ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd1g06 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_183466.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1093 Score = 159 bits (80), Expect = 1e-35 Identities = 182/216 (84%) Strand = Plus / Minus Query: 235 tcaccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgag 294 |||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | || Sbjct: 810 tcaccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccag 751 Query: 295 ggtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaa 354 ||||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | Sbjct: 750 ggtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgag 691 Query: 355 gtagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggt 414 ||||||||||||||||||||||||||| || | || |||||| ||||||||||| || Sbjct: 690 gtagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgt 631 Query: 415 ccaaaggaccgactcgtccagggtgtctggattgta 450 ||| || || |||||||||| | ||||||||||| Sbjct: 630 ccacagcacagactcgtccatgtactctggattgta 595
>dbj|AK104820.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-A11, full insert sequence Length = 1093 Score = 159 bits (80), Expect = 1e-35 Identities = 182/216 (84%) Strand = Plus / Minus Query: 235 tcaccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgag 294 |||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | || Sbjct: 810 tcaccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccag 751 Query: 295 ggtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaa 354 ||||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | Sbjct: 750 ggtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgag 691 Query: 355 gtagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggt 414 ||||||||||||||||||||||||||| || | || |||||| ||||||||||| || Sbjct: 690 gtagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgt 631 Query: 415 ccaaaggaccgactcgtccagggtgtctggattgta 450 ||| || || |||||||||| | ||||||||||| Sbjct: 630 ccacagcacagactcgtccatgtactctggattgta 595
>dbj|AK104555.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-F10, full insert sequence Length = 1088 Score = 159 bits (80), Expect = 1e-35 Identities = 182/216 (84%) Strand = Plus / Minus Query: 235 tcaccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgag 294 |||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | || Sbjct: 807 tcaccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccag 748 Query: 295 ggtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaa 354 ||||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | Sbjct: 747 ggtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgag 688 Query: 355 gtagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggt 414 ||||||||||||||||||||||||||| || | || |||||| ||||||||||| || Sbjct: 687 gtagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgt 628 Query: 415 ccaaaggaccgactcgtccagggtgtctggattgta 450 ||| || || |||||||||| | ||||||||||| Sbjct: 627 ccacagcacagactcgtccatgtactctggattgta 592
>dbj|AK071375.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023095C18, full insert sequence Length = 1392 Score = 159 bits (80), Expect = 1e-35 Identities = 182/216 (84%) Strand = Plus / Minus Query: 235 tcaccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgag 294 |||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | || Sbjct: 1093 tcaccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccag 1034 Query: 295 ggtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaa 354 ||||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | Sbjct: 1033 ggtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgag 974 Query: 355 gtagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggt 414 ||||||||||||||||||||||||||| || | || |||||| ||||||||||| || Sbjct: 973 gtagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgt 914 Query: 415 ccaaaggaccgactcgtccagggtgtctggattgta 450 ||| || || |||||||||| | ||||||||||| Sbjct: 913 ccacagcacagactcgtccatgtactctggattgta 878
>dbj|AK060132.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-C04, full insert sequence Length = 1220 Score = 159 bits (80), Expect = 1e-35 Identities = 182/216 (84%) Strand = Plus / Minus Query: 235 tcaccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgag 294 |||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | || Sbjct: 850 tcaccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccag 791 Query: 295 ggtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaa 354 ||||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | Sbjct: 790 ggtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgag 731 Query: 355 gtagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggt 414 ||||||||||||||||||||||||||| || | || |||||| ||||||||||| || Sbjct: 730 gtagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgt 671 Query: 415 ccaaaggaccgactcgtccagggtgtctggattgta 450 ||| || || |||||||||| | ||||||||||| Sbjct: 670 ccacagcacagactcgtccatgtactctggattgta 635
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 157 bits (79), Expect = 5e-35 Identities = 181/215 (84%) Strand = Plus / Minus Query: 236 caccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagg 295 ||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | ||| Sbjct: 227786 caccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccagg 227727 Query: 296 gtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaag 355 |||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | | Sbjct: 227726 gtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgagg 227667 Query: 356 tagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtc 415 |||||||||||||||||||||||||| || | || |||||| ||||||||||| ||| Sbjct: 227666 tagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgtc 227607 Query: 416 caaaggaccgactcgtccagggtgtctggattgta 450 || || || |||||||||| | ||||||||||| Sbjct: 227606 cacagcacagactcgtccatgtactctggattgta 227572
>dbj|AP002818.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0436E04 Length = 144644 Score = 157 bits (79), Expect = 5e-35 Identities = 181/215 (84%) Strand = Plus / Minus Query: 236 caccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagg 295 ||||||| ||| |||||||||||||||||||| ||||| ||||||||| || | ||| Sbjct: 69456 caccagggaacaatcttccagcgctggttgtcaccctcgcaccactcccagagcaccagg 69397 Query: 296 gtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaag 355 |||||||| |||||||| ||||| ||||||||||| ||||||||||| || ||||| | | Sbjct: 69396 gtggttccgtcgcgcacgccgccgtggtccttgtctccatggagcgcgtcgaagttgagg 69337 Query: 356 tagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtc 415 |||||||||||||||||||||||||| || | || |||||| ||||||||||| ||| Sbjct: 69336 tagatgttgttcaccatcctgatgcaccgaaacccactcccaacgtccctgctctccgtc 69277 Query: 416 caaaggaccgactcgtccagggtgtctggattgta 450 || || || |||||||||| | ||||||||||| Sbjct: 69276 cacagcacagactcgtccatgtactctggattgta 69242
