ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd1g10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC072865.1| Xenopus laevis MGC80271 protein, mRNA (cDNA clone... 460 e-126
2gb|BC076714.1| Xenopus tropicalis SWI/SNF related, matrix associ... 410 e-111
3ref|NM_001006818.1| Xenopus tropicalis SWI/SNF related, matrix a... 410 e-111
4ref|XM_515023.1| PREDICTED: Pan troglodytes similar to SWI/SNF r... 44 0.38
5gb|DQ230988.1| Homo sapiens SWI/SNF related, matrix associated, ... 44 0.38
6ref|NM_003073.3| Homo sapiens SWI/SNF related, matrix associated... 44 0.38
7ref|NM_001007468.1| Homo sapiens SWI/SNF related, matrix associa... 44 0.38
8ref|XM_852298.1| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
9ref|XM_852254.1| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
10ref|XM_852215.1| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
11ref|XM_852177.1| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
12ref|XM_852136.1| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
13ref|XM_543533.2| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
14ref|XM_843721.1| PREDICTED: Canis familiaris similar to SWI/SNF ... 44 0.38
15emb|CR626732.1| full-length cDNA clone CS0DA005YC17 of Neuroblas... 44 0.38
16emb|CR625707.1| full-length cDNA clone CS0DA011YE11 of Neuroblas... 44 0.38
17emb|CR625181.1| full-length cDNA clone CS0DI071YB16 of Placenta ... 44 0.38
18emb|CR624865.1| full-length cDNA clone CS0DI016YN24 of Placenta ... 44 0.38
19emb|CR621760.1| full-length cDNA clone CS0DI030YN10 of Placenta ... 44 0.38
20emb|CR620956.1| full-length cDNA clone CS0DF004YC19 of Fetal bra... 44 0.38
21emb|CR621090.1| full-length cDNA clone CS0DD001YJ18 of Neuroblas... 44 0.38
22emb|CR621083.1| full-length cDNA clone CS0DI057YI07 of Placenta ... 44 0.38
23emb|CR619411.1| full-length cDNA clone CS0DI042YG07 of Placenta ... 44 0.38
24emb|CR619336.1| full-length cDNA clone CS0DI030YM09 of Placenta ... 44 0.38
25emb|CR617530.1| full-length cDNA clone CS0DG001YP09 of B cells (... 44 0.38
26emb|CR601509.1| full-length cDNA clone CS0DI080YF20 of Placenta ... 44 0.38
27emb|CR600940.1| full-length cDNA clone CS0DI022YN22 of Placenta ... 44 0.38
28emb|CR600743.1| full-length cDNA clone CS0DE008YC21 of Placenta ... 44 0.38
29emb|CR599485.1| full-length cDNA clone CS0DC029YF01 of Neuroblas... 44 0.38
30emb|CR595672.1| full-length cDNA clone CS0DB003YC16 of Neuroblas... 44 0.38
31emb|CR594771.1| full-length cDNA clone CS0DF006YK20 of Fetal bra... 44 0.38
32dbj|AK024025.1| Homo sapiens cDNA FLJ13963 fis, clone Y79AA10012... 44 0.38
33emb|CR590517.1| full-length cDNA clone CS0DB001YE08 of Neuroblas... 44 0.38
34emb|CR590397.1| full-length cDNA clone CS0DC023YL08 of Neuroblas... 44 0.38
35dbj|AK021419.1| Homo sapiens cDNA FLJ11357 fis, clone HEMBA10002... 44 0.38
36emb|AJ011738.1|HSA011738 Homo sapiens mRNA for integrase interac... 44 0.38
37emb|AJ011737.1|HSA011737 Homo sapiens mRNA for integrase interac... 44 0.38
38emb|CR456581.1| Homo sapiens SMARCB1 full length open reading fr... 44 0.38
39emb|AL389881.1|HST000264 Homo sapiens mRNA full length insert cD... 44 0.38
40dbj|AP000350.1| Homo sapiens genomic DNA, chromosome 22q11.2, cl... 44 0.38
41gb|AC164883.5| Mus musculus BAC clone RP23-88A20 from chromosome... 40 5.9
42gb|AC166643.7| Mus musculus chromosome 18, clone RP24-241J8, com... 40 5.9
43ref|XM_543025.1| PREDICTED: Canis familiaris similar to Zinc fin... 40 5.9
44emb|AL139818.15| Human DNA sequence from clone RP11-311B18 on ch... 40 5.9
45gb|AC090505.10| Homo sapiens 3 BAC RP11-152D21 (Roswell Park Can... 40 5.9
46gb|AF371465.1|AF371465 Pirital virus strain 3367 nucleoprotein (... 40 5.9
47gb|AF371447.1|AF371447 Pirital virus strain 2148 nucleoprotein (... 40 5.9
48dbj|AK045383.1| Mus musculus adult male corpora quadrigemina cDN... 40 5.9
49gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 5.9 
>gb|BC072865.1| Xenopus laevis MGC80271 protein, mRNA (cDNA clone MGC:80271
            IMAGE:5073295), complete cds
          Length = 1605

