||| ||||||||| ||||
Sbjct: 131 ttgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatctcga 75
to top
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  240 bits (121), Expect = 5e-60
 Identities = 298/357 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 274
           |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353

                                                                       
Query: 275 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 334
           ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293

                                                                       
Query: 335 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 394
           ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 233

                                                                       
Query: 395 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 454
           | |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||| |
Sbjct: 232 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 173

                                                                       
Query: 455 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 514
            |  || ||||||| ||||||||||||||||||| |||||||||| |||||| |||||||
Sbjct: 172 aggccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagca 113

                                                                    
Query: 515 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 571
           | || ||||||| |||||||||||||||||  || ||||||| ||||||||| ||||
Sbjct: 112 ttgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatctcga 56



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 18  tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 62
           |||||||||| |||||| |||||| |||||||| |||||||||||
Sbjct: 596 tacaacagtg-gccggctatgcagagctggctcgacgtacgtact 553
to top
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  240 bits (121), Expect = 5e-60
 Identities = 298/357 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 274
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 313

                                                                       
Query: 275 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 334
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 312 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 253

                                                                       
Query: 335 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 394
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 252 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 193

                                                                       
Query: 395 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 454
           ||||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || ||| |
Sbjct: 192 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 133

                                                                       
Query: 455 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 514
           || ||||||||||||||||||| ||||||  |||||||||||||| |||| |||||| ||
Sbjct: 132 gggtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatca 73

                                                                    
Query: 515 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 571
           | || ||||||| ||||||||||||||||| ||||||||||| ||||||||| ||||
Sbjct: 72  ttgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatctcga 16
to top
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  232 bits (117), Expect = 1e-57
 Identities = 285/341 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 285
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 286 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 345
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 346 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 405
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 406 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 465
           |||||| |||||||  |||| ||| ||||    || ||||||| ||| | |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 466 gagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagcggccacc 525
           ||| ||||||||||||||||||| |||||||||| |||||| |||||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                    
Query: 526 atggcgaccagcacgagctgagtagctgcagcgcgagccat 566
           | |||||||||||||||||  || ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagctttgttgctgcagtgcgagccat 1
to top
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  224 bits (113), Expect = 3e-55
 Identities = 260/309 (84%)
 Strand = Plus / Minus

                                                                       
Query: 258 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 317
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 318 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 377
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||   ||||  ||  
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 378 gccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcg 437
           |||||||| |||| |||||||||||||||||||| ||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 438 ggcataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtc 497
            |||||||| | ||| ||||  | ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70

                                                                       
Query: 498 ggtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagc 557
           || |||||| ||||| |  || ||||||| ||||||||||||||||| |||||||| || 
Sbjct: 69  ggaggctacaaggaggagtgccgccaccagggcgaccagcacgagcttagtagctgtagt 10

                    
Query: 558 gcgagccat 566
           |||||||||
Sbjct: 9   gcgagccat 1
to top
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  224 bits (113), Expect = 3e-55
 Identities = 284/341 (83%)
 Strand = Plus / Minus

                                                                       
Query: 226 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 285
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 286 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 345
           || || || |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 346 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 405
           |  ||||||||||| ||||||||| | |||  |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                                                                       
Query: 406 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 465
           |||||| ||| |||  |||  ||| ||||    ||||||| || ||| ||| ||||||||
Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102

                                                                       
Query: 466 gagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagcggccacc 525
           ||||||||||| ||||||  |||||||||||||| |||| |||||| ||| || ||||||
Sbjct: 101 gagctcacctggccgcagctgatggccgcgtcggaggctgcgaggatcattgccgccacc 42

                                                    
Query: 526 atggcgaccagcacgagctgagtagctgcagcgcgagccat 566
           | ||||||||||||||| | ||||||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagtttagtagctgcagtgcgagccat 1
to top
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  216 bits (109), Expect = 7e-53
 Identities = 283/341 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 285
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 286 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 345
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 346 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 405
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 406 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 465
           |||||| |||||||  |||| ||| ||||    || ||||||| ||| | |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 466 gagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagcatagcggccacc 525
           ||| ||||||||||||||| ||| |||||||||| |||||| |||||||| || ||||||
Sbjct: 101 gagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcattgccgccacc 42