>ref|XM_479570.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1209 Score = 123 bits (62), Expect = 7e-25 Identities = 158/190 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 |||||||||||||||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 1191 gatcttccagcgctggttgtcgcccttacaccactcccagagcacgacggtggtgccgtc 1132 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | || ||||| ||||||||||||||||||| || |||||||| | |||||||||||| Sbjct: 1131 gtggacgccgccgtggtccttgtcgccatggaaggcgtcaaagttgaggtagatgttgtt 1072 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | || ||||||| |||| || || ||| ||||||| ||||| || ||||| Sbjct: 1071 caccatgcggacgcagcggaagccatggccgacgtccttgctctccgtccacagcaccga 1012 Query: 427 ctcgtccagg 436 |||||||||| Sbjct: 1011 ctcgtccagg 1002 Score = 85.7 bits (43), Expect = 2e-13 Identities = 151/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 503 gatcttccagcactggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 444 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| ||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 443 gtgcacgccgccgtgggacttgtcgccgtggaaggcgtccaagttgaggtagatgttgtt 384 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 ||||| | |||||||||| |||| || || ||| ||||||||||||| || ||||| Sbjct: 383 gaccatgcggatgcagcggaagccatggccgacgtccttgctctcggtccacagcaccga 324 Query: 427 ctcgtcc 433 ||||||| Sbjct: 323 ctcgtcc 317
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 123 bits (62), Expect = 7e-25 Identities = 158/190 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 |||||||||||||||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 28940894 gatcttccagcgctggttgtcgcccttacaccactcccagagcacgacggtggtgccgtc 28940835 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | || ||||| ||||||||||||||||||| || |||||||| | |||||||||||| Sbjct: 28940834 gtggacgccgccgtggtccttgtcgccatggaaggcgtcaaagttgaggtagatgttgtt 28940775 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | || ||||||| |||| || || ||| ||||||| ||||| || ||||| Sbjct: 28940774 caccatgcggacgcagcggaagccatggccgacgtccttgctctccgtccacagcaccga 28940715 Query: 427 ctcgtccagg 436 |||||||||| Sbjct: 28940714 ctcgtccagg 28940705 Score = 85.7 bits (43), Expect = 2e-13 Identities = 151/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 28939892 gatcttccagcactggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 28939833 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| ||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 28939832 gtgcacgccgccgtgggacttgtcgccgtggaaggcgtccaagttgaggtagatgttgtt 28939773 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 ||||| | |||||||||| |||| || || ||| ||||||||||||| || ||||| Sbjct: 28939772 gaccatgcggatgcagcggaagccatggccgacgtccttgctctcggtccacagcaccga 28939713 Query: 427 ctcgtcc 433 ||||||| Sbjct: 28939712 ctcgtcc 28939706 Score = 77.8 bits (39), Expect = 4e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 28952104 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 28952045 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 28952044 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 28951985 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | |||||||||| |||| || |||||| ||||||| ||||| || || || Sbjct: 28951984 caccatgcggatgcagcggaagcccttgcccacatccttgctctccgtccacagcacaga 28951925 Query: 427 ctcgtcc 433 ||||||| Sbjct: 28951924 ctcgtcc 28951918 Score = 69.9 bits (35), Expect = 9e-09 Identities = 110/135 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||||||||| ||||| ||| || | || | ||| || || Sbjct: 28956076 gatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgtcggtgccgtc 28956017 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 ||| || ||||| |||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 28956016 gcggacgccgccgtggtacttgtcgccgtggaaggcgtcgaagttgaggtagatgttgtt 28955957 Query: 367 caccatcctgatgca 381 |||||| | |||||| Sbjct: 28955956 caccatgcggatgca 28955942 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 28951417 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 28951358 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 28951357 gcggacgccgccgtggtccttgtcgccgtgga 28951326
>dbj|AP005167.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0060O17 Length = 180015 Score = 123 bits (62), Expect = 7e-25 Identities = 158/190 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 |||||||||||||||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 58431 gatcttccagcgctggttgtcgcccttacaccactcccagagcacgacggtggtgccgtc 58372 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | || ||||| ||||||||||||||||||| || |||||||| | |||||||||||| Sbjct: 58371 gtggacgccgccgtggtccttgtcgccatggaaggcgtcaaagttgaggtagatgttgtt 58312 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | || ||||||| |||| || || ||| ||||||| ||||| || ||||| Sbjct: 58311 caccatgcggacgcagcggaagccatggccgacgtccttgctctccgtccacagcaccga 58252 Query: 427 ctcgtccagg 436 |||||||||| Sbjct: 58251 ctcgtccagg 58242 Score = 85.7 bits (43), Expect = 2e-13 Identities = 151/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 57429 gatcttccagcactggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 57370 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| ||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 57369 gtgcacgccgccgtgggacttgtcgccgtggaaggcgtccaagttgaggtagatgttgtt 57310 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 ||||| | |||||||||| |||| || || ||| ||||||||||||| || ||||| Sbjct: 57309 gaccatgcggatgcagcggaagccatggccgacgtccttgctctcggtccacagcaccga 57250 Query: 427 ctcgtcc 433 ||||||| Sbjct: 57249 ctcgtcc 57243 Score = 77.8 bits (39), Expect = 4e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 69641 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 69582 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 69581 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 69522 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | |||||||||| |||| || |||||| ||||||| ||||| || || || Sbjct: 69521 caccatgcggatgcagcggaagcccttgcccacatccttgctctccgtccacagcacaga 69462 Query: 427 ctcgtcc 433 ||||||| Sbjct: 69461 ctcgtcc 69455 Score = 69.9 bits (35), Expect = 9e-09 Identities = 110/135 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||||||||| ||||| ||| || | || | ||| || || Sbjct: 73613 gatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgtcggtgccgtc 73554 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 ||| || ||||| |||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 73553 gcggacgccgccgtggtacttgtcgccgtggaaggcgtcgaagttgaggtagatgttgtt 73494 Query: 367 caccatcctgatgca 381 |||||| | |||||| Sbjct: 73493 caccatgcggatgca 73479 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 68954 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 68895 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 68894 gcggacgccgccgtggtccttgtcgccgtgga 68863