 Score =  460 bits (232), Expect = e-126
 Identities = 239/240 (99%), Gaps = 1/240 (0%)
 Strand = Plus / Minus

                                                                        
Query: 41   gctttacagcattacgttcacaggtataaaggagggcttgggacatctgtctcaggtctt 100
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1503 gctttacag-attacgttcacaggtataaaggagggcttgggacatctgtctcaggtctt 1445

                                                                        
Query: 101  ccggtagtcaggtagcactaatgcgtcactctctgtacatggaaggaggggtttgaagga 160
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1444 ccggtagtcaggtagcactaatgcgtcactctctgtacatggaaggaggggtttgaagga 1385

                                                                        
Query: 161  gccaaactcagcagcaccctgctgcttagaatgtggaatgtttgggtgccccgctccctc 220
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1384 gccaaactcagcagcaccctgctgcttagaatgtggaatgtttgggtgccccgctccctc 1325

                                                                        
Query: 221  tgaaatggactcaggaggtgctgggaccaccgtcctctccttcaaaatgtttaattagaa 280
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1324 tgaaatggactcaggaggtgctgggaccaccgtcctctccttcaaaatgtttaattagaa 1265



 Score =  216 bits (109), Expect = 5e-53
 Identities = 124/131 (94%)
 Strand = Plus / Minus

                                                                        
Query: 306  agaatcgttacattgtgtcatttatggggaggggttccatctccaggatgtgaaccgtga 365
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1239 agaatcgttacattgtgtcatttatggggaggggttccatctccaggatgtgaaccgtga 1180

                                                                        
Query: 366  gtttcgtcngnagggggctgtttaccaggccggtgcantgttggcaagacgtntnatacc 425
            |||||||| | |||||||||||||||||||||||||| |||||||||||||| | |||| 
Sbjct: 1179 gtttcgtcgggagggggctgtttaccaggccggtgcagtgttggcaagacgtctcatacg 1120

                       
Query: 426  cctngtgttcc 436
            ||| |||||||
Sbjct: 1119 cctggtgttcc 1109
to top
>gb|BC076714.1| Xenopus tropicalis SWI/SNF related, matrix associated, actin
            dependent regulator of chromatin, subfamily b, member 1,
            mRNA (cDNA clone MGC:79836 IMAGE:6987293), complete cds
          Length = 1602

 Score =  410 bits (207), Expect = e-111
 Identities = 229/235 (97%), Gaps = 1/235 (0%)
 Strand = Plus / Minus

                                                                        
Query: 41   gctttacagcattacgttcacaggtataaaggagggcttgggacatctgtctcaggtctt 100
            ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1480 gctttacag-atcacgttcacaggtataaaggagggcttgggacatctgtctcaggtctt 1422

