ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd0e04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1 569 e-159
2gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complet... 266 5e-68
3emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2 202 6e-49
4gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence 182 5e-43
5ref|XM_450351.1| Oryza sativa (japonica cultivar-group), mRNA 178 8e-42
6ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group... 178 8e-42
7ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group... 178 8e-42
8dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 8e-42
9dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 8e-42
10dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 8e-42
11gb|AY109488.1| Zea mays CL9529_1 mRNA sequence 176 3e-41
12gb|AY103585.1| Zea mays PCO123564 mRNA sequence 170 2e-39
13gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mR... 147 3e-32
14ref|NM_105410.2| Arabidopsis thaliana structural constituent of ... 125 1e-25
15gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, comple... 125 1e-25
16gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like p... 125 1e-25
17emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Co... 117 3e-23
18ref|XM_483472.1| Oryza sativa (japonica cultivar-group), mRNA 115 1e-22
19dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
20dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
21gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETR... 96 1e-16
22ref|NM_102503.2| Arabidopsis thaliana structural constituent of ... 94 4e-16
23gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, co... 94 4e-16
24gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 ... 94 4e-16
25gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 ... 94 4e-16
26gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, co... 94 4e-16
27gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete seq... 94 4e-16
28ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 88 2e-14
29ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L... 88 2e-14
30ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60... 88 2e-14
31dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 88 2e-14
32dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic D... 88 2e-14
33dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic D... 88 2e-14
34gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 ... 82 1e-12
35gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, co... 78 2e-11
36dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
37gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana... 78 2e-11
38dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
39dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
40ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal prote... 70 5e-09
41dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012 70 5e-09
42gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partia... 68 2e-08
43gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, ... 68 2e-08
44gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, c... 68 2e-08
45gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein ... 66 9e-08
46gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containi... 66 9e-08
47emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosom... 66 9e-08
48ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical prote... 64 3e-07
49gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogen... 60 5e-06
50emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC... 60 5e-06
51gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal... 60 5e-06
52gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996... 58 2e-05
53gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, com... 58 2e-05
54ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA 58 2e-05
55gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein ... 58 2e-05
56gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone... 56 8e-05
57ref|XM_866977.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 56 8e-05
58ref|XM_613874.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 56 8e-05
59ref|XM_879331.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 56 8e-05
60gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNIN... 56 8e-05
61gb|BC102600.1| Bos taurus similar to 60S ribosomal protein L17 (... 56 8e-05
62ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal pro... 56 8e-05
63emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in... 56 8e-05
64dbj|AB099057.1| Bos taurus mRNA for similar to ribosomal protein... 56 8e-05
65dbj|AB099047.1| Bos taurus mRNA for similar to ribosomal protein... 56 8e-05
66dbj|AB099021.1| Bos taurus mRNA for similar to ribosomal protein... 56 8e-05
67dbj|AB098996.1| Bos taurus mRNA for similar to ribosomal protein... 56 8e-05
68dbj|AB098987.1| Bos taurus mRNA for similar to ribosomal protein... 56 8e-05
69dbj|AB098888.1| Bos taurus mRNA for similar to ribosomal protein... 56 8e-05
70emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 i... 56 8e-05
71ref|NM_001034459.1| Bos taurus similar to 60S ribosomal protein ... 56 8e-05
72gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, c... 54 3e-04
73emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library 54 3e-04
74emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library 54 3e-04
75emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library 54 3e-04
76emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library 54 3e-04
77emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library 54 3e-04
78emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library 54 3e-04
79emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library 54 3e-04
80emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library 54 3e-04
81emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library 54 3e-04
82emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library 54 3e-04
83emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library 54 3e-04
84emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library 54 3e-04
85emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library 54 3e-04
86emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library 54 3e-04
87emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library 54 3e-04
88emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercon... 52 0.001
89dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 52 0.001
90gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein ... 50 0.005
91gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, p... 50 0.005
92ref|XM_599030.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.020
93ref|XM_869475.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.020
94emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17 46 0.079
95gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell... 46 0.079
96gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell... 46 0.079
97ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.079
98ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.079
99ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 C... 46 0.079
100ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 C... 46 0.079
101gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA 46 0.079
102emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library 46 0.079
103gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 ... 46 0.079
104gb|BC077000.1| Xenopus tropicalis MGC89639 protein, mRNA (cDNA c... 44 0.31
105ref|XM_865349.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 44 0.31
106emb|CT025372.2| Xenopus tropicalis finished cDNA, clone TNeu098j06 44 0.31
107ref|NM_171832.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.31
108ref|NM_170799.2| Caenorhabditis elegans Ribosomal Protein, Large... 44 0.31
109ref|NM_001005078.1| Xenopus tropicalis MGC89639 protein (MGC8963... 44 0.31
110ref|XM_871477.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.2
111ref|XM_868142.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.2
112ref|XM_869796.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.2
113ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.2
114ref|XM_786536.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 1.2
115gb|AY130351.1| Scyliorhinus canicula ribosomal protein L17 mRNA,... 42 1.2
116gb|AY909403.1| Siniperca chuatsi clone C176 ribosomal protein L1... 42 1.2
117gb|DQ223555.1| Ovis aries clone TO-DOWN-E18-5 ribosomal protein ... 42 1.2
118gb|AC103376.7| Mus musculus chromosome 8, clone RP24-226P5, comp... 40 4.9
119gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 40 4.9
120gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome... 40 4.9
121gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, comple... 40 4.9
122gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, compl... 40 4.9
123gb|AC108751.10| Homo sapiens 3 BAC RP11-278L15 (Roswell Park Can... 40 4.9
124ref|NM_001003629.1| Danio rerio zgc:100933 (zgc:100933), mRNA 40 4.9
125gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosom... 40 4.9
126dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.9
127gb|BC078194.1| Danio rerio zgc:100933, mRNA (cDNA clone MGC:1009... 40 4.9
128dbj|AP000852.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 4.9 
>emb|X62724.1|HVRNPL171 H.vulgare mRNA for ribosomal protein L17-1
          Length = 785

 Score =  569 bits (287), Expect = e-159
 Identities = 349/367 (95%), Gaps = 5/367 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   cacccataagtatacgatgaaaaatattaccanaacacaacccagaatcgaatccattan 60
           |||||||||| ||||||||||||||||| ||| ||||||||| ||| |||||||||||| 
Sbjct: 749 cacccataag-atacgatgaaaaatatt-ccaaaacacaacc-aga-tcgaatccattag 694

                                                                       
Query: 61  aagagactttcacaaagtntgagctagcagtntttanacgacagataacagggcanaaca 120
           |||||||||||||||||| |||||||||||| |||| |||||||||||||||||| || |
Sbjct: 693 aagagactttcacaaagtatgagctagcagtatttagacgacagataacagggcaaaa-a 635

                                                                       
Query: 121 tnccactcagccaaaccagntgctacaaagngctctaacgaataggtggacagatgatgt 180
           | ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||
Sbjct: 634 ttccactcagccaaaccagatgctacaaagtgctctaacgaataggtggacagatgatgt 575

                                                                       
Query: 181 nnagcttccttctctaggccttcctggcaatctgggactcagcctccttcttcaccggct 240
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 574 agagcttccttctctaggccttcctggcaatatgggactcagcctccttcttcaccggct 515