>ref|NM_187532.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1122 Score = 115 bits (58), Expect = 2e-22 Identities = 163/198 (82%) Strand = Plus / Minus Query: 236 caccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagg 295 ||||||| ||||||||||||||||||||||||||||| ||||| ||| || || | Sbjct: 1046 caccaggggacgatcttccagcgctggttgtcgccctcgcaccacttccagagcgcgacg 987 Query: 296 gtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaag 355 ||||| || ||||| || ||||| |||||||||||||| ||||| || || ||||| | | Sbjct: 986 gtggtgccgtcgcggacgccgccgtggtccttgtcgccgtggagggcgtcgaagttgagg 927 Query: 356 tagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtc 415 ||||||||||||||||| | |||||||||| |||| ||| || || | |||||| ||| Sbjct: 926 tagatgttgttcaccatgcggatgcagcggaagccgtgcccgacgtcgcggctctccgtc 867 Query: 416 caaaggaccgactcgtcc 433 || || |||||||||||| Sbjct: 866 cacagcaccgactcgtcc 849 Score = 85.7 bits (43), Expect = 2e-13 Identities = 115/139 (82%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 528 gatcttccagcactggttgtcgcccttggcccactcccagagcacgatggtggtgccgtc 469 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| |||||||||||||| |||| ||| || ||||| | | ||||||||| Sbjct: 468 gtgcacgccgccgtggtccttgtcgccgtggaacgcgtcgaagttgaggcggatgttgtt 409 Query: 367 caccatcctgatgcagcgg 385 || ||| | |||||||||| Sbjct: 408 cagcatgcggatgcagcgg 390
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 115 bits (58), Expect = 2e-22 Identities = 163/198 (82%) Strand = Plus / Plus Query: 236 caccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagg 295 ||||||| ||||||||||||||||||||||||||||| ||||| ||| || || | Sbjct: 11931353 caccaggggacgatcttccagcgctggttgtcgccctcgcaccacttccagagcgcgacg 11931412 Query: 296 gtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaag 355 ||||| || ||||| || ||||| |||||||||||||| ||||| || || ||||| | | Sbjct: 11931413 gtggtgccgtcgcggacgccgccgtggtccttgtcgccgtggagggcgtcgaagttgagg 11931472 Query: 356 tagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtc 415 ||||||||||||||||| | |||||||||| |||| ||| || || | |||||| ||| Sbjct: 11931473 tagatgttgttcaccatgcggatgcagcggaagccgtgcccgacgtcgcggctctccgtc 11931532 Query: 416 caaaggaccgactcgtcc 433 || || |||||||||||| Sbjct: 11931533 cacagcaccgactcgtcc 11931550 Score = 85.7 bits (43), Expect = 2e-13 Identities = 115/139 (82%) Strand = Plus / Plus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 11931980 gatcttccagcactggttgtcgcccttggcccactcccagagcacgatggtggtgccgtc 11932039 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| |||||||||||||| |||| ||| || ||||| | | ||||||||| Sbjct: 11932040 gtgcacgccgccgtggtccttgtcgccgtggaacgcgtcgaagttgaggcggatgttgtt 11932099 Query: 367 caccatcctgatgcagcgg 385 || ||| | |||||||||| Sbjct: 11932100 cagcatgcggatgcagcgg 11932118 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Minus Query: 410 tcggtccaaaggaccgactcgtccag 435 |||||||| ||||||||||||||||| Sbjct: 11854088 tcggtccacaggaccgactcgtccag 11854063
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 115 bits (58), Expect = 2e-22 Identities = 163/198 (82%) Strand = Plus / Plus Query: 236 caccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagg 295 ||||||| ||||||||||||||||||||||||||||| ||||| ||| || || | Sbjct: 11928116 caccaggggacgatcttccagcgctggttgtcgccctcgcaccacttccagagcgcgacg 11928175 Query: 296 gtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaag 355 ||||| || ||||| || ||||| |||||||||||||| ||||| || || ||||| | | Sbjct: 11928176 gtggtgccgtcgcggacgccgccgtggtccttgtcgccgtggagggcgtcgaagttgagg 11928235 Query: 356 tagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtc 415 ||||||||||||||||| | |||||||||| |||| ||| || || | |||||| ||| Sbjct: 11928236 tagatgttgttcaccatgcggatgcagcggaagccgtgcccgacgtcgcggctctccgtc 11928295 Query: 416 caaaggaccgactcgtcc 433 || || |||||||||||| Sbjct: 11928296 cacagcaccgactcgtcc 11928313 Score = 85.7 bits (43), Expect = 2e-13 Identities = 115/139 (82%) Strand = Plus / Plus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 11928743 gatcttccagcactggttgtcgcccttggcccactcccagagcacgatggtggtgccgtc 11928802 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| |||||||||||||| |||| ||| || ||||| | | ||||||||| Sbjct: 11928803 gtgcacgccgccgtggtccttgtcgccgtggaacgcgtcgaagttgaggcggatgttgtt 11928862 Query: 367 caccatcctgatgcagcgg 385 || ||| | |||||||||| Sbjct: 11928863 cagcatgcggatgcagcgg 11928881 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Minus Query: 410 tcggtccaaaggaccgactcgtccag 435 |||||||| ||||||||||||||||| Sbjct: 11850851 tcggtccacaggaccgactcgtccag 11850826
>gb|AC126222.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0014I10, complete sequence Length = 113946 Score = 115 bits (58), Expect = 2e-22 Identities = 163/198 (82%) Strand = Plus / Plus Query: 236 caccaggcaacgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagg 295 ||||||| ||||||||||||||||||||||||||||| ||||| ||| || || | Sbjct: 32615 caccaggggacgatcttccagcgctggttgtcgccctcgcaccacttccagagcgcgacg 32674 Query: 296 gtggttccatcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaag 355 ||||| || ||||| || ||||| |||||||||||||| ||||| || || ||||| | | Sbjct: 32675 gtggtgccgtcgcggacgccgccgtggtccttgtcgccgtggagggcgtcgaagttgagg 32734 Query: 356 tagatgttgttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtc 415 ||||||||||||||||| | |||||||||| |||| ||| || || | |||||| ||| Sbjct: 32735 tagatgttgttcaccatgcggatgcagcggaagccgtgcccgacgtcgcggctctccgtc 32794 Query: 416 caaaggaccgactcgtcc 433 || || |||||||||||| Sbjct: 32795 cacagcaccgactcgtcc 32812 Score = 85.7 bits (43), Expect = 2e-13 Identities = 115/139 (82%) Strand = Plus / Plus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 33242 gatcttccagcactggttgtcgcccttggcccactcccagagcacgatggtggtgccgtc 33301 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| |||||||||||||| |||| ||| || ||||| | | ||||||||| Sbjct: 33302 gtgcacgccgccgtggtccttgtcgccgtggaacgcgtcgaagttgaggcggatgttgtt 33361 Query: 367 caccatcctgatgcagcgg 385 || ||| | |||||||||| Sbjct: 33362 cagcatgcggatgcagcgg 33380