                                                                        
Query: 101  ccggtagtcaggtagcactaatgcgtcactctctgtacatggaaggaggggtttgaagga 160
            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 1421 ccggtagtcaggtagcactaatgcgtcactctctgtacatggaaggaggggtgtgaagga 1362

                                                                        
Query: 161  gccaaactcagcagcaccctgctgcttagaatgtggaatgtttgggtgccccgctccctc 220
            |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1361 gccaaactcagcagcaccctgctgcttagaatgtggaatgtttgggtgacccgctccctc 1302

                                                                   
Query: 221  tgaaatggactcaggaggtgctgggaccaccgtcctctccttcaaaatgtttaat 275
            ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1301 tgatatggactcaggaggtgctgggaccaccgtccactccttcaaaatgtttaat 1247



 Score =  208 bits (105), Expect = 1e-50
 Identities = 123/131 (93%)
 Strand = Plus / Minus

                                                                        
Query: 306  agaatcgttacattgtgtcatttatggggaggggttccatctccaggatgtgaaccgtga 365
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1220 agaatcgttacattgtgtcatttatggggaggggttccatctccaggatgtgaaccgtga 1161

                                                                        
Query: 366  gtttcgtcngnagggggctgtttaccaggccggtgcantgttggcaagacgtntnatacc 425
            |||||||| | |||||||||||||||| ||||||||| |||||||||||||| | |||| 
Sbjct: 1160 gtttcgtcgggagggggctgtttaccaagccggtgcagtgttggcaagacgtctcatacg 1101

                       
Query: 426  cctngtgttcc 436
            ||| |||||||
Sbjct: 1100 cctggtgttcc 1090
to top
>ref|NM_001006818.1| Xenopus tropicalis SWI/SNF related, matrix associated, actin
            dependent regulator of chromatin, subfamily b, member 1
            (smarcb1), mRNA
          Length = 1602

 Score =  410 bits (207), Expect = e-111
 Identities = 229/235 (97%), Gaps = 1/235 (0%)
 Strand = Plus / Minus

                                                                        
Query: 41   gctttacagcattacgttcacaggtataaaggagggcttgggacatctgtctcaggtctt 100
            ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1480 gctttacag-atcacgttcacaggtataaaggagggcttgggacatctgtctcaggtctt 1422

                                                                        
Query: 101  ccggtagtcaggtagcactaatgcgtcactctctgtacatggaaggaggggtttgaagga 160
            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 1421 ccggtagtcaggtagcactaatgcgtcactctctgtacatggaaggaggggtgtgaagga 1362

                                                                        
Query: 161  gccaaactcagcagcaccctgctgcttagaatgtggaatgtttgggtgccccgctccctc 220
            |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1361 gccaaactcagcagcaccctgctgcttagaatgtggaatgtttgggtgacccgctccctc 1302

                                                                   
Query: 221  tgaaatggactcaggaggtgctgggaccaccgtcctctccttcaaaatgtttaat 275
            ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 1301 tgatatggactcaggaggtgctgggaccaccgtccactccttcaaaatgtttaat 1247



 Score =  208 bits (105), Expect = 1e-50
 Identities = 123/131 (93%)
 Strand = Plus / Minus

                                                                        
Query: 306  agaatcgttacattgtgtcatttatggggaggggttccatctccaggatgtgaaccgtga 365
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1220 agaatcgttacattgtgtcatttatggggaggggttccatctccaggatgtgaaccgtga 1161

                                                                        
Query: 366  gtttcgtcngnagggggctgtttaccaggccggtgcantgttggcaagacgtntnatacc 425
            |||||||| | |||||||||||||||| ||||||||| |||||||||||||| | |||| 
Sbjct: 1160 gtttcgtcgggagggggctgtttaccaagccggtgcagtgttggcaagacgtctcatacg 1101

