ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaak4p17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 385 e-103
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 385 e-103
3dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 385 e-103
4dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 385 e-103
5dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 385 e-103
6dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 385 e-103
7gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 363 5e-97
8gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 313 4e-82
9emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 206 6e-50
10gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 206 6e-50
11gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 182 9e-43
12gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 176 6e-41
13emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 172 9e-40
14gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 168 1e-38
15gb|AY104464.1| Zea mays PCO114899 mRNA sequence 167 6e-38
16ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 165 2e-37
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 165 2e-37
18gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 165 2e-37
19dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
20dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 165 2e-37
21dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
22dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
23dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
24dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
25dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
26gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 137 5e-29
27gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 133 8e-28
28gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 117 5e-23
29gb|AY105015.1| Zea mays PCO137646 mRNA sequence 117 5e-23
30gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 115 2e-22
31gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 115 2e-22
32gb|AY106931.1| Zea mays PCO140073 mRNA sequence 115 2e-22
33gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 115 2e-22
34dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
35dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
36dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
37dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
38dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
39dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
40dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
41dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
42dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
43dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
44gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 98 4e-17
45gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 98 4e-17
46gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 98 4e-17
47gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water chann... 98 4e-17
48gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 98 4e-17
49dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 7e-16
50dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast ... 92 3e-15
51ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 88 4e-14
52dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 88 4e-14
53gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 88 4e-14
54dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 88 4e-14
55dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 88 4e-14
56dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 88 4e-14
57dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 4e-14
58emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 88 4e-14
59ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 80 1e-11
60emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 80 1e-11
61dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
62emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
63ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative... 72 2e-09
64gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 72 2e-09
65dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
66dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
67dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mR... 72 2e-09
68dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
69dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
70gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-09
71gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 70 1e-08
72gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 70 1e-08
73dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 70 1e-08
74ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC ... 64 6e-07
75ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predic... 64 6e-07
76gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP)... 64 6e-07
77emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4,... 64 6e-07
78gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, comp... 64 6e-07
79gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 64 6e-07
80gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 64 6e-07
81gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced ... 64 6e-07
82gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 64 6e-07
83emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
84emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
85emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
86emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
87emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
88emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
89emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
90emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
91emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
92emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Co... 64 6e-07
93dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 64 6e-07
94dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 6e-07
95gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protei... 64 6e-07
96dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence 64 6e-07
97emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 62 2e-06
98gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 62 2e-06
99gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral prot... 62 2e-06
100ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 60 9e-06
101dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 60 9e-06
102dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 9e-06
103ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA 58 4e-05
104dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
105dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
106dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 58 4e-05
107ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa817... 56 1e-04
108gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 56 1e-04
109emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
110emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
111dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
112gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intr... 56 1e-04
113gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 56 1e-04
114gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 54 6e-04
115gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) m... 54 6e-04
116gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete se... 52 0.002
117dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
118dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 52 0.002
119dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 52 0.002
120emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic pr... 50 0.009
121emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 50 0.009
122gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrin... 50 0.009
123dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsi... 50 0.009
124gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic p... 50 0.009
125dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 50 0.009
126dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 50 0.009
127ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 48 0.036
128gb|AY626938.1| Sparus aurata aquaporin 1-like mRNA, complete cds 48 0.036
129gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 48 0.036
130gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 48 0.036
131gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA,... 48 0.036
132gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral prot... 48 0.036
133emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Co... 48 0.036
134dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 48 0.036
135gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.036
136gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 46 0.14
137dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
138gb|AF326504.1|AF326504 Zea mays tonoplast membrane integral prot... 46 0.14
139gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 46 0.14
140gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 46 0.14
141gb|AY104541.1| Zea mays PCO074685 mRNA sequence 46 0.14
142gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.14
143emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa... 46 0.14
144gb|BT017952.1| Zea mays clone EL01N0522D02.c mRNA sequence 44 0.56
145gb|AC136491.4| Oryza sativa (japonica cultivar-group) chromosome... 44 0.56
146emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P... 44 0.56
147emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 44 0.56
148emb|BX572595.1| Rhodopseudomonas palustris CGA009 complete genom... 44 0.56
149emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete ... 44 0.56
150dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.56
151gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete se... 44 0.56
152emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 44 0.56
153emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.56
154gb|AY108015.1| Zea mays PCO111497 mRNA sequence 44 0.56
155gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.56
156gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds 42 2.2
157ref|NM_196526.1| Oryza sativa (japonica cultivar-group) putative... 42 2.2
158ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 42 2.2
159ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 2.2
160ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 42 2.2
161ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.2
162gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 42 2.2
163gb|BT012976.1| Lycopersicon esculentum clone 114187R, mRNA sequence 42 2.2
164gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 2.2
165ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 42 2.2
166ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 42 2.2
167gb|AC124174.4| Mus musculus BAC clone RP23-181O22 from chromosom... 42 2.2
168emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic pr... 42 2.2
169gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom... 42 2.2
170emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 42 2.2
171emb|BX640430.1| Bordetella parapertussis strain 12822, complete ... 42 2.2
172gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putat... 42 2.2
173dbj|AK147805.1| Mus musculus melanocyte cDNA, RIKEN full-length ... 42 2.2
174dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 42 2.2
175gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 42 2.2
176dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.2
177dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
178ref|XM_314890.2| Anopheles gambiae str. PEST ENSANGP00000012326 ... 42 2.2
179dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
180dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
181dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
182dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
183dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.2
184gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 42 2.2
185gb|AE015451.1| Pseudomonas putida KT2440 complete genome 42 2.2
186dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 42 2.2
187ref|XM_550294.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.7
188gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 40 8.7
189ref|XM_480022.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.7
190ref|XM_469996.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.7
191ref|XM_450702.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.7
192gb|AC168309.2| Mus musculus chromosome 1, clone wi1-2866I16, com... 40 8.7
193gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.7
194gb|DQ195081.1| Oryza sativa (indica cultivar-group) putative leu... 40 8.7
195gb|AC103551.7| Oryza sativa chromosome 3 BAC OSJNBb0058G04 genom... 40 8.7
196gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 40 8.7
197ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 8.7
198gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 8.7
199gb|AC145376.3| Pan troglodytes BAC clone RP43-59A12 from 7, comp... 40 8.7
200ref|XM_656638.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 8.7
201gb|AY756174.4| Oryza rufipogon putative leucine-rich repeat rece... 40 8.7
202gb|AC102374.7| Mus musculus chromosome 1, clone RP23-278G2, comp... 40 8.7
203gb|AF523823.1| Streptomyces chromofuscus phospholipase D precurs... 40 8.7
204gb|AC135563.5| Oryza sativa chromosome 3 BAC OSJNBb0015I02 genom... 40 8.7
205ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquapori... 40 8.7
206emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete ch... 40 8.7
207gb|CP000284.1| Methylobacillus flagellatus KT, complete genome 40 8.7
208gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 8.7
209emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chr... 40 8.7
210gb|AC090498.4| Homo sapiens chromosome 7 clone RP11-84E17, compl... 40 8.7
211gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 8.7
212gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Can... 40 8.7
213emb|BX842582.1| Mycobacterium tuberculosis H37Rv complete genome... 40 8.7
214emb|BX842576.1| Mycobacterium tuberculosis H37Rv complete genome... 40 8.7
215emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome... 40 8.7
216emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genom... 40 8.7
217emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 8.7
218emb|BX248335.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 8.7
219emb|BX248338.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 8.7
220emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 40 8.7
221emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 40 8.7
222emb|AL954726.31| Zebrafish DNA sequence from clone CH211-274A9 i... 40 8.7
223gb|AC010068.8| Drosophila melanogaster 3L BAC RP98-15K24 (Roswel... 40 8.7
224gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 8.7
225gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswel... 40 8.7
226gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of... 40 8.7
227gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 8.7
228ref|NM_141113.2| Drosophila melanogaster CG7442-RA (CG7442), mRNA 40 8.7
229gb|AY027524.1| Frankia sp. CpI1 plasmid pFQ12, complete plasmid ... 40 8.7
230gb|AF290617.1|AF290617 Nicotiana glauca putative delta TIP (MIP1... 40 8.7
231dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
232dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
233gb|BC093081.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypepti... 40 8.7
234gb|AF275315.1|AF275315 Lotus japonicus water-selective transport... 40 8.7
235dbj|AP004797.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
236dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 8.7
237dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 8.7
238dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
239dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
240dbj|AP007224.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
241emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene... 40 8.7
242dbj|AP005872.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
243dbj|AP005542.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
244dbj|AP003911.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.7
245dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri... 40 8.7
246ref|XM_314891.2| Anopheles gambiae str. PEST ENSANGP00000012352 ... 40 8.7
247dbj|AK109762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.7
248gb|AC009999.2|T20M3 Sequence of BAC T20M3 from Arabidopsis thali... 40 8.7
249dbj|AK073605.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.7
250gb|AE003596.5| Drosophila melanogaster chromosome 3L, section 77... 40 8.7
251gb|BT001724.1| Drosophila melanogaster RE69557 full insert cDNA 40 8.7
252emb|AL935066.2|CNS08CCI Oryza sativa chromosome 12, . BAC OSJNBa... 40 8.7
253dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 8.7
254dbj|D10335.1|RICADKB Oryza sativa mRNA for adenylate kinase-b, c... 40 8.7