>emb|X95402.1|OSOSR40C1 O.sativa mRNA for novel protein, osr40c1 Length = 1458 Score = 113 bits (57), Expect = 7e-22 Identities = 156/189 (82%) Strand = Plus / Minus Query: 245 acgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttcca 304 ||||||||||||||||||||||||||||| ||||| ||| || || |||||| || Sbjct: 1099 acgatcttccagcgctggttgtcgccctcgcaccacttccagagcgcgacggtggtgccg 1040 Query: 305 tcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttg 364 ||||| || ||||| |||||||||||||| ||||| || || ||||| | |||||||||| Sbjct: 1039 tcgcggacgccgccgtggtccttgtcgccgtggagggcgtcgaagttgaggtagatgttg 980 Query: 365 ttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggacc 424 |||||||| | |||||||||| |||| ||| || || | |||||| ||||| || ||| Sbjct: 979 ttcaccatgcggatgcagcggaagccgtgcccgacgtcgcggctctccgtccacagcacc 920 Query: 425 gactcgtcc 433 ||||||||| Sbjct: 919 gactcgtcc 911 Score = 77.8 bits (39), Expect = 4e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 590 gatcttccagcactggttgtcgcccttggcccactcccagagcacgatggtggtgccgtc 531 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| |||||||||||||| |||| ||| || ||||| | | ||||||||| Sbjct: 530 gtgcacgccgccgtggtccttgtcgccgtggaacgcgtcgaagttgaggcggatgttgtt 471 Query: 367 caccatcctgatgcagcgg 385 || ||| | ||||||||| Sbjct: 470 cagcatgcgaatgcagcgg 452
>dbj|AK069815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023031K10, full insert sequence Length = 1765 Score = 113 bits (57), Expect = 7e-22 Identities = 156/189 (82%) Strand = Plus / Minus Query: 245 acgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttcca 304 ||||||||||||||||||||||||||||| ||||| ||| || || |||||| || Sbjct: 1112 acgatcttccagcgctggttgtcgccctcgcaccacttccagagcgcgacggtggtgccg 1053 Query: 305 tcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttg 364 ||||| || ||||| |||||||||||||| ||||| || || ||||| | |||||||||| Sbjct: 1052 tcgcggacgccgccgtggtccttgtcgccgtggagggcgtcgaagttgaggtagatgttg 993 Query: 365 ttcaccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggacc 424 |||||||| | |||||||||| |||| ||| || || | |||||| ||||| || ||| Sbjct: 992 ttcaccatgcggatgcagcggaagccgtgcccgacgtcgcggctctccgtccacagcacc 933 Query: 425 gactcgtcc 433 ||||||||| Sbjct: 932 gactcgtcc 924 Score = 85.7 bits (43), Expect = 2e-13 Identities = 115/139 (82%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | ||||||||| || | || |||||| || || Sbjct: 603 gatcttccagcactggttgtcgcccttggcccactcccagagcacgatggtggtgccgtc 544 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| |||||||||||||| |||| ||| || ||||| | | ||||||||| Sbjct: 543 gtgcacgccgccgtggtccttgtcgccgtggaacgcgtcgaagttgaggcggatgttgtt 484 Query: 367 caccatcctgatgcagcgg 385 || ||| | |||||||||| Sbjct: 483 cagcatgcggatgcagcgg 465
>gb|BT016654.1| Zea mays clone Contig487 mRNA sequence Length = 905 Score = 91.7 bits (46), Expect = 3e-15 Identities = 121/146 (82%) Strand = Plus / Minus Query: 245 acgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttcca 304 ||||||||||||||||||||||||||||| ||||| ||| || | || | |||| || Sbjct: 549 acgatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgttggtgccg 490 Query: 305 tcgcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttg 364 |||||||| ||||| |||||||||||||| |||| || || ||||| | |||||||||| Sbjct: 489 tcgcgcacgccgccgtggtccttgtcgccgtggaaggcgtcgaagttgaggtagatgttg 430 Query: 365 ttcaccatcctgatgcagcggtagcc 390 || ||||| | || ||||||| |||| Sbjct: 429 ttgaccatgcggacgcagcggaagcc 404
>gb|BT017376.1| Zea mays clone EL01N0325G07.c mRNA sequence Length = 778 Score = 79.8 bits (40), Expect = 1e-11 Identities = 118/144 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| | |||||||||||| | | |||||| || || Sbjct: 682 gatcttccagctctggttgtcgcccttggcccactcccacagcaccacggtggtgccgtc 623 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | |||| ||||| ||| |||||||||| |||| || || ||||| | | ||||||||| Sbjct: 622 gtgcacgccgccgtggcccttgtcgccgtggaaggcgtcgaagttgaggcggatgttgtt 563 Query: 367 caccatcctgatgcagcggtagcc 390 |||||| | |||||||||| |||| Sbjct: 562 caccatgcggatgcagcggaagcc 539
>ref|XM_479572.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1239 Score = 77.8 bits (39), Expect = 4e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 885 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 826 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 825 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 766 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | |||||||||| |||| || |||||| ||||||| ||||| || || || Sbjct: 765 caccatgcggatgcagcggaagcccttgcccacatccttgctctccgtccacagcacaga 706 Query: 427 ctcgtcc 433 ||||||| Sbjct: 705 ctcgtcc 699 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 366 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 307 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 306 gcggacgccgccgtggtccttgtcgccgtgga 275
>ref|XM_479571.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1511 Score = 77.8 bits (39), Expect = 4e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 1100 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 1041 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 1040 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 981 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | |||||||||| |||| || |||||| ||||||| ||||| || || || Sbjct: 980 caccatgcggatgcagcggaagcccttgcccacatccttgctctccgtccacagcacaga 921 Query: 427 ctcgtcc 433 ||||||| Sbjct: 920 ctcgtcc 914 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 581 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 522 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 521 gcggacgccgccgtggtccttgtcgccgtgga 490
>dbj|AK103324.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125K07, full insert sequence Length = 1512 Score = 77.8 bits (39), Expect = 4e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 1100 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 1041 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 1040 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 981 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | |||||||||| |||| || |||||| ||||||| ||||| || || || Sbjct: 980 caccatgcggatgcagcggaagcccttgcccacatccttgctctccgtccacagcacaga 921 Query: 427 ctcgtcc 433 ||||||| Sbjct: 920 ctcgtcc 914 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 581 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 522 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 521 gcggacgccgccgtggtccttgtcgccgtgga 490
>dbj|AK060899.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-D04, full insert sequence Length = 1239 Score = 77.8 bits (39), Expect = 4e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 885 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 826 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 825 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 766 Query: 367 caccatcctgatgcagcggtagcctgccccaacatccctgctctcggtccaaaggaccga 426 |||||| | |||||||||| |||| || |||||| ||||||| ||||| || || || Sbjct: 765 caccatgcggatgcagcggaagcccttgcccacatccttgctctccgtccacagcacaga 706 Query: 427 ctcgtcc 433 ||||||| Sbjct: 705 ctcgtcc 699 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 366 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 307 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 306 gcggacgccgccgtggtccttgtcgccgtgga 275