                                                                       
Query: 241 cttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 514 cttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgc 455

                                                                       
Query: 301 gtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgcg 360
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 454 gtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgcg 395

                  
Query: 361 aaatgta 367
           |||||||
Sbjct: 394 aaatgta 388
to top
>gb|AF264022.1| Poa secunda ribosomal protein L17-1 mRNA, complete cds
          Length = 808

 Score =  266 bits (134), Expect = 5e-68
 Identities = 221/247 (89%), Gaps = 6/247 (2%)
 Strand = Plus / Minus

                                                                       
Query: 126 ctcagccaaa-ccagntgctacaaagngctctaacgaataggtggacagatgatgtnnag 184
           |||||||||| |||| |||||||||  |||||||||||||||||||||  | |||   ||
Sbjct: 607 ctcagccaaagccagatgctacaaactgctctaacgaataggtggacaagt-atgccgag 549

                                                                       
Query: 185 cttccttc-tctaggccttcctgg---caatctgggactcagcctccttcttcaccggct 240
           ||| |||| |||||||||||||||   ||||||||||||||||||| |||||||| ||||
Sbjct: 548 ctttcttcctctaggccttcctgggcgcaatctgggactcagcctctttcttcactggct 489

                                                                       
Query: 241 cttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgc 300
           | |||||||| |||||||| |||||||||||||| ||||| |||||||||||||| ||||
Sbjct: 488 cctccttctcggacaagatgagctcaatgtggcacgggttagacatgtaggggttaatgc 429

                                                                       
Query: 301 gtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgcg 360
           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
Sbjct: 428 gtccatgagcacggtaggtcctgcgccgctgcttctgggcctggttcacttggatgtgtg 369

                  
Query: 361 aaatgta 367
           | |||||
Sbjct: 368 agatgta 362
to top
>emb|X62725.1|HVRNPL172 H.vulgare mRNA for ribosomal protein L17-2
          Length = 854

 Score =  202 bits (102), Expect = 6e-49
 Identities = 137/149 (91%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 278
           ||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 530 tcagcctccttcttcacaggctcttccttctctgacaagatcagctcaatgtggcagggg 471

                                                                       
Query: 279 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgg 338
           ||||||||||| |||||||||||||||||||||||||| |||| |||||  ||||| |||
Sbjct: 470 ttggacatgtaagggttgatgcgtccatgagcacggtacgtccggcgcctctgcttttgg 411

                                        
Query: 339 gcctggttcacttggatgtgcgaaatgta 367
           || |||||||| |||||||| ||||||||
Sbjct: 410 gcttggttcacctggatgtgtgaaatgta 382
to top
>gb|BT017485.1| Zea mays clone EL01N0412G01.c mRNA sequence
          Length = 640

 Score =  182 bits (92), Expect = 5e-43
 Identities = 156/177 (88%), Gaps = 3/177 (1%)
 Strand = Plus / Minus

                                                                       
Query: 188 ccttctctaggccttcctgg---caatctgggactcagcctccttcttcaccggctcttc 244
           ||||||||| ||||||||||   | ||||| ||||||||||| |||||||| ||||||||
Sbjct: 527 ccttctctaagccttcctggttgcgatctgagactcagcctctttcttcactggctcttc 468

                                                                       
Query: 245 cttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtcc 304
           |||||| |||||||| ||||| ||||||||||||  ||||||||| ||||||||||||||
Sbjct: 467 cttctccgacaagatgagctctatgtggcatggggaggacatgtaagggttgatgcgtcc 408

                                                                    
Query: 305 atgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgcga 361
           |||||||||||| |||||||| || |||||||| ||||| || ||||| ||||||||
Sbjct: 407 atgagcacggtatgtcctgcgtcgctgcttctgagcctgattaacttgaatgtgcga 351
to top
>ref|XM_450351.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 813

 Score =  178 bits (90), Expect = 8e-42
 Identities = 157/179 (87%), Gaps = 3/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 239
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 605 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 546

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 545 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 486

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           |||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |||||
Sbjct: 485 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtg 427
to top
>ref|XM_507427.1| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA
          Length = 914

 Score =  178 bits (90), Expect = 8e-42
 Identities = 157/179 (87%), Gaps = 3/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 239
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 606 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 547

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 546 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 487

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           |||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |||||
Sbjct: 486 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtg 428
to top
>ref|XM_506642.2| PREDICTED Oryza sativa (japonica cultivar-group), P0523B07.46 mRNA
          Length = 936

 Score =  178 bits (90), Expect = 8e-42
 Identities = 157/179 (87%), Gaps = 3/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 239
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 592 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 533

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 532 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 473

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           |||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |||||
Sbjct: 472 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtg 414
to top
>dbj|AK120273.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013048E22, full
           insert sequence
          Length = 915

 Score =  178 bits (90), Expect = 8e-42
 Identities = 157/179 (87%), Gaps = 3/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 239
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 606 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 547

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 546 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 487

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           |||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |||||
Sbjct: 486 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtg 428
to top
>dbj|AK105087.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-A12, full
           insert sequence
          Length = 834

 Score =  178 bits (90), Expect = 8e-42
 Identities = 157/179 (87%), Gaps = 3/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 239
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 626 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 567

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 566 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 507

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           |||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |||||
Sbjct: 506 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtg 448
to top
>dbj|AK072488.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023134I03, full
           insert sequence
          Length = 936

 Score =  178 bits (90), Expect = 8e-42
 Identities = 157/179 (87%), Gaps = 3/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 183 agcttccttctctaggccttcctggca---atctgggactcagcctccttcttcaccggc 239
           ||||||||||||||||||||||||||    ||||| ||||||| ||| |||||||| || 
Sbjct: 592 agcttccttctctaggccttcctggctgcgatctgagactcaggctctttcttcactggt 533

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           ||||||||||| |||| ||| |||||||||||||| |||  ||||||||| |||||||||
Sbjct: 532 tcttccttctctgacaggataagctcaatgtggcacggggaggacatgtaagggttgatg 473

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           |||||||||||||||||||| | |||||  ||||||||||||||||| ||||| |||||
Sbjct: 472 cgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaacttgaatgtg 414
to top
>gb|AY109488.1| Zea mays CL9529_1 mRNA sequence
          Length = 1024

 Score =  176 bits (89), Expect = 3e-41
 Identities = 136/152 (89%)
 Strand = Plus / Plus

                                                                       
Query: 210 atctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatg 269
           ||||| ||||||||||| |||||||| |||||||||||||| |||||||| ||||| |||
Sbjct: 421 atctgagactcagcctctttcttcactggctcttccttctccgacaagatgagctcgatg 480

                                                                       
Query: 270 tggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgn 329
           |||||||||  ||||||||| |||||||||||||||||||||||||| |||||||| || 
Sbjct: 481 tggcatggggaggacatgtaagggttgatgcgtccatgagcacggtatgtcctgcgtcgc 540

                                           
Query: 330 tgcttctgggcctggttcacttggatgtgcga 361
           |||||||| ||||| || ||||| ||||||||
Sbjct: 541 tgcttctgagcctgattaacttgaatgtgcga 572
to top
>gb|AY103585.1| Zea mays PCO123564 mRNA sequence
          Length = 1953

 Score =  170 bits (86), Expect = 2e-39
 Identities = 133/149 (89%)
 Strand = Plus / Plus