                       
Query: 426  cctngtgttcc 436
            ||| |||||||
Sbjct: 1100 cctggtgttcc 1090
to top
>ref|XM_515023.1| PREDICTED: Pan troglodytes similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1; integrase interactor 1
            (LOC458702), mRNA
          Length = 1789

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1459 gggctggttaccaggccggggccgtgttggcaagacg 1423
to top
>gb|DQ230988.1| Homo sapiens SWI/SNF related, matrix associated, actin dependent
             regulator of chromatin, subfamily b, member 1 (SMARCB1)
             gene, complete cds
          Length = 50890

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 380   gggctgtttaccaggccggtgcantgttggcaagacg 416
             |||||| |||||||||||| ||  |||||||||||||
Sbjct: 48635 gggctggttaccaggccggggccgtgttggcaagacg 48599
to top
>ref|NM_003073.3| Homo sapiens SWI/SNF related, matrix associated, actin dependent
            regulator of chromatin, subfamily b, member 1 (SMARCB1),
            transcript variant 1, mRNA
          Length = 1717

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1372 gggctggttaccaggccggggccgtgttggcaagacg 1336
to top
>ref|NM_001007468.1| Homo sapiens SWI/SNF related, matrix associated, actin dependent
            regulator of chromatin, subfamily b, member 1 (SMARCB1),
            transcript variant 2, mRNA
          Length = 1690

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1345 gggctggttaccaggccggggccgtgttggcaagacg 1309
to top
>ref|XM_852298.1| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 7 (LOC486407),
            mRNA
          Length = 1562

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1270 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1221
to top
>ref|XM_852254.1| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 6 (LOC486407),
            mRNA
          Length = 1637

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1353 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1304
to top
>ref|XM_852215.1| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 5 (LOC486407),
            mRNA
          Length = 1603

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1319 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1270
to top
>ref|XM_852177.1| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 4 (LOC486407),
            mRNA
          Length = 1688

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1396 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1347
to top
>ref|XM_852136.1| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 3 (LOC486407),
            mRNA
          Length = 1785

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1501 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1452
to top
>ref|XM_543533.2| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 1 (LOC486407),
            mRNA
          Length = 1599

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1307 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1258
to top
>ref|XM_843721.1| PREDICTED: Canis familiaris similar to SWI/SNF related, matrix
            associated, actin dependent regulator of chromatin,
            subfamily b, member 1, transcript variant 2 (LOC486407),
            mRNA
          Length = 1633

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 42/50 (84%)
 Strand = Plus / Minus

                                                              
Query: 387  ttaccaggccggtgcantgttggcaagacgtntnatacccctngtgttcc 436
            ||||||||| || ||| |||||||||||||  | |||| ||| |||||||
Sbjct: 1341 ttaccaggctggggcagtgttggcaagacgcctcatacgccttgtgttcc 1292
to top
>emb|CR626732.1| full-length cDNA clone CS0DA005YC17 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1656

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1341 gggctggttaccaggccggggccgtgttggcaagacg 1305
to top
>emb|CR625707.1| full-length cDNA clone CS0DA011YE11 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1639

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1340 gggctggttaccaggccggggccgtgttggcaagacg 1304
to top
>emb|CR625181.1| full-length cDNA clone CS0DI071YB16 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1612

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1344 gggctggttaccaggccggggccgtgttggcaagacg 1308
to top
>emb|CR624865.1| full-length cDNA clone CS0DI016YN24 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1594

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1300 gggctggttaccaggccggggccgtgttggcaagacg 1264
to top
>emb|CR621760.1| full-length cDNA clone CS0DI030YN10 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1639

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1342 gggctggttaccaggccggggccgtgttggcaagacg 1306
to top
>emb|CR620956.1| full-length cDNA clone CS0DF004YC19 of Fetal brain of Homo sapiens
            (human)
          Length = 1645