>emb|Y08987.1|OSR40G2 O.sativa osr40g2 gene Length = 2101 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||| ||||| ||||| |||||| | || ||| ||||| Sbjct: 2031 gatcttccagcgctggttgtcaccctcgcaccacttccacagcacgatctcggtgccatc 1972 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 | | | ||||| || |||||||||||||||| || || ||||| | |||||||||||| Sbjct: 1971 gtggatgccgccgtgatccttgtcgccatggaaggcgtcgaagttgaggtagatgttgtt 1912 Query: 367 caccatcctgatgcagcggtagcc 390 |||||| | |||||||||| |||| Sbjct: 1911 caccatgcggatgcagcggaagcc 1888 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || |||||| || || Sbjct: 1344 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggtggtgccgtc 1285 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 ||| || ||||| |||||||||||||| |||| Sbjct: 1284 gcggacgccgccgtggtccttgtcgccgtgga 1253
>ref|XM_479573.1| Oryza sativa (japonica cultivar-group), mRNA Length = 988 Score = 69.9 bits (35), Expect = 9e-09 Identities = 110/135 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||||||||| ||||| ||| || | || | ||| || || Sbjct: 699 gatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgtcggtgccgtc 640 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 ||| || ||||| |||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 639 gcggacgccgccgtggtacttgtcgccgtggaaggcgtcgaagttgaggtagatgttgtt 580 Query: 367 caccatcctgatgca 381 |||||| | |||||| Sbjct: 579 caccatgcggatgca 565
>emb|Y08988.1|OSR40G3 O.sativa osr40g3 gene Length = 1531 Score = 69.9 bits (35), Expect = 9e-09 Identities = 110/135 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||||||||| ||||| ||| || | || | ||| || || Sbjct: 1316 gatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgtcggtgccgtc 1257 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 ||| || ||||| |||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 1256 gcggacgccgccgtggtacttgtcgccgtggaaggcgtcgaagttgaggtagatgttgtt 1197 Query: 367 caccatcctgatgca 381 |||||| | |||||| Sbjct: 1196 caccatgcggatgca 1182
>dbj|AK072989.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023145K15, full insert sequence Length = 987 Score = 69.9 bits (35), Expect = 9e-09 Identities = 110/135 (81%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||||||||| ||||| ||| || | || | ||| || || Sbjct: 698 gatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgtcggtgccgtc 639 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 ||| || ||||| |||| ||||||||| |||| || || ||||| | |||||||||||| Sbjct: 638 gcggacgccgccgtggtacttgtcgccgtggaaggcgtcgaagttgaggtagatgttgtt 579 Query: 367 caccatcctgatgca 381 |||||| | |||||| Sbjct: 578 caccatgcggatgca 564
>gb|BT017211.1| Zea mays clone EL01N0372B08.c mRNA sequence Length = 567 Score = 67.9 bits (34), Expect = 4e-08 Identities = 79/94 (84%) Strand = Plus / Minus Query: 245 acgatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttcca 304 ||||||||||||||||||||||||||||| ||||| ||| || | || | ||| || Sbjct: 233 acgatcttccagcgctggttgtcgccctcgcaccacttccagagcacgatgttggggccg 174 Query: 305 tcgcgcacaccgccatggtccttgtcgccatgga 338 |||||||| ||||| |||||||||||||| |||| Sbjct: 173 tcgcgcacgccgccgtggtccttgtcgccgtgga 140
>gb|DQ022951.1| Triticum aestivum stress responsive protein mRNA, complete cds Length = 846 Score = 61.9 bits (31), Expect = 2e-06 Identities = 100/123 (81%) Strand = Plus / Minus Query: 250 cttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatcgcg 309 |||||||||||||||||||||||| ||||| ||| || | || ||| || ||||| Sbjct: 592 cttccagcgctggttgtcgccctcgcaccacttccagagcacgacctcggtgccgtcgcg 533 Query: 310 cacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgttcac 369 ||| ||||| |||| ||||||||| | ||| || || ||||| | ||||||||||||||| Sbjct: 532 cacgccgccgtggtacttgtcgccgttgagggcgtcgaagttgaggtagatgttgttcac 473 Query: 370 cat 372 ||| Sbjct: 472 cat 470 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 401 tccctgctctcggtccaaaggaccgactcgtccagggtgtctggattgtac 451 ||||||||||| ||||| || ||||||||||||||| |||||| |||||| Sbjct: 441 tccctgctctccgtccacagcaccgactcgtccaggtagtctgggttgtac 391
>gb|BT016442.1| Zea mays clone Contig275 mRNA sequence Length = 1443 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||| |||||||||||||| ||||||||| || | || || ||| || || Sbjct: 559 gatcttccagctctggttgtcgcccttgcaccactcccagagcacgacggcggtgccgtc 500 Query: 307 gcgcacaccgccatggtccttgtcgccatgga 338 | |||| ||||| |||||||||||||| |||| Sbjct: 499 gtgcacgccgccgtggtccttgtcgccgtgga 468 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctc 273 ||||||||||||||||||||||||||| Sbjct: 1057 gatcttccagcgctggttgtcgccctc 1031 Score = 42.1 bits (21), Expect = 2.1 Identities = 63/77 (81%) Strand = Plus / Minus Query: 314 ccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgttcaccatc 373 ||||| ||| |||||||||| |||| || || ||||| | |||||||||||| ||||| Sbjct: 990 ccgccgtgggccttgtcgccgtggaaggcgtcgaagttgaggtagatgttgttgaccatg 931 Query: 374 ctgatgcagcggtagcc 390 | || ||||||| |||| Sbjct: 930 cggacgcagcggaagcc 914
>gb|BT018086.1| Zea mays clone EL01N0552C09.c mRNA sequence Length = 666 Score = 56.0 bits (28), Expect = 1e-04 Identities = 115/144 (79%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctcagtccactcccacagaatgagggtggttccatc 306 ||||||||||||||||||||||||||| ||||| ||| || | || | |||| || || Sbjct: 424 gatcttccagcgctggttgtcgccctcgcaccacttccagagcacgacgttggtgccgtc 365 Query: 307 gcgcacaccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgtt 366 || || ||||| || ||||||||| ||||| || || ||||| | |||||||||||| Sbjct: 364 acggacgccgccgtgccacttgtcgccgtggagggcgtcgaagttgaggtagatgttgtt 305 Query: 367 caccatcctgatgcagcggtagcc 390 ||||| | || ||||||| |||| Sbjct: 304 gaccatgcggacgcagcggaagcc 281
>gb|BT018342.1| Zea mays clone EL01T0403C03.c mRNA sequence Length = 690 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctc 273 ||||||||||||||||||||||||||| Sbjct: 309 gatcttccagcgctggttgtcgccctc 283
>gb|BT018000.1| Zea mays clone EL01N0526G03.c mRNA sequence Length = 842 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgccctc 273 ||||||||||||||||||||||||||| Sbjct: 491 gatcttccagcgctggttgtcgccctc 465 Score = 42.1 bits (21), Expect = 2.1 Identities = 63/77 (81%) Strand = Plus / Minus Query: 314 ccgccatggtccttgtcgccatggagcgcatcaaagttcaagtagatgttgttcaccatc 373 ||||| ||| |||||||||| |||| || || ||||| | |||||||||||| ||||| Sbjct: 424 ccgccgtgggccttgtcgccgtggaaggcgtcgaagttgaggtagatgttgttgaccatg 365 Query: 374 ctgatgcagcggtagcc 390 | || ||||||| |||| Sbjct: 364 cggacgcagcggaagcc 348
>gb|DQ083207.1| Oryza sativa (indica cultivar-group) clone 6S8A23 mRNA sequence Length = 332 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 245 acgatcttccagcgctggttgtcgcc 270 |||||||||||||||||||||||||| Sbjct: 26 acgatcttccagcgctggttgtcgcc 1