                                                    
Query: 526 atggcgaccagcacgagctgagtagctgcagcgcgagccat 566
           | |||||||||||||||||  || ||||||| |||||||||
Sbjct: 41  agggcgaccagcacgagctttgttgctgcagtgcgagccat 1
to top
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  190 bits (96), Expect = 4e-45
 Identities = 288/352 (81%)
 Strand = Plus / Minus

                                                                       
Query: 215 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 274
           |||||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||
Sbjct: 354 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgc 295

                                                                       
Query: 275 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 334
           ||||| |||||||||| || |||||| |||| |||||   | | || ||  | |||||||
Sbjct: 294 cgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttga 235

                                                                       
Query: 335 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 394
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 234 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 175

                                                                       
Query: 395 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 454
           | ||||| |||||| || |||  ||  ||| |||| ||||    || |||| |  ||| |
Sbjct: 174 ctccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagg 115

                                                                       
Query: 455 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 514
           ||| |||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||
Sbjct: 114 ggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgaggagca 55

                                                               
Query: 515 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 566
           | || ||||||| |||||||||| ||||||  || ||||||| |||||||||
Sbjct: 54  ttgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccat 3
to top
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  176 bits (89), Expect = 6e-41
 Identities = 290/357 (81%)
 Strand = Plus / Minus

                                                                       
Query: 215 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 274
           |||||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |
Sbjct: 425 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccc 366

                                                                       
Query: 275 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 334
           ||||| |||||||||| || |||||| | || |||||   | | || ||  | |||||||
Sbjct: 365 cgcacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttga 306

                                                                       
Query: 335 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 394
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 305 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 246

                                                                       
Query: 395 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 454
           | ||||| |||||| || |||  ||  ||| |||| ||||    || |||| |  ||| |
Sbjct: 245 ctccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagg 186

                                                                       
Query: 455 ggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagca 514
           ||| |||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||
Sbjct: 185 ggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgaggagca 126

                                                                    
Query: 515 tagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 571
           | || ||||||| |||||||||| ||||||  || ||||||| ||||||||| ||||
Sbjct: 125 ttgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccatctcga 69
to top
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  117 bits (59), Expect = 5e-23
 Identities = 168/203 (82%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 206 agcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggga 265
           |||| ||| |||||||| | |||||||||||||||||    |||||||| | ||||||||
Sbjct: 431 agcacgtgttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtagggga 372

                                                                       
Query: 266 cgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcag 325
           |||||||||||||| |||||||||| || |||||| |||| |||||   | | || ||| 
Sbjct: 371 cgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca- 313

                                                                       
Query: 326 cgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcca 385
           | ||||||| |||| ||||||  ||||||||||| ||||||||| | |||  ||||||||
Sbjct: 312 cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggcca 253

                                  
Query: 386 gtctcttgacgccgctgcagcag 408
            ||||||||| ||||| ||||||
Sbjct: 252 atctcttgactccgctacagcag 230



 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 101/118 (85%), Gaps = 2/118 (1%)
 Strand = Plus / Minus

                                                                       
Query: 454 gggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgaggagc 513
           |||| |||||||||||||||||| ||||||| ||||  |||||||| |||||||||||||
Sbjct: 185 gggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgaggagc 128

