Clone Name | rbasd0c11 |
---|---|
Clone Library Name | barley_pub |
>gb|AY579884.1| Hordeum vulgare AML6 mRNA, complete cds Length = 3269 Score = 204 bits (103), Expect = 7e-50 Identities = 103/103 (100%) Strand = Plus / Minus Query: 81 tcacctcctgcgcatttcgcccaccttgcaaccgtccgaactctagagttcgtcggcggg 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3132 tcacctcctgcgcatttcgcccaccttgcaaccgtccgaactctagagttcgtcggcggg 3073 Query: 141 gcaaaaacgagggcgcccttgcgcaacttactcacggcgaatc 183 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3072 gcaaaaacgagggcgcccttgcgcaacttactcacggcgaatc 3030 Score = 111 bits (56), Expect = 7e-22 Identities = 56/56 (100%) Strand = Plus / Minus Query: 1 gattagcatccaacacccctccaactcaactgtacagctccccatccctcttcttg 56 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3214 gattagcatccaacacccctccaactcaactgtacagctccccatccctcttcttg 3159
>ref|XM_844312.1| PREDICTED: Canis familiaris similar to Adenylate cyclase type III (Adenylate cyclase, olfactive type) (ATP pyrophosphate-lyase 3) (Adenylyl cyclase 3) (AC-III) (AC3), transcript variant 3 (LOC482994), mRNA Length = 3489 Score = 40.1 bits (20), Expect = 2.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 tacagctccccatccctcttcttg 56 ||||||||| |||||||||||||| Sbjct: 2750 tacagctcctcatccctcttcttg 2727
>ref|XM_540108.2| PREDICTED: Canis familiaris similar to Adenylate cyclase type III (Adenylate cyclase, olfactive type) (ATP pyrophosphate-lyase 3) (Adenylyl cyclase 3) (AC-III) (AC3), transcript variant 1 (LOC482994), mRNA Length = 3489 Score = 40.1 bits (20), Expect = 2.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 tacagctccccatccctcttcttg 56 ||||||||| |||||||||||||| Sbjct: 2750 tacagctcctcatccctcttcttg 2727
>ref|XM_853481.1| PREDICTED: Canis familiaris similar to Adenylate cyclase type III (Adenylate cyclase, olfactive type) (ATP pyrophosphate-lyase 3) (Adenylyl cyclase 3) (AC-III) (AC3), transcript variant 4 (LOC482994), mRNA Length = 3156 Score = 40.1 bits (20), Expect = 2.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 33 tacagctccccatccctcttcttg 56 ||||||||| |||||||||||||| Sbjct: 2417 tacagctcctcatccctcttcttg 2394
>gb|AC107232.4| Mus musculus chromosome 15, clone RP23-144B2, complete sequence Length = 204292 Score = 40.1 bits (20), Expect = 2.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 32 gtacagctccccatccctct 51 |||||||||||||||||||| Sbjct: 65482 gtacagctccccatccctct 65501
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence Length = 159173 Score = 40.1 bits (20), Expect = 2.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 ccaacacccctccaactcaa 29 |||||||||||||||||||| Sbjct: 97298 ccaacacccctccaactcaa 97317
>ref|NM_130779.1| Rattus norvegicus adenylate cyclase 3 (Adcy3), mRNA Length = 4533 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 3113 ctgtacagctcctcatctctcttcttg 3087
>gb|AE014292.2| Brucella suis 1330 chromosome II, complete sequence Length = 1207381 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 95 tttcgcccaccttgcaacc 113 ||||||||||||||||||| Sbjct: 848349 tttcgcccaccttgcaacc 848367
>ref|NM_138305.2| Mus musculus adenylate cyclase 3 (Adcy3), mRNA Length = 3674 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 2895 ctgtacagctcctcatctctcttcttg 2869
>ref|XM_615710.2| PREDICTED: Bos taurus similar to Adenylate cyclase type III (Adenylate cyclase, olfactive type) (ATP pyrophosphate-lyase 3) (Adenylyl cyclase 3) (AC-III) (AC3) (LOC535603), mRNA Length = 3489 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 2750 ctgtacagctcctcatctctcttcttg 2724