>gb|AC147568.5| Mus musculus chromosome 7 clone RP23-15J23, complete sequence Length = 211115 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 105016 acagtcacagcaggcacacttga 104994
>gb|BC053074.1| Mus musculus LIM domain only 1, mRNA (cDNA clone MGC:62435 IMAGE:5693266), complete cds Length = 1146 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 469 acagtcacagcaggcacacttga 447
>ref|NM_057173.1| Mus musculus LIM domain only 1 (Lmo1), mRNA Length = 1277 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 674 acagtcacagcaggcacacttga 652
>emb|AJ296304.1|MMU296304 Mus musculus lmo1 gene for putative human LMO1 homologue, exons 1-4 Length = 185655 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 174081 acagtcacagcaggcacacttga 174059
>dbj|AK133586.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330410G07 product:LIM domain only 1, full insert sequence Length = 815 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 219 acagtcacagcaggcacacttga 197
>gb|AF353304.1|AF353304 Rattus norvegicus neuronal specific transcription factor DAT1 mRNA, complete cds Length = 940 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 291 acagtcacagcaggcacacttga 269
>ref|NM_139112.1| Rattus norvegicus LIM domain only 3 (Lmo3), mRNA Length = 940 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 291 acagtcacagcaggcacacttga 269
>ref|XM_579663.1| PREDICTED: Rattus norvegicus LIM domain only 3 (Lmo3), mRNA Length = 554 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 291 acagtcacagcaggcacacttga 269
>dbj|AP007256.1| Danio rerio DNA, clone:DKEY-188F22, complete sequence Length = 155274 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 389 cctgccccaacatccctgctctc 411 ||||||||||||||||||||||| Sbjct: 86442 cctgccccaacatccctgctctc 86420
>gb|AC147221.4| Mus musculus BAC clone RP23-58K20 from 7, complete sequence Length = 223807 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacacttga 583 ||||||||||||||||||||||| Sbjct: 190077 acagtcacagcaggcacacttga 190055
>gb|AC136227.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0109A13, complete sequence Length = 134258 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 490 aggtgagcaaattcaccatact 511 |||||||||||||||||||||| Sbjct: 23241 aggtgagcaaattcaccatact 23262
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22, complete sequence Length = 166052 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 490 aggtgagcaaattcaccatact 511 |||||||||||||||||||||| Sbjct: 132313 aggtgagcaaattcaccatact 132334
>gb|BC096058.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone MGC:116692 IMAGE:40000078), complete cds Length = 785 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacacttga 583 |||||||||||||||||||||| Sbjct: 193 cagtcacagcaggcacacttga 172
>gb|BC096057.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone MGC:116691 IMAGE:40000076), complete cds Length = 663 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacacttga 583 |||||||||||||||||||||| Sbjct: 192 cagtcacagcaggcacacttga 171
>gb|BC096056.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone MGC:116690 IMAGE:40000075), complete cds Length = 664 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacacttga 583 |||||||||||||||||||||| Sbjct: 193 cagtcacagcaggcacacttga 172
>gb|AC091013.7| Homo sapiens chromosome 11, clone RP11-379P15, complete sequence Length = 223741 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacacttga 583 |||||||||||||||||||||| Sbjct: 159889 cagtcacagcaggcacacttga 159868
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Plus Query: 490 aggtgagcaaattcaccatact 511 |||||||||||||||||||||| Sbjct: 14796899 aggtgagcaaattcaccatact 14796920
>gb|AC137070.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0035J18, from chromsome 3, complete sequence Length = 162711 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 410 tcggtccaaaggaccgactcgtccag 435 |||||||| ||||||||||||||||| Sbjct: 56565 tcggtccacaggaccgactcgtccag 56590
>gb|BC069752.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone MGC:97388 IMAGE:7262660), complete cds Length = 1147 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacacttga 583 |||||||||||||||||||||| Sbjct: 559 cagtcacagcaggcacacttga 538
>gb|BC069793.1| Homo sapiens LIM domain only 1 (rhombotin 1), mRNA (cDNA clone MGC:97328 IMAGE:7262577), complete cds Length = 1149 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacacttga 583 |||||||||||||||||||||| Sbjct: 559 cagtcacagcaggcacacttga 538
>ref|XM_520773.1| PREDICTED: Pan troglodytes similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1) (LOC465319), mRNA Length = 736 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 254 acagtcacagcaggcacactt 234
>gb|DQ214007.1| Taeniopygia guttata clone 0064P0018A03 LIM domain only 1 variant 2-like mRNA, complete sequence Length = 1357 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 703 acagtcacagcaggcacactt 683
>ref|NM_001001395.1| Homo sapiens LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 2, mRNA Length = 3450 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 298 acagtcacagcaggcacactt 278
>ref|NM_018640.3| Homo sapiens LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 1, mRNA Length = 3727 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 575 acagtcacagcaggcacactt 555
>gb|BC017777.1| Homo sapiens LIM domain only 3 (rhombotin-like 2), mRNA (cDNA clone IMAGE:4696059), containing frame-shift errors Length = 1522 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 235 acagtcacagcaggcacactt 215
>gb|AC132235.3| Mus musculus BAC clone RP24-497H15 from chromosome 17, complete sequence Length = 180462 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 476 agaaacaaaccagaaggtgag 496 ||||||||||||||||||||| Sbjct: 115916 agaaacaaaccagaaggtgag 115936
>ref|XM_861498.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 8 (LOC486662), mRNA Length = 1853 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 670 acagtcacagcaggcacactt 650
>ref|XM_861485.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 7 (LOC486662), mRNA Length = 1864 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 681 acagtcacagcaggcacactt 661
>ref|XM_847840.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 2 (LOC486662), mRNA Length = 1496 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 313 acagtcacagcaggcacactt 293
>ref|XM_861457.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 6 (LOC486662), mRNA Length = 1484 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 301 acagtcacagcaggcacactt 281
>ref|XM_861443.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 5 (LOC486662), mRNA Length = 1508 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 325 acagtcacagcaggcacactt 305