                                                                        
Query: 210  atctgggactcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatg 269
            ||||| ||||||||||| |||||||| |||||||||||||| |||||||| || || |||
Sbjct: 1233 atctgagactcagcctctttcttcacgggctcttccttctctgacaagatgagttcgatg 1292

                                                                        
Query: 270  tggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgn 329
            ||||| |||  ||||||||| ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 1293 tggcacggggaggacatgtaagggttgatgcgcccatgagcgcggtaggtcctgcgccgc 1352

                                         
Query: 330  tgcttctgggcctggttcacttggatgtg 358
            |||||||| |||||||||||||| |||||
Sbjct: 1353 tgcttctgagcctggttcacttgaatgtg 1381
to top
>gb|AF034948.1|AF034948 Zea mays ribosomal protein L17 (rpl17) mRNA, complete cds
          Length = 746

 Score =  147 bits (74), Expect = 3e-32
 Identities = 127/145 (87%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 278
           |||||||| |||||||| |||||||||||||| ||||  ||||||||||||||||| |||
Sbjct: 528 tcagcctctttcttcacaggctcttccttctctgacagaatcagctcaatgtggcaaggg 469

                                                                       
Query: 279 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgg 338
             ||||||||| ||||| |||||||| |||||||||||||| | |||||  |||||||||
Sbjct: 468 gaggacatgtaagggttaatgcgtccgtgagcacggtaggtgcggcgcctctgcttctgg 409

                                    
Query: 339 gcctggttcacttggatgtgcgaaa 363
           || |||||||| |||||||| ||||
Sbjct: 408 gcttggttcacctggatgtgtgaaa 384
to top
>ref|NM_105410.2| Arabidopsis thaliana structural constituent of ribosome AT1G67430
           mRNA, complete cds
          Length = 713

 Score =  125 bits (63), Expect = 1e-25
 Identities = 107/122 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 296
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 502 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 443

                                                                       
Query: 297 atgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatg 356
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 442 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 383

             
Query: 357 tg 358
           ||
Sbjct: 382 tg 381
to top
>gb|AY081524.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 564

 Score =  125 bits (63), Expect = 1e-25
 Identities = 107/122 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 296
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 470 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 411

                                                                       
Query: 297 atgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatg 356
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 410 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 351

             
Query: 357 tg 358
           ||
Sbjct: 350 tg 349
to top
>gb|AY042862.1| Arabidopsis thaliana ribosomal protein L17-like protein (T1F15.11)
           mRNA, complete cds
          Length = 711

 Score =  125 bits (63), Expect = 1e-25
 Identities = 107/122 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 296
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 502 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 443

                                                                       
Query: 297 atgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatg 356
           || | ||| ||||||||||| ||||| | ||  |||||   |||||||||||||||||||
Sbjct: 442 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcacttggatg 383

             
Query: 357 tg 358
           ||
Sbjct: 382 tg 381
to top
>emb|BX817777.1|CNS0AE81 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZG06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 680

 Score =  117 bits (59), Expect = 3e-23
 Identities = 106/122 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttg 296
           |||||||||||||| ||||| |||| ||||||||||||||||||||||||||| ||||||
Sbjct: 490 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgtaagggttg 431

                                                                       
Query: 297 atgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatg 356
           || | ||| ||||||||||| ||||| | ||  |||||   ||||||||| |||||||||
Sbjct: 430 attcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttaacttggatg 371

             
Query: 357 tg 358
           ||
Sbjct: 370 tg 369
to top
>ref|XM_483472.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 755

 Score =  115 bits (58), Expect = 1e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 278
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498

                                                                       
Query: 279 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgg 338
             ||||||||| || ||||||||||||||||||||||| |||| ||| |  |||||||||
Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438

                                    
Query: 339 gcctggttcacttggatgtgcgaaa 363
           || |||||||| |||||||| ||||
Sbjct: 437 gcttggttcacctggatgtgtgaaa 413
to top
>dbj|AK120448.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013100M19, full
           insert sequence
          Length = 839

 Score =  115 bits (58), Expect = 1e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 278
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 614 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 555

                                                                       
Query: 279 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgg 338
             ||||||||| || ||||||||||||||||||||||| |||| ||| |  |||||||||
Sbjct: 554 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 495

                                    
Query: 339 gcctggttcacttggatgtgcgaaa 363
           || |||||||| |||||||| ||||
Sbjct: 494 gcttggttcacctggatgtgtgaaa 470
to top
>dbj|AK062052.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-B07, full
           insert sequence
          Length = 755

 Score =  115 bits (58), Expect = 1e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagcctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatggg 278
           |||| ||| |||||||| | |||||||||||| |||||||| ||||| | |||||| || 
Sbjct: 557 tcaggctctttcttcacggcctcttccttctctgacaagataagctcgacgtggcagggt 498

                                                                       
Query: 279 ttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgg 338
             ||||||||| || ||||||||||||||||||||||| |||| ||| |  |||||||||
Sbjct: 497 gaggacatgtaaggattgatgcgtccatgagcacggtatgtccggcgtctctgcttctgg 438

                                    
Query: 339 gcctggttcacttggatgtgcgaaa 363
           || |||||||| |||||||| ||||
Sbjct: 437 gcttggttcacctggatgtgtgaaa 413
to top
>gb|AF307336.1|AF307336 Petunia x hybrida ribosomal protein (PETRP) mRNA, complete cds
          Length = 819

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 240 tcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatg 299
           |||||||| |||||||| |||| |||||| ||||| || || ||||||||||| ||||| 
Sbjct: 498 tcttccttttcagacaatatcaactcaatatggcagggattagacatgtagggattgatt 439

                                                                      
Query: 300 cgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
           | ||||||||||||||| |||| |||||  || ||||| || ||||| |||||||||||
Sbjct: 438 cttccatgagcacggtatgtccggcgcctctgtttctgtgcttggtttacttggatgtg 380
to top
>ref|NM_102503.2| Arabidopsis thaliana structural constituent of ribosome AT1G27400
           mRNA, complete cds
          Length = 826

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 287
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           || || ||||| | |||||||||||| || ||||| | ||  || ||    || ||||||
Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455

                             
Query: 348 acttggatgtgcgaaatg 365
           ||||||||||| ||||||
Sbjct: 454 acttggatgtgagaaatg 437
to top
>gb|AY077651.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 531

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 287
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 479 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 420

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           || || ||||| | |||||||||||| || ||||| | ||  || ||    || ||||||
Sbjct: 419 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 360

                             
Query: 348 acttggatgtgcgaaatg 365
           ||||||||||| ||||||
Sbjct: 359 acttggatgtgagaaatg 342
to top
>gb|AF428449.1|AF428449 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 712

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 287
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           || || ||||| | |||||||||||| || ||||| | ||  || ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                             
Query: 348 acttggatgtgcgaaatg 365
           ||||||||||| ||||||
Sbjct: 394 acttggatgtgagaaatg 377
to top
>gb|AF428271.1|AF428271 Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 762

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 287
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           || || ||||| | |||||||||||| || ||||| | ||  || ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                             
Query: 348 acttggatgtgcgaaatg 365
           ||||||||||| ||||||
Sbjct: 394 acttggatgtgagaaatg 377
to top
>gb|AY037249.1| Arabidopsis thaliana At1g27400/F17L21_20 mRNA, complete cds
          Length = 767

