>gb|AC140331.2| Mus musculus BAC clone RP23-406J20 from chromosome 13, complete
             sequence
          Length = 192473

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 121   aagagaagcagaaagaagagg 141
             |||||||||||||||||||||
Sbjct: 48333 aagagaagcagaaagaagagg 48353

>gb|AC132092.3| Mus musculus BAC clone RP24-470A15 from chromosome 16, complete sequence
          Length = 174558

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 122    agagaagcagaaagaagagga 142
              |||||||||||||||||||||
Sbjct: 156198 agagaagcagaaagaagagga 156218

>gb|AC129186.3| Mus musculus BAC clone RP23-415I21 from chromosome 16, complete
             sequence
          Length = 209432

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 122   agagaagcagaaagaagagga 142
             |||||||||||||||||||||
Sbjct: 10779 agagaagcagaaagaagagga 10799

>emb|AL590080.25| Human DNA sequence from clone RP11-469M1 on chromosome 10 Contains the
             HHEX gene for hematopoietically expressed homeobox, the 5'
             end of the gene for SEC15 (S. cerevisiae)-like (SEC15L), a
             eukaryotic translation initiation factor 2 subunit 2
             (eIF-2-beta) pseudogene and four CpG islands, complete
             sequence
          Length = 190144

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 160   cacatgggaagacactcaagc 180
             |||||||||||||||||||||
Sbjct: 81307 cacatgggaagacactcaagc 81287

>emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chromosome 1q21.1-21.3
             Contains the SPRL2A gene for small proline rich-like
             (epidermal differentiation complex) 2A, the LEP1 gene for
             late envelope protein 1, a novel gene, the MCSP gene for
             mitochondrial capsule selenoprotein and the IVL gene for
             involucrin, complete sequence
          Length = 116067

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     tacaacaaacaagaactaga 26
             ||||||||||||||||||||
Sbjct: 63619 tacaacaaacaagaactaga 63638

>emb|AL157402.19| Human DNA sequence from clone RP11-553K8 on chromosome 1q31.2-31.3
             Contains the ATP6V1G3 gene for H+ transporting ATPase
             lysosomal 13kDa V1 subunit G isoform 3, two novel genes, a
             prostatic binding protein (PBP) pseudogene and the 5' end
             of the PTPRC gene for receptor type protein tyrosine
             phosphatase C, complete sequence
          Length = 210331

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 96    ctgaagaaacaaattcggcc 115
             ||||||||||||||||||||
Sbjct: 34790 ctgaagaaacaaattcggcc 34809

>gb|AC157919.5| Mus musculus chromosome 3, clone RP23-131B7, complete sequence
          Length = 190453

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 121   aagagaagcagaaagaagaggatc 144
             |||||| |||||||||||||||||
Sbjct: 46708 aagagaggcagaaagaagaggatc 46731

>gb|AC154118.6| Mus musculus chromosome 19, clone RP24-340C10, complete sequence
          Length = 141422

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   gaagcagaaagaagaggatc 144
             ||||||||||||||||||||
Sbjct: 14235 gaagcagaaagaagaggatc 14254

>gb|AC121099.8| Mus musculus chromosome 3, clone RP24-501F21, complete sequence
          Length = 157318

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 121   aagagaagcagaaagaagaggatc 144
             |||||| |||||||||||||||||
Sbjct: 16040 aagagaggcagaaagaagaggatc 16017

>dbj|AK048074.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130033C08 product:unclassifiable, full
            insert sequence
          Length = 3730

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 329  gaatcaccaaccttggccgt 348
            ||||||||||||||||||||
Sbjct: 3495 gaatcaccaaccttggccgt 3514

>emb|AL831771.5| Mouse DNA sequence from clone RP23-336F13 on chromosome X, complete
             sequence
          Length = 207974

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 184   ttcaaagtcttaatcaattg 203
             ||||||||||||||||||||
Sbjct: 23439 ttcaaagtcttaatcaattg 23458

>emb|AL645963.9| Mouse DNA sequence from clone RP23-76C16 on chromosome 11, complete
             sequence
          Length = 176154

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   gaatcaccaaccttggccgt 348
             ||||||||||||||||||||
Sbjct: 90654 gaatcaccaaccttggccgt 90635


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,834,121
Number of Sequences: 3902068
Number of extensions: 3834121
Number of successful extensions: 70469
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70453
Number of HSP's gapped (non-prelim): 16
length of query: 544
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 521
effective length of database: 17,143,297,704
effective search space: 8931658103784
effective search space used: 8931658103784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)