                                                                     
Query: 514 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 571
           || || ||||||| ||  |||||| ||||||  || ||||||| ||||||||| ||||
Sbjct: 127 attgccgccaccaggggcaccagcgcgagcttggttgctgcagtgcgagccatctcga 70
to top
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                         
Query: 230   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 289
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 290   ttccggcggccttgccagcgtttagccc 317
             | | |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 230      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 289
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 290      ttccggcggccttgccagcgtttagccc 317
                | | |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 292    ccggcggccttgccagcgtttagccc 317
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 292    ccggcggccttgccagcgtt 311
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 292    ccggcg 297
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 392    tgacgccgctgcagcaggcc 411
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576
to top
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 230 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 289
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 290 ttccggcggccttgccagcgtttagccc 317
           | | |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
to top
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 230 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 289
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 290 ttccggcggccttgccagcgtttagccc 317
           | | |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 230      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 289
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 290      ttccggcggccttgccagcgtttagccc 317
                | | |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 292    ccggcggccttgccagcgtttagccc 317
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 292    ccggcggccttgccagcgtt 311
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 292    ccggcg 297
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 392    tgacgccgctgcagcaggcc 411
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 292    ccggcggccttgccagcgtttagccc 317
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 292    ccggcggccttgccagcgtt 311
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 292    ccggcg 297
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 392    tgacgccgctgcagcaggcc 411
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428
to top
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 292    ccggcggccttgccagcgtttagccc 317
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 292    ccggcggccttgccagcgtt 311
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 232    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 292    ccggcg 297
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 392    tgacgccgctgcagcaggcc 411
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428
to top
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  107 bits (54), Expect = 4e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 292   ccggcggccttgccagcgtttagccc 317
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 292   ccggcggccttgccagcgtt 311
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 292   ccggcg 297
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 392   tgacgccgctgcagcaggcc 411
             ||||||||||||||||||||
Sbjct: 46687 tgacgccgctgcagcaggcc 46706
to top
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
to top
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                        
Query: 232  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 292  ccggcggccttgccagcgtttagccc 317
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
to top
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
to top
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 292   ccggcggccttgccagcgtttagccc 317
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 292   ccggcggccttgccagcgtt 311
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 292   ccggcg 297
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 392   tgacgccgctgcagcaggcc 411
             ||||||||||||||||||||
Sbjct: 50377 tgacgccgctgcagcaggcc 50396
to top
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288
to top
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 77/86 (89%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||| 
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 292 ccggcggccttgccagcgtttagccc 317
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 300 tgacgccgctgcagcaggcc 281
to top
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 532 tgacgccgctgcagcaggcc 513
to top
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 466 gagctcacctgaccgcaggagatggccgc 494
           ||||||||||| |||||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggccgc 26
to top
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 466 gagctcacctgaccgcaggagatggccgc 494
           ||||||||||| |||||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggccgc 726
to top
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 162 tgacgccgctgcagcaggcc 143
to top
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 485 tgacgccgctgcagcaggcc 466
to top
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 268 tgacgccgctgcagcaggcc 249
to top
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 250 tgacgccgctgcagcaggcc 231
to top
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 244 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttg 303
           |||| |||||||| |||||||| ||||||||||||| |||||||||| | |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                      
Query: 304 ccagcgtttag 314
           || ||||||||
Sbjct: 265 ccggcgtttag 255



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 168 tgacgccgctgcagcaggcc 149
to top
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 292 ccggcggccttgcc 305
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                            
Query: 232      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 292      ccggcg 297
                ||||||
Sbjct: 14437004 ccggcg 14436999
to top
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 232   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 292   ccggcg 297
             ||||||
Sbjct: 45502 ccggcg 45497
to top
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344
to top
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254
to top
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 388 ctcttgacgccgctgcagcag 408
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140
to top
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 388 ctcttgacgccgctgcagcag 408
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140
to top
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355
to top
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 388 ctcttgacgccgctgcagcag 408
           |||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagcag 266
to top
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335
to top
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 249 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagc 308
           |||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 309 gtt 311
           |||
Sbjct: 157 gtt 159