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  385 bits (194), Expect = e-103
 Identities = 287/318 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 tcagtactcggcggtggggagctgctcgtgtggacgctggccgatgaagcagatgtcgta 376
           |||||| ||||||||||| ||||| ||||| || |||||||||||||||  |||||||||
Sbjct: 759 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 700

                                                                       
Query: 377 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 436
           || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||
Sbjct: 699 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 640

                                                                       
Query: 437 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
           |||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 639 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 580

                                                                       
Query: 497 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
            ||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 579 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 520

                                                                       
Query: 557 caccccgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagccc 616
            || |||||||||||   |||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 519 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggcc 460

                             
Query: 617 gaaggtcatgacgatctc 634
           ||||||||||||||||||
Sbjct: 459 gaaggtcatgacgatctc 442



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  385 bits (194), Expect = e-103
 Identities = 287/318 (90%)
 Strand = Plus / Plus

                                                                            
Query: 317      tcagtactcggcggtggggagctgctcgtgtggacgctggccgatgaagcagatgtcgta 376
                |||||| ||||||||||| ||||| ||||| || |||||||||||||||  |||||||||
Sbjct: 43108668 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 43108727

                                                                            
Query: 377      gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 436
                || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||
Sbjct: 43108728 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 43108787

                                                                            
Query: 437      ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
                |||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 43108788 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 43108847

                                                                            
Query: 497      aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
                 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 43108848 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 43108907

                                                                            
Query: 557      caccccgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagccc 616
                 || |||||||||||   |||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 43108908 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggcc 43108967

                                  
Query: 617      gaaggtcatgacgatctc 634
                ||||||||||||||||||
Sbjct: 43108968 gaaggtcatgacgatctc 43108985



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                           
Query: 459     gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 518
               ||||||||||||  ||| ||||||||||| ||||||    |||  |||||||| ||||||
Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412

                                     
Query: 519     ttggcgccgacgatgaagccga 540
               ||||||||||||| || |||||
Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 385     cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
               |||||| | ||||||||  |||||| ||||||||||||||||||||||
Sbjct: 6644923 cggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 381     agggcggcgatggcggcgccggcg 404
               |||||||||||||||||| |||||
Sbjct: 3810342 agggcggcgatggcggcggcggcg 3810319



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score =  385 bits (194), Expect = e-103
 Identities = 287/318 (90%)
 Strand = Plus / Plus

                                                                          
Query: 317    tcagtactcggcggtggggagctgctcgtgtggacgctggccgatgaagcagatgtcgta 376
              |||||| ||||||||||| ||||| ||||| || |||||||||||||||  |||||||||
Sbjct: 105697 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 105756

                                                                          
Query: 377    gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 436
              || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||
Sbjct: 105757 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 105816

                                                                          
Query: 437    ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
              |||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 105817 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 105876

                                                                          
Query: 497    aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
               ||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 105877 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 105936

                                                                          
Query: 557    caccccgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagccc 616
               || |||||||||||   |||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 105937 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggcc 105996

                                
Query: 617    gaaggtcatgacgatctc 634
              ||||||||||||||||||
Sbjct: 105997 gaaggtcatgacgatctc 106014



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score =  385 bits (194), Expect = e-103
 Identities = 287/318 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 tcagtactcggcggtggggagctgctcgtgtggacgctggccgatgaagcagatgtcgta 376
           |||||| ||||||||||| ||||| ||||| || |||||||||||||||  |||||||||
Sbjct: 783 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 724

                                                                       
Query: 377 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 436
           || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||
Sbjct: 723 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 664