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1343 gggctggttaccaggccggggccgtgttggcaagacg 1307
to top
>emb|CR621090.1| full-length cDNA clone CS0DD001YJ18 of Neuroblastoma Cot
            50-normalized of Homo sapiens (human)
          Length = 1641

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1327 gggctggttaccaggccggggccgtgttggcaagacg 1291
to top
>emb|CR621083.1| full-length cDNA clone CS0DI057YI07 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1582

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1291 gggctggttaccaggccggggccgtgttggcaagacg 1255
to top
>emb|CR619411.1| full-length cDNA clone CS0DI042YG07 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1629

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1340 gggctggttaccaggccggggccgtgttggcaagacg 1304
to top
>emb|CR619336.1| full-length cDNA clone CS0DI030YM09 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1639

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1344 gggctggttaccaggccggggccgtgttggcaagacg 1308
to top
>emb|CR617530.1| full-length cDNA clone CS0DG001YP09 of B cells (Ramos cell line) of
            Homo sapiens (human)
          Length = 1669

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1361 gggctggttaccaggccggggccgtgttggcaagacg 1325
to top
>emb|CR601509.1| full-length cDNA clone CS0DI080YF20 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1619

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1320 gggctggttaccaggccggggccgtgttggcaagacg 1284
to top
>emb|CR600940.1| full-length cDNA clone CS0DI022YN22 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1617

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1320 gggctggttaccaggccggggccgtgttggcaagacg 1284
to top
>emb|CR600743.1| full-length cDNA clone CS0DE008YC21 of Placenta of Homo sapiens
            (human)
          Length = 1642

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1340 gggctggttaccaggccggggccgtgttggcaagacg 1304
to top
>emb|CR599485.1| full-length cDNA clone CS0DC029YF01 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1611

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1313 gggctggttaccaggccggggccgtgttggcaagacg 1277
to top
>emb|CR595672.1| full-length cDNA clone CS0DB003YC16 of Neuroblastoma Cot
            10-normalized of Homo sapiens (human)
          Length = 1635

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1313 gggctggttaccaggccggggccgtgttggcaagacg 1277
to top
>emb|CR594771.1| full-length cDNA clone CS0DF006YK20 of Fetal brain of Homo sapiens
            (human)
          Length = 1649

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1343 gggctggttaccaggccggggccgtgttggcaagacg 1307
to top
>dbj|AK024025.1| Homo sapiens cDNA FLJ13963 fis, clone Y79AA1001299, highly similar to
            Homo sapiens mRNA for integrase interactor 1b protein
            (INI1B)
          Length = 1717

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1399 gggctggttaccaggccggggccgtgttggcaagacg 1363
to top
>emb|CR590517.1| full-length cDNA clone CS0DB001YE08 of Neuroblastoma Cot
            10-normalized of Homo sapiens (human)
          Length = 1320

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1009 gggctggttaccaggccggggccgtgttggcaagacg 973
to top
>emb|CR590397.1| full-length cDNA clone CS0DC023YL08 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1641

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1343 gggctggttaccaggccggggccgtgttggcaagacg 1307
to top
>dbj|AK021419.1| Homo sapiens cDNA FLJ11357 fis, clone HEMBA1000201, highly similar to
            Homo sapiens mRNA for integrase interactor 1b protein
            (INI1B)
          Length = 1637

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1310 gggctggttaccaggccggggccgtgttggcaagacg 1274
to top
>emb|AJ011738.1|HSA011738 Homo sapiens mRNA for integrase interactor 1b protein (INI1B)
          Length = 1612

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1285 gggctggttaccaggccggggccgtgttggcaagacg 1249
to top
>emb|AJ011737.1|HSA011737 Homo sapiens mRNA for integrase interactor 1a protein (INI1A)
          Length = 1640

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1312 gggctggttaccaggccggggccgtgttggcaagacg 1276
to top
>emb|CR456581.1| Homo sapiens SMARCB1 full length open reading frame (ORF) cDNA clone
            (cDNA clone C22ORF:pGEM.SMARCB1)
          Length = 1382

