Clone Name | rbasd1b13 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... | 78 | 1e-11 | 2 | gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ... | 40 | 2.9 | 3 | tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... | 40 | 2.9 |
---|
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 77.8 bits (39), Expect = 1e-11 Identities = 48/51 (94%) Strand = Plus / Minus Query: 103 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc 153 ||||||||||||||||||||||| || ||||||||||||||||| |||||| Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattc 882 Score = 40.1 bits (20), Expect = 2.9 Identities = 44/50 (88%), Gaps = 2/50 (4%) Strand = Plus / Minus Query: 1 actcaactgnagnattctgcaaaccccaacaacttgcacaacatcacatt 50 ||||||||| | ||||| ||||||||| |||||| |||||||||||||| Sbjct: 1014 actcaactgaaaaattct-caaaccccaccaactt-cacaacatcacatt 967
>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete sequence Length = 222430 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 110 tctgaaccaaacaacatgac 129 |||||||||||||||||||| Sbjct: 111593 tctgaaccaaacaacatgac 111574
>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region locus, strain C57BL/6 Length = 2500000 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 110 tctgaaccaaacaacatgac 129 |||||||||||||||||||| Sbjct: 1893522 tctgaaccaaacaacatgac 1893503 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,421,223 Number of Sequences: 3902068 Number of extensions: 1421223 Number of successful extensions: 21477 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 21470 Number of HSP's gapped (non-prelim): 7 length of query: 229 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 207 effective length of database: 17,147,199,772 effective search space: 3549470352804 effective search space used: 3549470352804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)