>gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, complete sequence
          Length = 222820

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                       
Query: 2      tgacaatntgaccatgttttnggaa 26
              ||||||| |||||||||||| ||||
Sbjct: 186658 tgacaatctgaccatgttttgggaa 186634

>dbj|AK116852.1| Ciona intestinalis cDNA, clone:cilv014e14, full insert sequence
          Length = 1615

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 33/37 (89%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                 
Query: 1    ttgacaatntgaccatgttttnggaaaa-aatgatat 36
            |||||||| ||| |||||||| |||||| ||||||||
Sbjct: 1153 ttgacaatttgagcatgtttttggaaaaaaatgatat 1117

>dbj|AK113757.1| Ciona intestinalis cDNA, clone:cicl008d07, full insert sequence
          Length = 1590

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 33/37 (89%), Gaps = 1/37 (2%)
 Strand = Plus / Minus

                                                 
Query: 1    ttgacaatntgaccatgttttnggaa-aaaatgatat 36
            |||||||| ||| |||||||| |||| ||||||||||
Sbjct: 1143 ttgacaatttgagcatgtttttggaaaaaaatgatat 1107

>emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chromosome 1 Contains a novel
              gene, a novel pseudogene, a novel gene similar to heparan
              sulfate 6-O-sulfotransferase 1 (HS6ST1), a pseudogene
              similar to part of a novel gene, the gene for a
              hypothetical protein AE2, a profilin 1 (PFN1) pseudogene,
              the 5' end of the ALPL gene for alkaline phosphatase,
              liver/bone/kidney and a CpG island, complete sequence
          Length = 206231

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                   
Query: 14     catgttttnggaaaaaatgat 34
              |||||||| ||||||||||||
Sbjct: 152572 catgtttttggaaaaaatgat 152592

>gb|AC161168.6| Mus musculus chromosome 1, clone RP24-364J15, complete sequence
          Length = 163341

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                   
Query: 1      ttgacaatntgaccatgtttt 21
              |||||||| ||||||||||||
Sbjct: 126955 ttgacaatctgaccatgtttt 126935

>gb|AC104136.5| Homo sapiens BAC clone RP11-782E2 from 4, complete sequence
          Length = 149715

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                   
Query: 13     ccatgttttnggaaaaaatga 33
              ||||||||| |||||||||||
Sbjct: 143643 ccatgttttaggaaaaaatga 143663

>gb|AC102788.7| Mus musculus chromosome 1, clone RP23-437G8, complete sequence
          Length = 212403

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                   
Query: 1      ttgacaatntgaccatgtttt 21
              |||||||| ||||||||||||
Sbjct: 129282 ttgacaatctgaccatgtttt 129302


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 201,327
Number of Sequences: 3902068
Number of extensions: 201327
Number of successful extensions: 43605
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 43598
Number of HSP's gapped (non-prelim): 9
length of query: 36
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 16
effective length of database: 17,155,003,908
effective search space: 274480062528
effective search space used: 274480062528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)