Clone Name | rbasd0d10 |
---|---|
Clone Library Name | barley_pub |
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete sequence Length = 100991 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 aaaatagagataccatgaaga 203 ||||||||||||||||||||| Sbjct: 74383 aaaatagagataccatgaaga 74363
>emb|Z81528.1|CEF35E2 Caenorhabditis elegans Cosmid F35E2, complete sequence Length = 37439 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 340 gcaaattaagcgtgtgacctt 360 ||||||||||||||||||||| Sbjct: 29493 gcaaattaagcgtgtgacctt 29473
>gb|AC150845.11| Medicago truncatula clone mth2-150a2, complete sequence Length = 131577 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 aaaatagagataccatgaaga 203 ||||||||||||||||||||| Sbjct: 129344 aaaatagagataccatgaaga 129364
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence Length = 100985 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 aaaatagagataccatgaaga 203 ||||||||||||||||||||| Sbjct: 74386 aaaatagagataccatgaaga 74366
>gb|AY341029.1| Homo sapiens steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) (SRD5A1) gene, complete cds Length = 38399 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 tagagtcagggtggagactgg 124 ||||||||||||||||||||| Sbjct: 14294 tagagtcagggtggagactgg 14274
>gb|BC105473.1| Bos taurus cDNA clone IMAGE:7988010, with apparent retained intron Length = 2329 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 356 accttgtctctgcagttctgc 376 ||||||||||||||||||||| Sbjct: 1245 accttgtctctgcagttctgc 1225
>gb|AC010366.6| Homo sapiens chromosome 5 clone CTD-2044J15, complete sequence Length = 115396 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 104 tagagtcagggtggagactgg 124 ||||||||||||||||||||| Sbjct: 73665 tagagtcagggtggagactgg 73645
>emb|BX294124.8| Mouse DNA sequence from clone RP23-80H12 on chromosome X, complete sequence Length = 181854 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 cacttggataaaattgggtta 57 ||||||||||||||||||||| Sbjct: 165314 cacttggataaaattgggtta 165334
>gb|AC148324.2| Mus musculus BAC clone RP24-454N4 from chromosome 12, complete sequence Length = 183478 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 aatgagtaatgcagaaccat 100 |||||||||||||||||||| Sbjct: 178 aatgagtaatgcagaaccat 159
>gb|AY362469.1| Valeriana officinalis NADH dehydrogenase subunit F-like (ndhF) gene, partial sequence; chloroplast Length = 1995 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 441 atatctaacttcgttccctg 460 |||||||||||||||||||| Sbjct: 1687 atatctaacttcgttccctg 1668
>gb|AC153564.6| Mus musculus 10 BAC RP23-39C23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 241022 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 gctcatgtgatgaacacttg 42 |||||||||||||||||||| Sbjct: 76389 gctcatgtgatgaacacttg 76408
>emb|AL136532.22| Human DNA sequence from clone RP11-379F14 on chromosome 20 Contains the MRPS16P gene for mitochondrial ribosomal protein S16 pseudogene, complete sequence Length = 94387 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tgcagaaccatatttagagt 109 |||||||||||||||||||| Sbjct: 62766 tgcagaaccatatttagagt 62747
>emb|AL136116.11| Human DNA sequence from clone RP1-95L4 on chromosome 6 Contains the 3' end of the gene for androgen induced protein (AIG-1) (CGI-103) (includes FLJ10485), a pseudogene similar to actin genes, a ribosomal protein L31 (RPL31) pseudogene and a pseudogene similar to hypothetical proteins PRO2207 and similar to presenilins associated rhomboid-like protein, complete sequence Length = 100815 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 ccttgtctctgcagttctgc 376 |||||||||||||||||||| Sbjct: 21275 ccttgtctctgcagttctgc 21294
>gb|AC018861.9| Homo sapiens chromosome 8, clone RP11-577N1, complete sequence Length = 187047 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 cagctcatgtgatgaacact 40 |||||||||||||||||||| Sbjct: 68901 cagctcatgtgatgaacact 68882
>emb|CR855999.1| Human DNA sequence from clone XX-NCIH2171_12H10, complete sequence Length = 116906 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 cagctcatgtgatgaacact 40 |||||||||||||||||||| Sbjct: 1669 cagctcatgtgatgaacact 1688
>emb|CR855280.1| Human DNA sequence from clone XX-NCIH2171_1M02, complete sequence Length = 132605 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 cagctcatgtgatgaacact 40 |||||||||||||||||||| Sbjct: 93613 cagctcatgtgatgaacact 93594
>emb|CR626937.1| Human DNA sequence from clone XX-NCIH2171_3C16, complete sequence Length = 110843 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 cagctcatgtgatgaacact 40 |||||||||||||||||||| Sbjct: 31548 cagctcatgtgatgaacact 31529
>gb|AC026387.7|AC026387 Mus musculus 11 BAC RP23-476H9 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 204318 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 aatgagtaatgcagaaccat 100 |||||||||||||||||||| Sbjct: 99958 aatgagtaatgcagaaccat 99977
>gb|AC010102.3|AC010102 Homo sapiens BAC clone RP11-486B15 from 2, complete sequence Length = 230827 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 tgcagaaccatatttagagt 109 |||||||||||||||||||| Sbjct: 201898 tgcagaaccatatttagagt 201879
>dbj|AB127931.1| Sphingomonas sp. A1 nadK gene for ATP-NAD kinase, complete cds Length = 897 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 147 ccgacgacaatggccagatc 166 |||||||||||||||||||| Sbjct: 227 ccgacgacaatggccagatc 208
>gb|AC147218.4| Mus musculus BAC clone RP23-11I13 from 12, complete sequence Length = 217668 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 aatgagtaatgcagaaccat 100 |||||||||||||||||||| Sbjct: 68580 aatgagtaatgcagaaccat 68599
>emb|AL772346.5| Mouse DNA sequence from clone RP23-413E7 on chromosome 4, complete sequence Length = 189115 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 281 ctgcatctatccttaacaaa 300 |||||||||||||||||||| Sbjct: 143483 ctgcatctatccttaacaaa 143464 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,411,376 Number of Sequences: 3902068 Number of extensions: 4411376 Number of successful extensions: 73262 Number of sequences better than 10.0: 22 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 73232 Number of HSP's gapped (non-prelim): 30 length of query: 505 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 483 effective length of database: 17,147,199,772 effective search space: 8282097489876 effective search space used: 8282097489876 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)