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 287
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 514 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 455

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           || || ||||| | |||||||||||| || ||||| | ||  || ||    || ||||||
Sbjct: 454 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 395

                             
Query: 348 acttggatgtgcgaaatg 365
           ||||||||||| ||||||
Sbjct: 394 acttggatgtgagaaatg 377
to top
>gb|AY088522.1| Arabidopsis thaliana clone 749 mRNA, complete sequence
          Length = 747

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 228 ttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatg 287
           |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| ||||||
Sbjct: 574 ttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttgacatg 515

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           || || ||||| | |||||||||||| || ||||| | ||  || ||    || ||||||
Sbjct: 514 taaggattgattcttccatgagcacgatatgtccttctcctctgttttgctgcttggttc 455

                             
Query: 348 acttggatgtgcgaaatg 365
           ||||||||||| ||||||
Sbjct: 454 acttggatgtgagaaatg 437
to top
>ref|XM_323004.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS]
           (NCU03703.1) partial mRNA
          Length = 585

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 320
           ||||| |||||||| |||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408

                                                  
Query: 321 ctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           | ||| || |||||  |||||||||| || |||||||||
Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtgc 369
to top
>ref|XM_956386.1| Neurospora crassa OR74A 60S RIBOSOMAL PROTEIN L17 [MIPS]
           (NCU03703.1) partial mRNA
          Length = 585

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 320
           ||||| |||||||| |||||||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 467 agctcgatgtggcaggggttggacatgtaggggttgatgcgaccgtgagcgcggtaagtg 408

                                                  
Query: 321 ctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           | ||| || |||||  |||||||||| || |||||||||
Sbjct: 407 cggcggcgctgcttgggggcctggttgacctggatgtgc 369
to top
>ref|XM_382047.1| Gibberella zeae PH-1 chromosome 1 RL17_NEUCR 60S ribosomal protein
           L17 (FG01871.1) partial mRNA
          Length = 558

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                       
Query: 261 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtc 320
           ||||| |||||||| |||||||||||||| |||||||| || || ||||||||||| |||
Sbjct: 443 agctcgatgtggcaggggttggacatgtaagggttgatacgaccgtgagcacggtatgtc 384

                                                  
Query: 321 ctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           || || || |||||  |||||||||| || |||||||||
Sbjct: 383 cttcgtcgctgcttgggggcctggttgacctggatgtgc 345
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                           
Query: 292     ggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcactt 351
               |||||||||||||||||||||||||||| | |||||  ||||||||||||||||| ||||
Sbjct: 4337323 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 4337382

                      
Query: 352     ggatgtg 358
               | |||||
Sbjct: 4337383 gaatgtg 4337389



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                           
Query: 223     cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 282
               |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 4337174 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 4337233

                      
Query: 283     acatgta 289
               |||||||
Sbjct: 4337234 acatgta 4337240



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 183     agcttccttctctaggccttcctggc 208
               ||||||||||||||||||||||||||
Sbjct: 4337036 agcttccttctctaggccttcctggc 4337061
to top
>dbj|AP006441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1279D09
          Length = 134793

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                         
Query: 292   ggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcactt 351
             |||||||||||||||||||||||||||| | |||||  ||||||||||||||||| ||||
Sbjct: 40141 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 40200

                    
Query: 352   ggatgtg 358
             | |||||
Sbjct: 40201 gaatgtg 40207



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                         
Query: 223   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 282
             |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 39992 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 40051

                    
Query: 283   acatgta 289
             |||||||
Sbjct: 40052 acatgta 40058



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 183   agcttccttctctaggccttcctggc 208
             ||||||||||||||||||||||||||
Sbjct: 39854 agcttccttctctaggccttcctggc 39879
to top
>dbj|AP005589.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0523B07
          Length = 170510

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 61/67 (91%)
 Strand = Plus / Plus

                                                                          
Query: 292    ggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcactt 351
              |||||||||||||||||||||||||||| | |||||  ||||||||||||||||| ||||
Sbjct: 161082 ggttgatgcgtccatgagcacggtaggtacggcgcctctgcttctgggcctggttaactt 161141

                     
Query: 352    ggatgtg 358
              | |||||
Sbjct: 161142 gaatgtg 161148



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                          
Query: 223    cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 282
              |||| |||||||| || ||||||||||| |||| ||| |||||||||||||| |||  ||
Sbjct: 160933 cctctttcttcactggttcttccttctctgacaggataagctcaatgtggcacggggagg 160992

                     
Query: 283    acatgta 289
              |||||||
Sbjct: 160993 acatgta 160999



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 183    agcttccttctctaggccttcctggc 208
              ||||||||||||||||||||||||||
Sbjct: 160795 agcttccttctctaggccttcctggc 160820
to top
>gb|AC004393.2|T1F15 Arabidopsis thaliana chromosome 1 BAC T1F15 sequence, complete sequence
          Length = 60066

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                  
Query: 237   ggctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgta 289
             |||||||||||||| ||||| |||| |||||||||||||||||||||||||||
Sbjct: 43909 ggctcttccttctctgacaaaatcaactcaatgtggcatgggttggacatgta 43961



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                         
Query: 292   ggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcactt 351
             ||||||| | ||| ||||||||||| ||||| | ||  |||||   ||||||||||||||
Sbjct: 44048 ggttgattcttccgtgagcacggtaagtccttctcctttgctttgcggcctggttcactt 44107

                    
Query: 352   ggatgtg 358
             |||||||
Sbjct: 44108 ggatgtg 44114
to top
>gb|AY853172.1| Pectinaria gouldii ribosomal protein L17 mRNA, complete cds
          Length = 666

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 260 cagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 319
           ||||||||||||||||||| ||  |||||||||||||||||| |||||||| | ||||||
Sbjct: 472 cagctcaatgtggcatgggctgctcatgtaggggttgatgcgaccatgagccctgtaggt 413

              
Query: 320 cct 322
           |||
Sbjct: 412 cct 410
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                            
Query: 294      ttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttgg 353
                ||||||||||||||||||||||| |||| ||| |  ||||||||||| |||||||| |||
Sbjct: 26399460 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 26399519

                          
Query: 354      atgtgcgaaa 363
                ||||| ||||
Sbjct: 26399520 atgtgtgaaa 26399529



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                    
Query: 223      cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 274
                |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 26399319 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 26399370
to top
>gb|AC004557.2|AC004557 Genomic sequence for Arabidopsis thaliana BAC F17L21 from chromosome I,
             complete sequence
          Length = 99690

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                         
Query: 223   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggcatgggttgg 282
             |||| |||||||| |||||||| ||||| ||||| |||| |||||||||||||||||| |
Sbjct: 60465 cctctttcttcacaggctcttctttctctgacaaaatcaactcaatgtggcatgggtttg 60406

                    
Query: 283   acatgta 289
             |||||||
Sbjct: 60405 acatgta 60399



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 342   tggttcacttggatgtgcgaaatg 365
             ||||||||||||||||| ||||||
Sbjct: 60256 tggttcacttggatgtgagaaatg 60233
to top
>dbj|AP003920.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1789_C07
          Length = 138944

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                         
Query: 294   ttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttgg 353
             ||||||||||||||||||||||| |||| ||| |  ||||||||||| |||||||| |||
Sbjct: 49012 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 49071