                                                                       
Query: 437 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
           |||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 663 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 604

                                                                       
Query: 497 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
            ||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 603 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 544

                                                                       
Query: 557 caccccgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagccc 616
            || |||||||||||   |||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 543 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggcc 484

                             
Query: 617 gaaggtcatgacgatctc 634
           ||||||||||||||||||
Sbjct: 483 gaaggtcatgacgatctc 466



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score =  385 bits (194), Expect = e-103
 Identities = 287/318 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 tcagtactcggcggtggggagctgctcgtgtggacgctggccgatgaagcagatgtcgta 376
           |||||| ||||||||||| ||||| ||||| || |||||||||||||||  |||||||||
Sbjct: 832 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 773

                                                                       
Query: 377 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 436
           || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||
Sbjct: 772 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 713

                                                                       
Query: 437 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
           |||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 712 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 653

                                                                       
Query: 497 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
            ||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 652 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 593

                                                                       
Query: 557 caccccgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagccc 616
            || |||||||||||   |||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 592 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggcc 533

                             
Query: 617 gaaggtcatgacgatctc 634
           ||||||||||||||||||
Sbjct: 532 gaaggtcatgacgatctc 515



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score =  385 bits (194), Expect = e-103
 Identities = 287/318 (90%)
 Strand = Plus / Minus

                                                                       
Query: 317 tcagtactcggcggtggggagctgctcgtgtggacgctggccgatgaagcagatgtcgta 376
           |||||| ||||||||||| ||||| ||||| || |||||||||||||||  |||||||||
Sbjct: 769 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 710

                                                                       
Query: 377 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 436
           || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| ||
Sbjct: 709 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 650

                                                                       
Query: 437 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
           |||||| ||| |||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 649 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 590

                                                                       
Query: 497 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
            ||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 589 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 530

                                                                       
Query: 557 caccccgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagccc 616
            || |||||||||||   |||||| ||||| || ||||||||||| ||||| ||||| ||
Sbjct: 529 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggcc 470

                             
Query: 617 gaaggtcatgacgatctc 634
           ||||||||||||||||||
Sbjct: 469 gaaggtcatgacgatctc 452



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score =  363 bits (183), Expect = 5e-97
 Identities = 270/299 (90%)
 Strand = Plus / Minus

                                                                       
Query: 336 agctgctcgtgtggacgctggccgatgaagcagatgtcgtagacgagggcggcgatggcg 395
           ||||||| |||||| ||||| |||||||||  ||||||||||||||| || |||||||| 
Sbjct: 754 agctgctggtgtgggcgctgcccgatgaagatgatgtcgtagacgagcgccgcgatggcc 695

                                                                       
Query: 396 gcgccggcgaaggggccgagccagtacacccagtggttctcccagacgccgctgaccacg 455
           ||||| ||||  ||||||| ||||||||||||||||||||||||||||||| |||| |||
Sbjct: 694 gcgcccgcgagtgggccgacccagtacacccagtggttctcccagacgccggtgacgacg 635

                                                                       
Query: 456 gcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccagg 515
           || ||||||||||||||||||||||||||||| |||||||| ||||| || || ||||||
Sbjct: 634 gccgggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccccccgccagg 575

                                                                       
Query: 516 atgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgc 575
           ||||||||||||||||||||||||||||||||||||||||| || |||||||||||   |
Sbjct: 574 atgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttc 515

                                                                      
Query: 576 ttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| |||||||||||||| ||||||||||| |||||||||||||| |||||
Sbjct: 514 ttggggtccacggccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctc 456



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score =  313 bits (158), Expect = 4e-82
 Identities = 250/283 (88%)
 Strand = Plus / Plus

                                                                       
Query: 352 gctggccgatgaagcagatgtcgtagacgagggcggcgatggcggcgccggcgaaggggc 411
           |||| |||||||||  ||||||||||||||| || |||||||| ||||| ||||  ||||
Sbjct: 273 gctgcccgatgaagatgatgtcgtagacgagcgccgcgatggccgcgcccgcgagtgggc 332

                                                                       
Query: 412 cgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggaga 471
           ||| ||||||||||||||||||||||||||||||| |||| || || |||||||||||||
Sbjct: 333 cgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaaggaga 392

                                                                       
Query: 472 cggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacga 531
           |||||| ||||||||| |||||||| |||||       ||||||||||||||||||||||
Sbjct: 393 cggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccgacga 452

