>gb|AY108531.1| Zea mays PCO112988 mRNA sequence
          Length = 792

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 248 ctaaaatccgtgaatcttgatactctcttt 277
           ||||||||||||||||||||| || |||||
Sbjct: 520 ctaaaatccgtgaatcttgatgctatcttt 491

>ref|NM_190883.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 360

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 241 gtgttgcctaaaatccgtgaatcttgatactctctttcttt 281
           |||| |||||||| ||||| || ||||| ||||||||||||
Sbjct: 356 gtgtagcctaaaacccgtgtattttgatgctctctttcttt 316

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                         
Query: 241      gtgttgcctaaaatccgtgaatcttgatactctctttcttt 281
                |||| |||||||| ||||| || ||||| ||||||||||||
Sbjct: 33644640 gtgtagcctaaaacccgtgtattttgatgctctctttcttt 33644680

>dbj|AP003290.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0684C02
          Length = 80086

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 241   gtgttgcctaaaatccgtgaatcttgatactctctttcttt 281
             |||| |||||||| ||||| || ||||| ||||||||||||
Sbjct: 59512 gtgtagcctaaaacccgtgtattttgatgctctctttcttt 59552

>gb|AC123865.5| Mus musculus BAC clone RP23-365C14 from chromosome 10, complete sequence
          Length = 212994

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 82     cacaccgatgccaaattcaaatgt 105
              ||||| ||||||||||||||||||
Sbjct: 116478 cacactgatgccaaattcaaatgt 116501

>gb|AC124722.3| Mus musculus BAC clone RP23-389E7 from chromosome 6, complete sequence
          Length = 193830

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tccgtgaatcttgatactct 273
              ||||||||||||||||||||
Sbjct: 107099 tccgtgaatcttgatactct 107118

>gb|AC097512.2| Homo sapiens BAC clone RP11-412P11 from 4, complete sequence
          Length = 149282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 235  atttgagtgttgcctaaaat 254
            ||||||||||||||||||||
Sbjct: 6346 atttgagtgttgcctaaaat 6327

>gb|AC090648.5| Genomic sequence for Mus musculus, clone RP23-331I23, complete sequence
          Length = 198695

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tccgtgaatcttgatactct 273
             ||||||||||||||||||||
Sbjct: 87691 tccgtgaatcttgatactct 87672

>emb|BX248080.21| Zebrafish DNA sequence from clone CH211-226C1 in linkage group 5,
              complete sequence
          Length = 188075

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     acaacttgcatcaacacacc 87
              ||||||||||||||||||||
Sbjct: 127788 acaacttgcatcaacacacc 127769

>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome
          Length = 3573470

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 240     agtgttgcctaaaatccgtg 259
               ||||||||||||||||||||
Sbjct: 1712792 agtgttgcctaaaatccgtg 1712773

>gb|AC150773.2| Xenopus tropicalis clone CH216-69F7, complete sequence
          Length = 115925

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 263   cttgatactctctttctttgcaag 286
             |||||| |||||||||||||||||
Sbjct: 74553 cttgattctctctttctttgcaag 74576


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,248,943
Number of Sequences: 3902068
Number of extensions: 2248943
Number of successful extensions: 35138
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35105
Number of HSP's gapped (non-prelim): 33
length of query: 286
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 264
effective length of database: 17,147,199,772
effective search space: 4526860739808
effective search space used: 4526860739808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)