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 249 tgacgccgctgcagcaggcc 268
to top
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 292 ccggcg 297
           ||||||
Sbjct: 370 ccggcg 365
to top
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 232  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 292  ccggcg 297
            ||||||
Sbjct: 3456 ccggcg 3451
to top
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 292 ccggcg 297
           ||||||
Sbjct: 372 ccggcg 367
to top
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 292 ccggcg 297
           ||||||
Sbjct: 374 ccggcg 369
to top
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 374 ctggcggc 367
to top
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||| 
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 392 tgacgccgctgcagcaggcc 411
           ||||||||||||||||||||
Sbjct: 245 tgacgccgctgcagcaggcc 226
to top
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| || 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 356 ctggcggc 349
to top
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 281 ctggcggc 274
to top
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 380 ctggcggc 373
to top
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 395 ctggcggc 388
to top
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 292 ccggcggccttgccagcgtt 311
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 204 ctggcggc 197
to top
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 391 ctggcggc 384
to top
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 291
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||| 
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 292 ccggcggc 299
           | ||||||
Sbjct: 259 ctggcggc 252
to top
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 249  gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 297
            ||||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
to top
>gb|AC007023.3|AC007023 Homo sapiens clone DJ0635B05, complete sequence
          Length = 148454

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 577   agctagcaatagtagtggtggtg 599
             |||||||||||||||||||||||
Sbjct: 24018 agctagcaatagtagtggtggtg 23996
to top
>gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta 1b, mRNA (cDNA
           clone IMAGE:4504353), partial cds
          Length = 4763

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 395 cgccgctgcagcaggccacagg 416
           ||||||||||||||||||||||
Sbjct: 367 cgccgctgcagcaggccacagg 388
to top
>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence
          Length = 43869

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 395   cgccgctgcagcaggccacagg 416
             ||||||||||||||||||||||
Sbjct: 43282 cgccgctgcagcaggccacagg 43303
to top
>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence
          Length = 199824

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 395   cgccgctgcagcaggccacagg 416
             ||||||||||||||||||||||
Sbjct: 52943 cgccgctgcagcaggccacagg 52964
to top
>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete
             sequence
          Length = 171538

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 457   ctcaaggcagagctcacctgaccgc 481
             |||||||||||| ||||||||||||
Sbjct: 24731 ctcaaggcagagatcacctgaccgc 24755
to top
>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the 3'
              end of the PRKCZ gene for protein kinase C zeta, a novel
              gene, a novel gene (FLJ31031), the SKI gene for v-ski
              sarcoma viral oncogene homolog (avian) and five CpG
              islands, complete sequence
          Length = 179836

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 464    cagagctcacctgaccgcagg 484
              |||||||||||||||||||||
Sbjct: 113726 cagagctcacctgaccgcagg 113706
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 393      gacgccgctgcagcaggccac 413
                |||||||||||||||||||||
Sbjct: 41554621 gacgccgctgcagcaggccac 41554641
to top
>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0614D08
          Length = 147548

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 393    gacgccgctgcagcaggccac 413
              |||||||||||||||||||||
Sbjct: 110914 gacgccgctgcagcaggccac 110934
to top
>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 482  aggagatggccgcgtcggtgg 502
            |||||||||||||||||||||
Sbjct: 1709 aggagatggccgcgtcggtgg 1729
to top
>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0660F12
          Length = 147203

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 393    gacgccgctgcagcaggccac 413
              |||||||||||||||||||||
Sbjct: 122820 gacgccgctgcagcaggccac 122840
to top
>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 226 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 278
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 226 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 278
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 388  ctcttgacgccgctgcagcag 408
            |||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagcag 2785
to top
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 388 ctcttgacgccgctgcagcag 408
           |||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagcag 135
to top
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 518    cggccaccatggcgaccagc 537
              ||||||||||||||||||||
Sbjct: 608556 cggccaccatggcgaccagc 608575
to top
>ref|XM_638808.1| Dictyostelium discoideum hypothetical protein (DDB0167912), partial
           mRNA
          Length = 1989

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 580 tagcaatagtagtggtggtg 599
           ||||||||||||||||||||
Sbjct: 117 tagcaatagtagtggtggtg 136
to top
>ref|XM_628905.1| Dictyostelium discoideum hypothetical protein (DDB0219917), partial
            mRNA
          Length = 2928