>gb|AF287957.6| Homo sapiens chromosome 8 clone CTD-2541M15 map p23.1, complete sequence Length = 168136 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 37 gctccccatccctcttctt 55 ||||||||||||||||||| Sbjct: 95024 gctccccatccctcttctt 95042
>gb|AC110256.12| Mus musculus chromosome 6, clone RP23-274K3, complete sequence Length = 240425 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 34 acagctccccatccctctt 52 ||||||||||||||||||| Sbjct: 145071 acagctccccatccctctt 145053
>gb|AC131764.3| Mus musculus BAC clone RP24-239L16 from chromosome 6, complete sequence Length = 210145 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 34 acagctccccatccctctt 52 ||||||||||||||||||| Sbjct: 199341 acagctccccatccctctt 199359
>gb|BC057316.1| Mus musculus adenylate cyclase 3, mRNA (cDNA clone MGC:66648 IMAGE:6830961), complete cds Length = 5168 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 3135 ctgtacagctcctcatctctcttcttg 3109
>emb|AL121749.14|HSBA425A6 Human DNA sequence from clone RP11-425A6 on chromosome 10 Contains the 3' end of the gene for cyclin fold protein 1 (CFP1) (CBCP1), the gene for connexin40.1 (CX40.1) (FLJ90023), the FZD8 gene for frizzled homolog 8 (Drosophila) and two CpG islands, complete sequence Length = 166007 Score = 38.2 bits (19), Expect = 9.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 22 caactcaactgtacagctcccca 44 ||||||||||| ||||||||||| Sbjct: 90625 caactcaactgcacagctcccca 90603
>gb|AC023282.8| Homo sapiens chromosome 10 clone RP11-257O17, complete sequence Length = 168319 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 33 tacagctccccatccctct 51 ||||||||||||||||||| Sbjct: 24451 tacagctccccatccctct 24433
>gb|AF458089.1|AF458089 Mus musculus adenylyl cyclase 3 (Adcy3) mRNA, complete cds Length = 3674 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 2895 ctgtacagctcctcatctctcttcttg 2869
>gb|BC057113.1| Mus musculus adenylate cyclase 3, mRNA (cDNA clone MGC:64706 IMAGE:6835448), complete cds Length = 4674 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 3231 ctgtacagctcctcatctctcttcttg 3205
>dbj|AK122298.1| Mus musculus mRNA for mKIAA0511 protein Length = 4639 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 3214 ctgtacagctcctcatctctcttcttg 3188
>gb|AC132615.5| Mus musculus BAC clone RP23-301J15 from 9, complete sequence Length = 201718 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 5 agcatccaacacccctcca 23 ||||||||||||||||||| Sbjct: 116964 agcatccaacacccctcca 116946
>gb|M55075.1|RATADCY3 R.norvegicus type III adenylyl cyclase mRNA, complete cds Length = 4533 Score = 38.2 bits (19), Expect = 9.0 Identities = 25/27 (92%) Strand = Plus / Minus Query: 30 ctgtacagctccccatccctcttcttg 56 |||||||||||| |||| ||||||||| Sbjct: 3113 ctgtacagctcctcatctctcttcttg 3087
>gb|AC168266.2| Mus musculus BAC clone RP24-245G1 from chromosome 9, complete sequence Length = 188778 Score = 38.2 bits (19), Expect = 9.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 agcatccaacacccctcca 23 ||||||||||||||||||| Sbjct: 156014 agcatccaacacccctcca 156032 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 811,726 Number of Sequences: 3902068 Number of extensions: 811726 Number of successful extensions: 48612 Number of sequences better than 10.0: 22 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 48575 Number of HSP's gapped (non-prelim): 37 length of query: 183 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 161 effective length of database: 17,147,199,772 effective search space: 2760699163292 effective search space used: 2760699163292 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)