                                                                       
Query: 532 tgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccg 591
           ||||||||||||||||||||||||| || |||||||||||   |||||||||||| ||||
Sbjct: 453 tgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacggccg 512

                                                      
Query: 592 tggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||||| ||||||||||| |||||||||||||| |||||
Sbjct: 513 tggcgtacaccgtgtacacgaggccgaaggtcatgaccatctc 555



to top

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  206 bits (104), Expect = 6e-50
 Identities = 197/228 (86%)
 Strand = Plus / Minus

                                                                       
Query: 407 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 466
           |||||||| |||||||||||| |||| | ||||  | | |||||| | ||||||||||||
Sbjct: 729 ggggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaa 670

                                                                       
Query: 467 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 526
           ||||||||||||||||||||||||||||   ||||| |||||| | ||||||||||||||
Sbjct: 669 ggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgcc 610

                                                                       
Query: 527 gacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccac 586
           ||||||||||||||||||||||||||||||    || |||  |||   ||||||||| ||
Sbjct: 609 gacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgac 550

                                                           
Query: 587 agccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
            || ||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 549 ggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 502



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 814 agtagtcggtggtggggagctgctcgtg 787



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  206 bits (104), Expect = 6e-50
 Identities = 197/228 (86%)
 Strand = Plus / Minus

                                                                       
Query: 407 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 466
           |||||||| |||||||||||| |||| | ||||  | | |||||| | ||||||||||||
Sbjct: 760 ggggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaa 701

                                                                       
Query: 467 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 526
           ||||||||||||||||||||||||||||   ||||| |||||  ||||||||||||||||
Sbjct: 700 ggagacggcggggttcatggacgcgccggagaaggcgccgcccaccaggatgttggcgcc 641

                                                                       
Query: 527 gacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccac 586
            |||||||||||||||||||||||||||||    || |||  |||   ||||||||||||
Sbjct: 640 cacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtccac 581

                                                           
Query: 587 agccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
            |||||||||||||| |||||||| |||||||||||||| ||||||||
Sbjct: 580 ggccgtggcgtacaccgtgtacaccagcccgaaggtcatcacgatctc 533



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 317 tcagtactcggcggtggggagctgctcgtg 346
           |||||| |||| ||||||||||||||||||
Sbjct: 847 tcagtagtcggtggtggggagctgctcgtg 818



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  182 bits (92), Expect = 9e-43
 Identities = 194/228 (85%)
 Strand = Plus / Minus

                                                                       
Query: 407 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 466
           |||||||| |||||||||||| ||||   ||||  | | |||||| | ||||||||||||
Sbjct: 667 ggggccgacccagtacacccactggtagccccactcccagctgacgagggcggggccgaa 608

                                                                       
Query: 467 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 526
           ||| |||||||||||||||||||||||||| ||||| |||||  ||||||||||||| ||
Sbjct: 607 ggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccc 548

                                                                       
Query: 527 gacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccac 586
            ||||||||||||||||||||||| |||||    || |||  |||   ||| ||||||||
Sbjct: 547 cacgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccac 488

                                                           
Query: 587 agccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
            |||||||||||||| |||||||| |||||||||||||| ||||||||
Sbjct: 487 cgccgtggcgtacaccgtgtacaccagcccgaaggtcatcacgatctc 440



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score =  176 bits (89), Expect = 6e-41
 Identities = 164/189 (86%)
 Strand = Plus / Minus

                                                                       
Query: 446 gctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctcc 505
           |||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||| ||
Sbjct: 724 gctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgcc 665

                                                                       
Query: 506 gccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgag 565
           |||  |||||||||||||||| ||||||||||||||||||||||| |||||    || ||
Sbjct: 664 gcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggtgcccag 605

                                                                       
Query: 566 gtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcat 625
           |  |||   ||| |||||||| ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 604 gctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaaggtcat 545

                    
Query: 626 gacgatctc 634
            ||||||||
Sbjct: 544 cacgatctc 536



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  172 bits (87), Expect = 9e-40
 Identities = 192/227 (84%)
 Strand = Plus / Minus

                                                                       
Query: 408 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 467
           ||||||| |||||||||||||||||| | ||||   | |||||| |  | ||||||||||
Sbjct: 744 gggccgacccagtacacccagtggttgttccaggaccagctgacgagcgaggggccgaag 685