>ref|XM_861426.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 4 (LOC486662), mRNA Length = 1437 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 254 acagtcacagcaggcacactt 234
>ref|XM_543789.2| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 1 (LOC486662), mRNA Length = 1428 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 245 acagtcacagcaggcacactt 225
>ref|XM_861401.1| PREDICTED: Canis familiaris similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 3 (LOC486662), mRNA Length = 1804 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 681 acagtcacagcaggcacactt 661
>gb|BC026311.1| Homo sapiens LIM domain only 3 (rhombotin-like 2), transcript variant 1, mRNA (cDNA clone MGC:26081 IMAGE:4799836), complete cds Length = 3691 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 576 acagtcacagcaggcacactt 556
>gb|BC050085.1| Homo sapiens LIM domain only 3 (rhombotin-like 2), mRNA (cDNA clone MGC:50972 IMAGE:5274811), complete cds Length = 3383 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 262 acagtcacagcaggcacactt 242
>emb|CR859600.1| Pongo pygmaeus mRNA; cDNA DKFZp459L014 (from clone DKFZp459L014) Length = 3519 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 412 acagtcacagcaggcacactt 392
>emb|CR861346.1| Pongo pygmaeus mRNA; cDNA DKFZp459H1911 (from clone DKFZp459H1911) Length = 2840 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 621 acagtcacagcaggcacactt 601
>emb|CR861281.1| Pongo pygmaeus mRNA; cDNA DKFZp459I083 (from clone DKFZp459I083) Length = 3350 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 238 acagtcacagcaggcacactt 218
>emb|CR861209.1| Pongo pygmaeus mRNA; cDNA DKFZp459E083 (from clone DKFZp459E083) Length = 3708 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 516 acagtcacagcaggcacactt 496
>emb|CR860409.1| Pongo pygmaeus mRNA; cDNA DKFZp459H241 (from clone DKFZp459H241) Length = 3546 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 380 acagtcacagcaggcacactt 360
>emb|CR860023.1| Pongo pygmaeus mRNA; cDNA DKFZp459N0325 (from clone DKFZp459N0325) Length = 3419 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 309 acagtcacagcaggcacactt 289
>emb|CR858516.1| Pongo pygmaeus mRNA; cDNA DKFZp459K207 (from clone DKFZp459K207) Length = 4715 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 277 acagtcacagcaggcacactt 257
>emb|CR858323.1| Pongo pygmaeus mRNA; cDNA DKFZp459F0827 (from clone DKFZp459F0827) Length = 3771 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 579 acagtcacagcaggcacactt 559
>dbj|AK095595.1| Homo sapiens cDNA FLJ38276 fis, clone FCBBF3004323, highly similar to RHOMBOTIN-1 Length = 3448 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 298 acagtcacagcaggcacactt 278
>emb|CR598247.1| full-length cDNA clone CS0DI033YJ14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1685 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 609 acagtcacagcaggcacactt 589
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 330 cgccatggagcgcatcaaagt 350 ||||||||||||||||||||| Sbjct: 3551481 cgccatggagcgcatcaaagt 3551461
>gb|AC007529.5| Homo sapiens 12p13 BAC RPCI11-69C13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 147239 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 141971 acagtcacagcaggcacactt 141951
>gb|AF258348.1|AF258348 Homo sapiens neuronal specific transcription factor DAT1 mRNA, complete cds Length = 1763 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 278 acagtcacagcaggcacactt 258
>dbj|AB044746.1| Homo sapiens Nbla03267 mRNA, complete cds Length = 753 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 327 acagtcacagcaggcacactt 307
>dbj|AB044745.1| Homo sapiens Nbla03267 mRNA, complete cds Length = 3540 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 426 acagtcacagcaggcacactt 406
>gb|AC091254.77| Mus musculus strain C57BL/6J clone rp23-364j24 map 17, complete sequence Length = 187696 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 110 tcctcaaacaaaacagaaaca 130 ||||||||||||||||||||| Sbjct: 140032 tcctcaaacaaaacagaaaca 140052
>gb|AC091484.8| Mus musculus strain C57BL/6J chromosome 17 clone rp23-386a1, complete sequence Length = 205343 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 110 tcctcaaacaaaacagaaaca 130 ||||||||||||||||||||| Sbjct: 176428 tcctcaaacaaaacagaaaca 176408
>gb|M64358.1|HUMRHOM3A Human rhom-3 gene, exon Length = 234 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 561 acagtcacagcaggcacactt 581 ||||||||||||||||||||| Sbjct: 153 acagtcacagcaggcacactt 133
>ref|NM_129462.2| Arabidopsis thaliana unknown protein AT2G39050 mRNA, complete cds Length = 1271 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgcc 270 |||||||||| ||||||||||||| Sbjct: 966 gatcttccagagctggttgtcgcc 943
>gb|DQ213100.1| Taeniopygia guttata clone 0058P0015F04 MGC75753-like mRNA, complete sequence Length = 1368 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 371 atcctgatgcagcggtagcc 390 |||||||||||||||||||| Sbjct: 455 atcctgatgcagcggtagcc 436
>ref|XM_530087.1| PREDICTED: Pan troglodytes LOC456449 (LOC456449), mRNA Length = 1546 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 32 ctcatgcatccatcacacat 51 |||||||||||||||||||| Sbjct: 1122 ctcatgcatccatcacacat 1141
>gb|AC159298.3| Mus musculus BAC clone RP23-265N1 from chromosome 5, complete sequence Length = 175995 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 gtacctggtcagaagaacct 467 |||||||||||||||||||| Sbjct: 150742 gtacctggtcagaagaacct 150761
>ref|XM_877133.1| PREDICTED: Bos taurus similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 4 (LOC532870), mRNA Length = 3785 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacactt 581 |||||||||||||||||||| Sbjct: 698 cagtcacagcaggcacactt 679
>ref|XM_865821.1| PREDICTED: Bos taurus similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 2 (LOC532870), mRNA Length = 3403 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacactt 581 |||||||||||||||||||| Sbjct: 316 cagtcacagcaggcacactt 297
>ref|XM_877039.1| PREDICTED: Bos taurus similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 3 (LOC532870), mRNA Length = 3555 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacactt 581 |||||||||||||||||||| Sbjct: 468 cagtcacagcaggcacactt 449
>ref|XM_612075.2| PREDICTED: Bos taurus similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), transcript variant 1 (LOC532870), mRNA Length = 3547 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacactt 581 |||||||||||||||||||| Sbjct: 460 cagtcacagcaggcacactt 441
>gb|AC115357.5| Mus musculus BAC clone RP23-81J4 from chromosome 14, complete sequence Length = 233685 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 163 gaaacattcagtacttgctt 182 |||||||||||||||||||| Sbjct: 149003 gaaacattcagtacttgctt 148984