                       
Query: 354   atgtgcgaaa 363
             ||||| ||||
Sbjct: 49072 atgtgtgaaa 49081



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                 
Query: 223   cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 274
             |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 48871 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 48922
to top
>dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1770_H02
          Length = 170648

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 62/70 (88%)
 Strand = Plus / Plus

                                                                          
Query: 294    ttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttgg 353
              ||||||||||||||||||||||| |||| ||| |  ||||||||||| |||||||| |||
Sbjct: 129041 ttgatgcgtccatgagcacggtatgtccggcgtctctgcttctgggcttggttcacctgg 129100

                        
Query: 354    atgtgcgaaa 363
              ||||| ||||
Sbjct: 129101 atgtgtgaaa 129110



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 223    cctccttcttcaccggctcttccttctcagacaagatcagctcaatgtggca 274
              |||| |||||||| | |||||||||||| |||||||| ||||| | ||||||
Sbjct: 128900 cctctttcttcacggcctcttccttctctgacaagataagctcgacgtggca 128951
to top
>ref|XM_747718.1| Aspergillus fumigatus Af293 60s ribosomal protein yL17-b
           (Afu1g14410) partial mRNA
          Length = 585

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 261 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 319
           ||||| |||||||| ||||||| ||||||||||||||| || || ||||||||||||||
Sbjct: 464 agctcgatgtggcaggggttggtcatgtaggggttgatacgaccgtgagcacggtaggt 406
to top
>dbj|AB226154.1| Aspergillus oryzae cDNA, contig sequence: AoEST3012
          Length = 1075

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                      
Query: 261 agctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 319
           ||||| |||||||| ||||||| ||||||||||||||| || || ||||||||||||||
Sbjct: 501 agctcgatgtggcaagggttggtcatgtaggggttgatacgaccgtgagcacggtaggt 443
to top
>gb|AY389972.1| Xenopus laevis ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 301
           |||||||||||  | |||||  || ||||||||||||  |  ||||||||||||||||||
Sbjct: 436 ttccttctcagtaaggatcatttcgatgtggcatggggagctcatgtaggggttgatgcg 377

                             
Query: 302 tccatgagcacggtaggt 319
            |||||||||||||||||
Sbjct: 376 accatgagcacggtaggt 359
to top
>gb|BC043971.1| Xenopus laevis similar to ribosomal protein L17, mRNA (cDNA clone
           IMAGE:5571114), partial cds
          Length = 627

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 301
           |||||||||||  | |||||  || ||||||||||||  |  ||||||||||||||||||
Sbjct: 473 ttccttctcagtaaggatcatttcgatgtggcatggggagctcatgtaggggttgatgcg 414

                             
Query: 302 tccatgagcacggtaggt 319
            |||||||||||||||||
Sbjct: 413 accatgagcacggtaggt 396
to top
>gb|AF401571.1| Ictalurus punctatus ribosomal protein L17 mRNA, complete cds
          Length = 600

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 301
           |||||||||||  | ||||| |||||||||||| |||  |  ||||||||||||||||||
Sbjct: 478 ttccttctcagtgaggatcatctcaatgtggcagggggagctcatgtaggggttgatgcg 419

                             
Query: 302 tccatgagcacggtaggt 319
           ||| || |||||||||||
Sbjct: 418 tccgtgggcacggtaggt 401
to top
>gb|DQ207869.1| Solanum tuberosum clone 086A10 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 729

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 239 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 298
           ||||||||||||||| || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 498 ctcttccttctcagataaaatcaactcaatatggcaggggtgagacatataggggttaat 439

                                
Query: 299 gcgtccatgagcacggtaggt 319
            | |||||| |||||||||||
Sbjct: 438 tcttccatgtgcacggtaggt 418
to top
>gb|BC053781.1| Xenopus laevis cDNA clone IMAGE:6876276, containing frame-shift
           errors
          Length = 651

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 267 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggt 319
           ||||||||||||  |  |||||||||||||||||| |||||||||||||||||
Sbjct: 467 atgtggcatggggagctcatgtaggggttgatgcgaccatgagcacggtaggt 415
to top
>emb|AJ876806.1| Acanthamoeba polyphaga mRNA for putative ribosomal L17-like protein
          Length = 545

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 267 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggtaggtcctgcgc 326
           |||||||| ||||||||||||||||||||||| |  || || || ||||||||||| | |
Sbjct: 423 atgtggcaggggttggacatgtaggggttgatcctaccgtgggcgcggtaggtcctcctc 364

                           
Query: 327 cgntgcttctgggcct 342
           |  |||||||||||||
Sbjct: 363 ctctgcttctgggcct 348
to top
>ref|XM_653288.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0776.2), mRNA
          Length = 555

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 248 ctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatg 307
           ||||| || ||| ||||| |||||||| ||||||| |||||| |||||||| || || ||
Sbjct: 456 ctcagtcaggatgagctcgatgtggcaggggttggtcatgtaagggttgatacgaccgtg 397

                       
Query: 308 agcacggtaggt 319
           ||||||||||||
Sbjct: 396 agcacggtaggt 385
to top
>gb|AF443188.1| Paracoccidioides brasiliensis sorbitol dehydrogenase (SOR1) gene;
            hydroxyacid dehydrogenase protein Ynl274c (YNL274c) gene;
            and 60S ribosomal protein Rpl17A (RPL17A) gene, partial
            cds
          Length = 6361

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                  
Query: 261  agctcaatgtggcatgggttggacatgtaggggttgat 298
            ||||| |||||||||||| |||||||||||||||||||
Sbjct: 6360 agctcgatgtggcatgggctggacatgtaggggttgat 6323
to top
>emb|AL451014.1|NCB9B15 Neurospora crassa DNA linkage group V BAC clone B9B15
          Length = 81650

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                   
Query: 261   agctcaatgtggcatgggttggacatgtaggggttgat 298
             ||||| |||||||| |||||||||||||||||||||||
Sbjct: 76796 agctcgatgtggcaggggttggacatgtaggggttgat 76759
to top
>gb|DQ066273.1| Ixodes scapularis isolate is-all-clu554 ribosomal protein L17 mRNA,
           complete cds
          Length = 558

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||| ||| ||  |||||| |||||||||||||| || || |||||
Sbjct: 447 gatcacctcaatgtggcacgggctgctcatgtacgggttgatgcgtccgtgggcgcggta 388

                 
Query: 317 ggtcct 322
           ||||||
Sbjct: 387 ggtcct 382
to top
>gb|BC055097.1| Danio rerio zgc:65996, mRNA (cDNA clone MGC:65996 IMAGE:6792826),
           complete cds
          Length = 636

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctg 343
           ||||||||||||||||||||| ||||| |||||||| |  |||||   |||  |||||| 
Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369

                           
Query: 344 gttcacttggatgtgc 359
           |||||| |||||||||
Sbjct: 368 gttcacctggatgtgc 353
to top
>gb|AY496096.1| Capsicum annuum ribosomal protein PETRP mRNA, complete cds
          Length = 765

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 239 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 298
           |||||||||||||||||| | || |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 512 ctcttccttctcagacaataccaactcaatatggcaagggtgagacatataggggttaat 453