                                                                       
Query: 468 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 527
           || |||||||||||||||||||||||||| ||||| |||||| | |||||||||||||| 
Sbjct: 684 gacacggcggggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgccc 625

                                                                       
Query: 528 acgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccaca 587
           ||||||||||||||||||||||| |||||    || |||  |||   ||||||||| || 
Sbjct: 624 acgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgacc 565

                                                          
Query: 588 gccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           || ||||||||||| |||||||| || ||||||||||| ||||||||
Sbjct: 564 gcggtggcgtacacagtgtacaccagaccgaaggtcatcacgatctc 518



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 833 agtagtcggtggtggggagctgctcgtg 806



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score =  168 bits (85), Expect = 1e-38
 Identities = 163/189 (86%)
 Strand = Plus / Minus

                                                                       
Query: 446 gctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctcc 505
           |||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||| ||
Sbjct: 720 gctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgcc 661

                                                                       
Query: 506 gccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgag 565
           |||  ||||||||||||| || ||||||||||||||||| ||||| |||||    || ||
Sbjct: 660 gcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggtgcccag 601

                                                                       
Query: 566 gtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcat 625
           |  |||   ||| |||||||| |||||||||||||| |||||||| ||||||||||||||
Sbjct: 600 gctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaaggtcat 541

                    
Query: 626 gacgatctc 634
            ||||||||
Sbjct: 540 cacgatctc 532



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score =  167 bits (84), Expect = 6e-38
 Identities = 192/228 (84%)
 Strand = Plus / Minus

                                                                       
Query: 407 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 466
           |||||||| |||||||||||| ||||   ||||  | | |||||| | ||||||||||||
Sbjct: 762 ggggccgacccagtacacccactggtagccccactcccagctgacgagggcggggccgaa 703

                                                                       
Query: 467 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 526
           ||| |||||||||||||||||||||||||| ||||| |||||  ||||||||||||| ||
Sbjct: 702 ggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccc 643

                                                                       
Query: 527 gacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccac 586
            ||||||||||||||||| ||||| |||||    || |||  |||   ||| ||||||||
Sbjct: 642 cacgatgaagccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccac 583

                                                           
Query: 587 agccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
            ||||| |||||||| |||||||| |||||||||||||| ||||||||
Sbjct: 582 cgccgtcgcgtacaccgtgtacaccagcccgaaggtcatcacgatctc 535



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 657 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 598

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 597 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 538

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 537 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 478

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 477 gtacacggtgtagacgaggccgaaggtcatgacgatctc 439



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 751 agtagtcggtggtggggagctgctcgtg 724



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Plus

                                                                           
Query: 416     ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
               |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 2544825 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 2544884

                                                                           
Query: 476     ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
                ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 2544885 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 2544944

                                                                           
Query: 536     gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
               ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 2544945 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 2545004

                                                      
Query: 596     gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
               |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 2545005 gtacacggtgtagacgaggccgaaggtcatgacgatctc 2545043



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 392      ggcggcgccggcgaaggggcc 412
                |||||||||||||||||||||
Sbjct: 36057600 ggcggcgccggcgaaggggcc 36057580



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 383      ggcggcgatggcggcgccggcgaagggg 410
                |||||||||||||| | |||||||||||
Sbjct: 33259902 ggcggcgatggcgggggcggcgaagggg 33259929



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 383      ggcggcgatggcggcgccggcgaagggg 410
                |||||||||||||||| |||||| ||||
Sbjct: 15248524 ggcggcgatggcggcggcggcgaggggg 15248497



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 319     agtactcggcggtggggagctgctcgtg 346
               |||| |||| ||||||||||||||||||
Sbjct: 2544731 agtagtcggtggtggggagctgctcgtg 2544758



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                          
Query: 416    ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
              |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 125269 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 125210

                                                                          
Query: 476    ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
               ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 125209 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 125150

                                                                          
Query: 536    gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
              ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 125149 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 125090

                                                     
Query: 596    gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
              |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 125089 gtacacggtgtagacgaggccgaaggtcatgacgatctc 125051



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 319    agtactcggcggtggggagctgctcgtg 346
              |||| |||| ||||||||||||||||||
Sbjct: 125363 agtagtcggtggtggggagctgctcgtg 125336