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 580  tagcaatagtagtggtggtg 599
            ||||||||||||||||||||
Sbjct: 1005 tagcaatagtagtggtggtg 1024
to top
>gb|AC183388.3| Pan troglodytes BAC clone CH251-53D20 from chromosome 16, complete
              sequence
          Length = 161327

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 578    gctagcaatagtagtggtgg 597
              ||||||||||||||||||||
Sbjct: 153458 gctagcaatagtagtggtgg 153439
to top
>gb|AC002288.1|HUAC002288 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-249B10, complete sequence
          Length = 213633

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 578    gctagcaatagtagtggtgg 597
              ||||||||||||||||||||
Sbjct: 182524 gctagcaatagtagtggtgg 182505
to top
>gb|AC130451.2| Homo sapiens chromosome 16 clone CTA-249B10, complete sequence
          Length = 215866

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 578   gctagcaatagtagtggtgg 597
             ||||||||||||||||||||
Sbjct: 30167 gctagcaatagtagtggtgg 30186
to top
>dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130
          Length = 3692

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 194  agcaaggatgacagcaagtg 213
            ||||||||||||||||||||
Sbjct: 1826 agcaaggatgacagcaagtg 1807
to top
>gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete sequence
          Length = 109398

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 194    agcaaggatgacagcaagtg 213
              ||||||||||||||||||||
Sbjct: 100675 agcaaggatgacagcaagtg 100694
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 355      ttgtcagcggtgctctgggc 374
                ||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggc 11569482
to top
>gb|AC127089.4| Homo sapiens BAC clone RP13-590E7 from 4, complete sequence
          Length = 25804

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 578   gctagcaatagtagtggtgg 597
             ||||||||||||||||||||
Sbjct: 15879 gctagcaatagtagtggtgg 15898
to top
>gb|AC116986.2| Dictyostelium discoideum chromosome 2 map 2234041-2567370 strain AX4,
              complete sequence
          Length = 333321

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 580    tagcaatagtagtggtggtg 599
              ||||||||||||||||||||
Sbjct: 267625 tagcaatagtagtggtggtg 267644
to top
>gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, complete sequence
          Length = 206852

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   agcaaggatgacagcaagtg 213
             ||||||||||||||||||||
Sbjct: 90670 agcaaggatgacagcaagtg 90651
to top
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 355    ttgtcagcggtgctctgggc 374
              ||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggc 123616
to top
>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 355   ttgtcagcggtgctctgggc 374
             ||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggc 29753
to top
>dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-591J4, complete
             sequence
          Length = 211750

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   agcaaggatgacagcaagtg 213
             ||||||||||||||||||||
Sbjct: 90149 agcaaggatgacagcaagtg 90168
to top
>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete
              sequence
          Length = 156583

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 194    agcaaggatgacagcaagtg 213
              ||||||||||||||||||||
Sbjct: 142238 agcaaggatgacagcaagtg 142257
to top
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 482    aggagatggccgcgtcggtg 501
              ||||||||||||||||||||
Sbjct: 201635 aggagatggccgcgtcggtg 201616
to top
>gb|AC158526.3| Mus musculus BAC clone RP23-288A9 from chromosome 12, complete sequence
          Length = 236362

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 580    tagcaatagtagtggtggtg 599
              ||||||||||||||||||||
Sbjct: 163843 tagcaatagtagtggtggtg 163824
to top
>dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 6/19
          Length = 100000

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   agcaaggatgacagcaagtg 213
             ||||||||||||||||||||
Sbjct: 19820 agcaaggatgacagcaagtg 19801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,581,835
Number of Sequences: 3902068
Number of extensions: 3581835
Number of successful extensions: 58780
Number of sequences better than 10.0: 140
Number of HSP's better than 10.0 without gapping: 142
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58151
Number of HSP's gapped (non-prelim): 615
length of query: 634
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 611
effective length of database: 17,143,297,704
effective search space: 10474554897144
effective search space used: 10474554897144
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top