                                                                       
Query: 299 gcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttcacttggatgtg 358
            | ||| || || ||||| || | |||||  || || || |||||||| |||||||||||
Sbjct: 452 tcttccgtgtgctcggtatgtgcggcgcctctgtttttgtgcctggtttacttggatgtg 393
to top
>ref|NM_212760.1| Danio rerio zgc:65996 (zgc:65996), mRNA
          Length = 636

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctg 343
           ||||||||||||||||||||| ||||| |||||||| |  |||||   |||  |||||| 
Sbjct: 428 catgtaggggttgatgcgtccgtgagcgcggtaggtacgtcgccgcatctttggggcctt 369

                           
Query: 344 gttcacttggatgtgc 359
           |||||| |||||||||
Sbjct: 368 gttcacctggatgtgc 353
to top
>gb|DQ252494.1| Solanum tuberosum clone 063E12 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 760

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 298
           ||||||||||||||| || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 509 ctcttccttctcagataaaatcaactcaatatggcaggggtgagacatataggggttaat 450

                                
Query: 299 gcgtccatgagcacggtaggt 319
            | ||| || |||||||||||
Sbjct: 449 tcttccgtgtgcacggtaggt 429
to top
>gb|BC077192.1| Xenopus laevis MGC78885 protein, mRNA (cDNA clone MGC:78885
           IMAGE:4174034), complete cds
          Length = 678

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggt 319
           |||||||||||||||||| |||||||| ||||||||
Sbjct: 443 catgtaggggttgatgcgaccatgagcgcggtaggt 408
to top
>ref|XM_866977.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 3 (LOC534195), mRNA
          Length = 643

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 482 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 423

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 422 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 380
to top
>ref|XM_613874.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 1 (LOC534195), mRNA
          Length = 548

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 404 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 345

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 344 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 302
to top
>ref|XM_879331.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI),
           transcript variant 4 (LOC534195), mRNA
          Length = 515

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 371 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 312

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 311 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 269
to top
>gb|BC049299.1| Danio rerio cDNA clone IMAGE:5914772, **** WARNING: chimeric clone
            ****
          Length = 1854

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 284  catgtaggggttgatgcgtccatgagcacggtaggt 319
            ||||||||||||||||||||| ||||| ||||||||
Sbjct: 1672 catgtaggggttgatgcgtccgtgagcgcggtaggt 1637
to top
>gb|BC102600.1| Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid
           starvation-induced protein) (ASI), mRNA (cDNA clone
           MGC:128012 IMAGE:30957113), complete cds
          Length = 642

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 488 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 429

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 428 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 386
to top
>ref|XM_680042.1| PREDICTED: Danio rerio similar to Ribosomal protein L17
           (LOC572750), mRNA
          Length = 631

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggt 319
           ||||||||||||||||||||| ||||| ||||||||
Sbjct: 462 catgtaggggttgatgcgtccgtgagcgcggtaggt 427
to top
>emb|BX000991.8| Zebrafish DNA sequence from clone CH211-203L7 in linkage group 6,
              complete sequence
          Length = 170966

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                  
Query: 284    catgtaggggttgatgcgtccatgagcacggtaggt 319
              ||||||||||||||||||||| ||||| ||||||||
Sbjct: 121973 catgtaggggttgatgcgtccgtgagcgcggtaggt 122008
to top
>dbj|AB099057.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS13090
          Length = 608

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 470 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 411

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 410 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 368
to top
>dbj|AB099047.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS12904
          Length = 615

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 469 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 410

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 409 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 367
to top
>dbj|AB099021.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS12459
          Length = 509

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 383 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 324

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 323 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 281
to top
>dbj|AB098996.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS11762
          Length = 586

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 474 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 415

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 414 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 372
to top
>dbj|AB098987.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS11689
          Length = 567

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 454 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 395

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 394 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 352
to top
>dbj|AB098888.1| Bos taurus mRNA for similar to ribosomal protein L17, partial cds,
           clone: ORCS10039
          Length = 589

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 466 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 407

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 406 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 364
to top
>emb|BX005111.4| Zebrafish DNA sequence from clone CH211-273E17 in linkage group 21,
            complete sequence
          Length = 169747

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 284  catgtaggggttgatgcgtccatgagcacggtaggt 319
            ||||||||||||||||||||| ||||| ||||||||
Sbjct: 5500 catgtaggggttgatgcgtccgtgagcgcggtaggt 5535
to top
>ref|NM_001034459.1| Bos taurus similar to 60S ribosomal protein L17 (L23) (Amino acid
           starvation-induced protein) (ASI) (MGC128012), mRNA
          Length = 642

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 84/103 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 488 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 429

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 428 agtcctgcgccgcatcttgggggctttgttcacttggatgtgc 386
to top
>gb|AY769286.1| Bombyx mori ribosomal protein L17 (RpL17) mRNA, complete cds
          Length = 620

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 282 gacatgtaggggttgatgcgtccatgagcacggta 316
           |||||||||||||||||||| || |||||||||||
Sbjct: 437 gacatgtaggggttgatgcgaccgtgagcacggta 403
to top
>emb|AL115613.1|CNS01CJP Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 474 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 415

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 414 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 369
to top
>emb|AL114989.1|CNS01C2D Botrytis cinerea strain T4 cDNA library
          Length = 420

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 198 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 139

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 138 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 93
to top
>emb|AL114758.1|CNS01BVY Botrytis cinerea strain T4 cDNA library
          Length = 840

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 460 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 401

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 400 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 355
to top
>emb|AL114552.1|CNS01BQ8 Botrytis cinerea strain T4 cDNA library
          Length = 456

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 200 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 141

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 140 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 95
to top
>emb|AL113871.1|CNS01B7B Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 371 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 312

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 311 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 266
to top
>emb|AL113217.1|CNS01AP5 Botrytis cinerea strain T4 cDNA library
          Length = 516

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 286 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 227

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 226 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 181
to top
>emb|AL113064.1|CNS01AKW Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 454 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 395

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 394 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 349
to top
>emb|AL112375.1|CNS01A1R Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 420 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 375
to top
>emb|AL112009.1|CNS019RL Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 501 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 442

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 441 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 396
to top
>emb|AL111981.1|CNS019QT Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 372 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 313

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 312 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 267
to top
>emb|AL111483.1|CNS019CZ Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 401 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 356
to top
>emb|AL111750.1|CNS019KE Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 480 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 421

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 420 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 375
to top
>emb|AL111381.1|CNS019A5 Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 466 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 407

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 406 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 361
to top
>emb|AL110722.1|CNS018RV Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 469 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 410

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 409 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 364
to top
>emb|AL110976.1|CNS018YX Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 463 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 404

                                                         
Query: 314 gtaggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
           ||| || || || || |||||  | || ||||| ||||||||||||
Sbjct: 403 gtaagttctacgacgttgctttggtgcttggttaacttggatgtgc 358
to top
>emb|BX649607.1| Aspergillus fumigatus BAC pilot project supercontig; segment 3/3
          Length = 227448

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 261    agctcaatgtggcatgggttggacatgtaggggttgat 298
              ||||| |||||||| ||||||| |||||||||||||||
Sbjct: 202049 agctcgatgtggcaggggttggtcatgtaggggttgat 202012
to top
>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 261    agctcaatgtggcatgggttggacatgtaggggttgat 298
              ||||| |||||||| ||||||| |||||||||||||||
Sbjct: 944438 agctcgatgtggcaagggttggtcatgtaggggttgat 944475
to top
>gb|DQ235197.1| Solanum tuberosum clone 168G07 ribosomal protein PETRP-like mRNA,
           complete cds
          Length = 774