>gb|AC004413.2| Homo sapiens PAC clone RP4-650P9 from 7, complete sequence Length = 114827 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 aaccaacaaacttcagcata 226 |||||||||||||||||||| Sbjct: 26467 aaccaacaaacttcagcata 26448
>gb|AC117550.8| Mus musculus chromosome 1, clone RP24-571N3, complete sequence Length = 156349 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 481 caaaccagaaggtgagcaaa 500 |||||||||||||||||||| Sbjct: 1213 caaaccagaaggtgagcaaa 1232
>gb|BC112712.1| Bos taurus similar to LIM-only protein 3 (Neuronal specific transcription factor DAT1), mRNA (cDNA clone MGC:137301 IMAGE:8170471), complete cds Length = 1056 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacactt 581 |||||||||||||||||||| Sbjct: 248 cagtcacagcaggcacactt 229
>gb|AC058789.20| Mus musculus strain C57BL/6J clone rp23-428p20 map 5, complete sequence Length = 181121 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 gtacctggtcagaagaacct 467 |||||||||||||||||||| Sbjct: 148597 gtacctggtcagaagaacct 148616
>emb|AL355482.13| Human DNA sequence from clone RP11-538D16 on chromosome 1q25.1-31.3 Contains the gene for a protein similar to zinc finger protein 135 (clone pHZ-17) zinc finger protein 61 (LOC127665) and two novel genes (LOC149157), complete sequence Length = 74515 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 32 ctcatgcatccatcacacat 51 |||||||||||||||||||| Sbjct: 39384 ctcatgcatccatcacacat 39403
>emb|AL672026.11| Mouse DNA sequence from clone RP23-403O11 on chromosome X, complete sequence Length = 200566 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 atatatatgcataataacaa 20 |||||||||||||||||||| Sbjct: 186346 atatatatgcataataacaa 186327
>gb|AF525421.1| Mus musculus adenosine deaminase ADAR2 mRNA, complete cds; alternatively spliced Length = 6917 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 ccatcctttttattccagaaacat 169 ||||| |||||||||||||||||| Sbjct: 417 ccatcatttttattccagaaacat 440
>ref|NM_001024838.1| Mus musculus adenosine deaminase, RNA-specific, B1 (Adarb1), transcript variant 3, mRNA Length = 6662 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 ccatcctttttattccagaaacat 169 ||||| |||||||||||||||||| Sbjct: 465 ccatcatttttattccagaaacat 488
>gb|AC107421.6| Homo sapiens 3 BAC RP11-8J23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160396 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 560 cacagtcacagcaggcacacttga 583 |||||||||||||||||| ||||| Sbjct: 111463 cacagtcacagcaggcacccttga 111486
>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete sequence Length = 96827 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgcc 270 |||||||||| ||||||||||||| Sbjct: 77194 gatcttccagagctggttgtcgcc 77171
>gb|AY093795.1| Arabidopsis thaliana At2g39050/T7F6.22 mRNA, complete cds Length = 954 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgcc 270 |||||||||| ||||||||||||| Sbjct: 942 gatcttccagagctggttgtcgcc 919
>dbj|AK164931.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched library, clone:E030028L10 product:adenosine deaminase, RNA-specific, B1, full insert sequence Length = 3291 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 ccatcctttttattccagaaacat 169 ||||| |||||||||||||||||| Sbjct: 433 ccatcatttttattccagaaacat 456
>gb|AF411801.1|AF411801 Arabidopsis thaliana At2g39050/T7F6.22 mRNA, complete cds Length = 1209 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgcc 270 |||||||||| ||||||||||||| Sbjct: 966 gatcttccagagctggttgtcgcc 943
>gb|AC159966.5| Mus musculus chromosome 1, clone RP23-287P12, complete sequence Length = 208142 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 481 caaaccagaaggtgagcaaa 500 |||||||||||||||||||| Sbjct: 135378 caaaccagaaggtgagcaaa 135397
>dbj|AK079837.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430079J05 product:unclassifiable, full insert sequence Length = 2011 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 gtacctggtcagaagaacct 467 |||||||||||||||||||| Sbjct: 1573 gtacctggtcagaagaacct 1592
>gb|BC062806.1| Mus musculus adenosine deaminase, RNA-specific, B1, mRNA (cDNA clone IMAGE:1244670) Length = 730 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 ccatcctttttattccagaaacat 169 ||||| |||||||||||||||||| Sbjct: 594 ccatcatttttattccagaaacat 617
>emb|BX819436.1|CNS0A8S2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1226 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgcc 270 |||||||||| ||||||||||||| Sbjct: 952 gatcttccagagctggttgtcgcc 929
>gb|AY087909.1| Arabidopsis thaliana clone 39558 mRNA, complete sequence Length = 1186 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 247 gatcttccagcgctggttgtcgcc 270 |||||||||| ||||||||||||| Sbjct: 966 gatcttccagagctggttgtcgcc 943
>ref|XM_579664.1| PREDICTED: Rattus norvegicus similar to LIM domain only 3 (LOC497798), mRNA Length = 757 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 cagtcacagcaggcacactt 581 |||||||||||||||||||| Sbjct: 107 cagtcacagcaggcacactt 88
>gb|AY162454.1| Mus musculus adenosine deaminase (Adarb1) mRNA, complete cds, alternatively spliced Length = 6583 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 ccatcctttttattccagaaacat 169 ||||| |||||||||||||||||| Sbjct: 417 ccatcatttttattccagaaacat 440
>gb|AC155176.6| Mus musculus 10 BAC RP24-219F17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 186725 Score = 40.1 bits (20), Expect = 8.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 146 ccatcctttttattccagaaacat 169 ||||| |||||||||||||||||| Sbjct: 81187 ccatcatttttattccagaaacat 81210
>gb|AC175116.2| Mus musculus BAC clone RP23-396H16 from chromosome 5, complete sequence Length = 210409 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 448 gtacctggtcagaagaacct 467 |||||||||||||||||||| Sbjct: 142662 gtacctggtcagaagaacct 142681
>gb|AC002406.1|AC002406 Mouse chromosome X BAC B178A13 (Research Genetics mouse BAC library) complete sequence Length = 194985 Score = 40.1 bits (20), Expect = 8.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 atatatatgcataataacaa 20 |||||||||||||||||||| Sbjct: 121202 atatatatgcataataacaa 121221 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,328,837 Number of Sequences: 3902068 Number of extensions: 5328837 Number of successful extensions: 108156 Number of sequences better than 10.0: 119 Number of HSP's better than 10.0 without gapping: 119 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 107730 Number of HSP's gapped (non-prelim): 395 length of query: 616 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 593 effective length of database: 17,143,297,704 effective search space: 10165975538472 effective search space used: 10165975538472 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