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  gggctgtttaccaggccggtgcantgttggcaagacg 416
            |||||| |||||||||||| ||  |||||||||||||
Sbjct: 1218 gggctggttaccaggccggggccgtgttggcaagacg 1182
to top
>emb|AL389881.1|HST000264 Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 152038
          Length = 532

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 380 gggctgtttaccaggccggtgcantgttggcaagacg 416
           |||||| |||||||||||| ||  |||||||||||||
Sbjct: 186 gggctggttaccaggccggggccgtgttggcaagacg 150
to top
>dbj|AP000350.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB1125A3
          Length = 162328

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 380   gggctgtttaccaggccggtgcantgttggcaagacg 416
             |||||| |||||||||||| ||  |||||||||||||
Sbjct: 28231 gggctggttaccaggccggggccgtgttggcaagacg 28195
to top
>gb|AC164883.5| Mus musculus BAC clone RP23-88A20 from chromosome 15, complete sequence
          Length = 260402

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   cctgctgcttagaatgtgga 197
             ||||||||||||||||||||
Sbjct: 69709 cctgctgcttagaatgtgga 69728
to top
>gb|AC166643.7| Mus musculus chromosome 18, clone RP24-241J8, complete sequence
          Length = 173501

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 149   gggtttgaaggagccaaactcagc 172
             |||||||| |||||||||||||||
Sbjct: 99917 gggtttgagggagccaaactcagc 99940
to top
>ref|XM_543025.1| PREDICTED: Canis familiaris similar to Zinc finger SWIM domain
            containing protein 3 (LOC485901), mRNA
          Length = 2091

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 70   aggagggcttgggacatctg 89
            ||||||||||||||||||||
Sbjct: 1073 aggagggcttgggacatctg 1054
to top
>emb|AL139818.15| Human DNA sequence from clone RP11-311B18 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 103124

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 261   ttcaaaatgtttaattagaa 280
             ||||||||||||||||||||
Sbjct: 91302 ttcaaaatgtttaattagaa 91321
to top
>gb|AC090505.10| Homo sapiens 3 BAC RP11-152D21 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 86560

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 226  tggactcaggaggtgctggg 245
            ||||||||||||||||||||
Sbjct: 5537 tggactcaggaggtgctggg 5556
to top
>gb|AF371465.1|AF371465 Pirital virus strain 3367 nucleoprotein (N) gene, partial cds
          Length = 616

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 58 tcacaggtataaaggagggcttgggaca 85
          ||||||||| || |||||||||||||||
Sbjct: 17 tcacaggtaaaagggagggcttgggaca 44
to top
>gb|AF371447.1|AF371447 Pirital virus strain 2148 nucleoprotein (N) gene, partial cds
          Length = 616

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 58 tcacaggtataaaggagggcttgggaca 85
          ||||||||| || |||||||||||||||
Sbjct: 17 tcacaggtaaaagggagggcttgggaca 44
to top
>dbj|AK045383.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230111P18 product:brain and
            acute leukemia, cytoplasmic, full insert sequence
          Length = 4189

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 178  cctgctgcttagaatgtgga 197
            ||||||||||||||||||||
Sbjct: 3434 cctgctgcttagaatgtgga 3453
to top
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 337     gggttccatctccaggatgt 356
               ||||||||||||||||||||
Sbjct: 2116480 gggttccatctccaggatgt 2116499


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,998,933
Number of Sequences: 3902068
Number of extensions: 2998933
Number of successful extensions: 52118
Number of sequences better than 10.0: 49
Number of HSP's better than 10.0 without gapping: 49
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52053
Number of HSP's gapped (non-prelim): 65
length of query: 436
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 414
effective length of database: 17,147,199,772
effective search space: 7098940705608
effective search space used: 7098940705608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top