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 239 ctcttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgat 298
           |||||||||||| || || |||| |||||| ||||| ||||  ||||| |||||||| ||
Sbjct: 503 ctcttccttctcggataaaatcaactcaatatggcaggggtgagacatataggggttaat 444

                                
Query: 299 gcgtccatgagcacggtaggt 319
            | ||| || |||||||||||
Sbjct: 443 tcttccgtgtgcacggtaggt 423
to top
>gb|AY389929.1| Latimeria chalumnae ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 243 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 302
           ||||||||||  | |||||  ||||||||||| |||  |  |||||| ||||||||||| 
Sbjct: 435 tccttctcagttaggatcatttcaatgtggcaaggggagctcatgtaagggttgatgcgg 376

                            
Query: 303 ccatgagcacggtaggt 319
           || ||||||||||||||
Sbjct: 375 ccgtgagcacggtaggt 359
to top
>ref|XM_599030.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (LOC520780), mRNA
          Length = 500

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||||||   |  ||||||||||||||| || || ||||| | |||
Sbjct: 354 gatcatctcaatgtggcatggagagctcatgtaggggttgatccgaccgtgagctctgta 295

                       
Query: 317 ggtcctgcgccg 328
            |||||||||||
Sbjct: 294 agtcctgcgccg 283
to top
>ref|XM_869475.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC617250), mRNA
          Length = 483

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 83/103 (80%)
 Strand = Plus / Minus

                                                                       
Query: 257 gatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacggta 316
           ||||| |||||||||||| |||  |  |||||||||| |||| || || ||||| | |||
Sbjct: 339 gatcatctcaatgtggcagggggagctcatgtaggggctgatccgaccgtgagctctgta 280

                                                      
Query: 317 ggtcctgcgccgntgcttctgggcctggttcacttggatgtgc 359
            |||||||||||   |||  |||| | ||||||||||||||||
Sbjct: 279 agtcctgcgccgcgtcttgggggctttgttcacttggatgtgc 237
to top
>emb|X71382.1|PCRPL17 P.carnea mRNA for 60S ribosomal protein L17
          Length = 577

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 267 atgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           |||||||||||  | |||||||| || |||||||| |||||||||||
Sbjct: 447 atgtggcatggactcgacatgtatggattgatgcgaccatgagcacg 401
to top
>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 191590

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 282   gacatgtaggggttgatgcgtccatgagcacggta 316
             ||||||||||| |||||||| ||||| ||||||||
Sbjct: 56271 gacatgtagggattgatgcgaccatgggcacggta 56305
to top
>gb|AC023699.4| Drosophila melanogaster X BAC RP98-11K20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 177941

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 282    gacatgtaggggttgatgcgtccatgagcacggta 316
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 160375 gacatgtagggattgatgcgaccatgggcacggta 160409
to top
>ref|NM_167089.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RC, transcript
           variant C (RpL17), mRNA
          Length = 919

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 gacatgtaggggttgatgcgtccatgagcacggta 316
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 540 gacatgtagggattgatgcgaccatgggcacggta 506
to top
>ref|NM_167088.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RB, transcript
           variant B (RpL17), mRNA
          Length = 873

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 gacatgtaggggttgatgcgtccatgagcacggta 316
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 494 gacatgtagggattgatgcgaccatgggcacggta 460
to top
>ref|NM_167087.1| Drosophila melanogaster Ribosomal protein L17 CG3203-RA, transcript
           variant A (RpL17), mRNA
          Length = 837

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 gacatgtaggggttgatgcgtccatgagcacggta 316
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 458 gacatgtagggattgatgcgaccatgggcacggta 424
to top
>ref|NM_132118.2| Drosophila melanogaster Ribosomal protein L17 CG3203-RD, transcript
           variant D (RpL17), mRNA
          Length = 1065

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 gacatgtaggggttgatgcgtccatgagcacggta 316
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggta 652
to top
>gb|AY060845.1| Drosophila melanogaster GM02242 full length cDNA
          Length = 885

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 282 gacatgtaggggttgatgcgtccatgagcacggta 316
           ||||||||||| |||||||| ||||| ||||||||
Sbjct: 686 gacatgtagggattgatgcgaccatgggcacggta 652
to top
>emb|AL111872.1|CNS019NS Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 254 caagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgtccatgagcacg 313
           ||||||||  || |||||||| || || |||||||| |||||||| || || ||||||||
Sbjct: 461 caagatcaattcgatgtggcaaggatttgacatgtatgggttgatacgaccgtgagcacg 402

              
Query: 314 gta 316
           |||
Sbjct: 401 gta 399
to top
>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
              sequence
          Length = 299943

 Score = 46.1 bits (23), Expect = 0.079
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 282    gacatgtaggggttgatgcgtccatgagcacggta 316
              ||||||||||| |||||||| ||||| ||||||||
Sbjct: 202262 gacatgtagggattgatgcgaccatgggcacggta 202296
to top
>gb|BC077000.1| Xenopus tropicalis MGC89639 protein, mRNA (cDNA clone MGC:89639
           IMAGE:7025713), complete cds
          Length = 653

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 301
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 499 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 440

                             
Query: 302 tccatgagcacggtaggt 319
            |||||||||||||||||
Sbjct: 439 accatgagcacggtaggt 422
to top
>ref|XM_865349.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC614032), mRNA
          Length = 442

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                       
Query: 287 gtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggtt 346
           |||||||||||| || || ||||| | ||| |||||||||||   |||  |||| | |||
Sbjct: 267 gtaggggttgatccgaccgtgagctctgtaagtcctgcgccgcatcttgggggctttgtt 208

                        
Query: 347 cacttggatgtgc 359
           |||||||||||||
Sbjct: 207 cacttggatgtgc 195
to top
>emb|CT025372.2| Xenopus tropicalis finished cDNA, clone TNeu098j06
          Length = 658

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 301
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 476 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 417

                             
Query: 302 tccatgagcacggtaggt 319
            |||||||||||||||||
Sbjct: 416 accatgagcacggtaggt 399
to top
>ref|NM_171832.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-17) (rpl-17) mRNA, complete cds
          Length = 543

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 302
           |||||||| | |||||| | ||| ||||||||||||   |||||||| |||||||| | |
Sbjct: 403 tccttctcggccaagatgacctcgatgtggcatggggaagacatgtatgggttgattctt 344

                         
Query: 303 ccatgagcacggta 316
           || || ||||||||
Sbjct: 343 ccgtgggcacggta 330
to top
>ref|NM_170799.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-17) (rpl-17) mRNA, complete cds
          Length = 621

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 302
           |||||||| | |||||| | ||| ||||||||||||   |||||||| |||||||| | |
Sbjct: 487 tccttctcggccaagatgacctcgatgtggcatggggaagacatgtatgggttgattctt 428

                         
Query: 303 ccatgagcacggta 316
           || || ||||||||
Sbjct: 427 ccgtgggcacggta 414
to top
>ref|NM_001005078.1| Xenopus tropicalis MGC89639 protein (MGC89639), mRNA
          Length = 653

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcg 301
           |||||||||||  | |||||  || ||||||||||||  |  ||| ||||| ||||| ||
Sbjct: 499 ttccttctcagtaaggatcaattcgatgtggcatggggagctcatatagggattgatacg 440

                             
Query: 302 tccatgagcacggtaggt 319
            |||||||||||||||||
Sbjct: 439 accatgagcacggtaggt 422
to top
>ref|XM_871477.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC619156), mRNA
          Length = 627

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 59/72 (81%)
 Strand = Plus / Minus

                                                                       
Query: 288 taggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctggttc 347
           ||||||||||| || |||||||| | ||| |||| ||||||   |||  |||| | ||||
Sbjct: 445 taggggttgatacgaccatgagctctgtaagtcccgcgccgcatcttgggggctttgttc 386

                       
Query: 348 acttggatgtgc 359
           ||||||||||||
Sbjct: 385 acttggatgtgc 374
to top
>ref|XM_868142.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC616175), mRNA
          Length = 398

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                       
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctg 343
           ||||||||||||||| || |  ||||| | ||| |||||||||||   |||  |||| | 
Sbjct: 219 catgtaggggttgatccgactgtgagctctgtaagtcctgcgccgcatcttgggggcttt 160

                           
Query: 344 gttcacttggatgtgc 359
           ||||||||||||||||
Sbjct: 159 gttcacttggatgtgc 144
to top
>ref|XM_869796.1| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC617520), mRNA
          Length = 570

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccg 328
           ||||||||||||||| || || ||||| | ||| |||||||||||
Sbjct: 327 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgccg 283
to top
>ref|XM_584664.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L17 (L23)
           (Amino acid starvation-induced protein) (ASI)
           (LOC507961), mRNA
          Length = 590

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccg 328
           ||||||||||||||| || || ||||| | ||| |||||||||||
Sbjct: 436 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgccg 392
to top
>ref|XM_786536.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal
           protein L17 (L23) (Amino acid starvation-induced
           protein) (ASI) (LOC586769), mRNA
          Length = 631

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 257 gatcagctcaatgtggcatgg 277
           |||||||||||||||||||||
Sbjct: 457 gatcagctcaatgtggcatgg 437
to top
>gb|AY130351.1| Scyliorhinus canicula ribosomal protein L17 mRNA, partial cds
          Length = 472

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 302
           ||||||||||  | ||||| ||| |||||||||||   |  |||||| |||||||| || 
Sbjct: 435 tccttctcagtgaggatcatctctatgtggcatggtgagctcatgtatgggttgatacgg 376

                            
Query: 303 ccatgagcacggtaggt 319
           ||||| |||||||||||
Sbjct: 375 ccatgggcacggtaggt 359
to top
>gb|AY909403.1| Siniperca chuatsi clone C176 ribosomal protein L17 mRNA, partial
           cds
          Length = 441

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 243 tccttctcagacaagatcagctcaatgtggcatgggttggacatgtaggggttgatgcgt 302
           |||||||| | || ||||| ||| |||||||| |||  |  |||||||||||||||||| 
Sbjct: 322 tccttctcggtcaggatcatctcgatgtggcagggggagctcatgtaggggttgatgcgg 263

                            
Query: 303 ccatgagcacggtaggt 319
           || || || ||||||||
Sbjct: 262 ccgtgggcgcggtaggt 246
to top
>gb|DQ223555.1| Ovis aries clone TO-DOWN-E18-5 ribosomal protein L17 mRNA, partial
           cds
          Length = 538

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 62/76 (81%)
 Strand = Plus / Minus

                                                                       
Query: 284 catgtaggggttgatgcgtccatgagcacggtaggtcctgcgccgntgcttctgggcctg 343
           ||||||||||||||| || || ||||| | ||| |||||||| ||   |||  |||| | 
Sbjct: 349 catgtaggggttgatccgaccgtgagctctgtaagtcctgcgtcgcatcttgggggcttt 290

                           
Query: 344 gttcacttggatgtgc 359
           ||||||||||||||||
Sbjct: 289 gttcacttggatgtgc 274
to top
>gb|AC103376.7| Mus musculus chromosome 8, clone RP24-226P5, complete sequence
          Length = 165714

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   tctcagacaagatcagctca 266
             ||||||||||||||||||||
Sbjct: 93352 tctcagacaagatcagctca 93333
to top
>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 226     ccttcttcaccggctcttcc 245
               ||||||||||||||||||||
Sbjct: 2470354 ccttcttcaccggctcttcc 2470335
to top
>gb|AC126244.3| Mus musculus BAC clone RP24-319A6 from chromosome 12, complete sequence
          Length = 175549

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   aggccttcctggcaatctgg 215
             ||||||||||||||||||||
Sbjct: 98933 aggccttcctggcaatctgg 98914
to top
>gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, complete sequence
          Length = 204795

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 212   ctgggactcagcctccttcttcac 235
             |||| |||||||||||||||||||
Sbjct: 51513 ctggcactcagcctccttcttcac 51490
to top
>gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, complete sequence
          Length = 186200

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 212    ctgggactcagcctccttcttcac 235
              |||| |||||||||||||||||||
Sbjct: 126406 ctggcactcagcctccttcttcac 126383
to top
>gb|AC108751.10| Homo sapiens 3 BAC RP11-278L15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 131894

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 217   actcagcctccttcttcacc 236
             ||||||||||||||||||||
Sbjct: 88424 actcagcctccttcttcacc 88405
to top
>ref|NM_001003629.1| Danio rerio zgc:100933 (zgc:100933), mRNA
          Length = 1675

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  atcagctcaatgtggcatgg 277
            ||||||||||||||||||||
Sbjct: 1034 atcagctcaatgtggcatgg 1015
to top
>gb|AC157822.2| Mus musculus BAC clone RP23-392J15 from chromosome 12, complete
             sequence
          Length = 185536

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   aggccttcctggcaatctgg 215
             ||||||||||||||||||||
Sbjct: 79561 aggccttcctggcaatctgg 79542
to top
>dbj|AK110522.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-H04, full
           insert sequence
          Length = 944

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 282 gacatgtaggggttgatgcgtccatgagcacggtaggtcc 321
           ||||||||||||||||| || || || |||||||| ||||
Sbjct: 480 gacatgtaggggttgatacgaccgtgggcacggtacgtcc 441
to top
>gb|BC078194.1| Danio rerio zgc:100933, mRNA (cDNA clone MGC:100933 IMAGE:7145844),
            complete cds
          Length = 1675

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  atcagctcaatgtggcatgg 277
            ||||||||||||||||||||
Sbjct: 1034 atcagctcaatgtggcatgg 1015
to top
>dbj|AP000852.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-851M3, complete
              sequence
          Length = 166277

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 248    ctcagacaagatcagctcaa 267
              ||||||||||||||||||||
Sbjct: 153596 ctcagacaagatcagctcaa 153615


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,594,780
Number of Sequences: 3902068
Number of extensions: 2594780
Number of successful extensions: 35489
Number of sequences better than 10.0: 128
Number of HSP's better than 10.0 without gapping: 124
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 35268
Number of HSP's gapped (non-prelim): 181
length of query: 367
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 345
effective length of database: 17,147,199,772
effective search space: 5915783921340
effective search space used: 5915783921340
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top