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Plus

                                                                           
Query: 416     ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
               |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 2544935 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 2544994

                                                                           
Query: 476     ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
                ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 2544995 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 2545054

                                                                           
Query: 536     gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
               ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 2545055 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 2545114

                                                      
Query: 596     gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
               |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 2545115 gtacacggtgtagacgaggccgaaggtcatgacgatctc 2545153



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 392      ggcggcgccggcgaaggggcc 412
                |||||||||||||||||||||
Sbjct: 36147674 ggcggcgccggcgaaggggcc 36147654



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 383      ggcggcgatggcggcgccggcgaagggg 410
                |||||||||||||| | |||||||||||
Sbjct: 33350412 ggcggcgatggcgggggcggcgaagggg 33350439



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 383      ggcggcgatggcggcgccggcgaagggg 410
                |||||||||||||||| |||||| ||||
Sbjct: 15243058 ggcggcgatggcggcggcggcgaggggg 15243031



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 319     agtactcggcggtggggagctgctcgtg 346
               |||| |||| ||||||||||||||||||
Sbjct: 2544841 agtagtcggtggtggggagctgctcgtg 2544868



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 735 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 676

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 675 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 616

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 615 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 556

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 555 gtacacggtgtagacgaggccgaaggtcatgacgatctc 517



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 829 agtagtcggtggtggggagctgctcgtg 802



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Plus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 234 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 293

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 294 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 353

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 354 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 413

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 414 gtacacggtgtagacgaggccgaaggtcatgacgatctc 452



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 182 agtagtcggtggtggggagctgctcgtg 209



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 744 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 685

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 684 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 625

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 624 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 565

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 564 gtacacggtgtagacgaggccgaaggtcatgacgatctc 526



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 838 agtagtcggtggtggggagctgctcgtg 811



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 746 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 687

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 686 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 627

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 626 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 567

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 566 gtacacggtgtagacgaggccgaaggtcatgacgatctc 528



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 840 agtagtcggtggtggggagctgctcgtg 813



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 270 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 211

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 210 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 151

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 150 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 91

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 90  gtacacggtgtagacgaggccgaaggtcatgacgatctc 52



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 364 agtagtcggtggtggggagctgctcgtg 337



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  165 bits (83), Expect = 2e-37
 Identities = 185/219 (84%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||||||||| |||  |||||||   | |||||| | ||| |||||||||||||||||
Sbjct: 742 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 683

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            ||||||||||| |||||||| || || |||||| | |||||||| ||||||||||||||
Sbjct: 682 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 623

                                                                       
Query: 536 gccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagccgtggc 595
           ||||||||||||||| |||||    ||||||  |||   ||||||||| || || |||||
Sbjct: 622 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 563

                                                  
Query: 596 gtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 562 gtacacggtgtagacgaggccgaaggtcatgacgatctc 524



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 836 agtagtcggtggtggggagctgctcgtg 809



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score =  137 bits (69), Expect = 5e-29
 Identities = 147/173 (84%)
 Strand = Plus / Minus

                                                                       
Query: 462 ccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttg 521
           |||||||| || || |||||||| ||||| ||||| ||||| ||||||||||||||||||
Sbjct: 607 ccgaaggacaccgccgggttcatcgacgccccgtcgaaggccccgccggccaggatgttg 548

                                                                       
Query: 522 gcgccgacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttgggg 581
           || || |||||||||||||| |||||||||||||||  ||| |||   ||   ||| |||
Sbjct: 547 gcccccacgatgaagccgatcgcgatgggcgcgatcgtccccaggctccccttcttcggg 488

                                                                
Query: 582 tccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           || |  || ||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 487 tcaatggcggtggcgtacacggtgtagacgagcccgaaggtcatgacgatctc 435



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  133 bits (67), Expect = 8e-28
 Identities = 156/183 (85%), Gaps = 2/183 (1%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccg-tcaaaggctccgccggc 511
           ||||||||||||||||||  |||||||||||||||  ||||| | || ||| |||| |||
Sbjct: 684 acggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgc-ggc 626

                                                                       
Query: 512 caggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgcc 571
            ||||||||||||||||||||||||||||||||||||||||||||    ||||||  |||
Sbjct: 625 gaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagcc 566

                                                                       
Query: 572 gcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgat 631
              |||||||||  | || ||||||||||| ||||| |||||| ||||||| ||||||||
Sbjct: 565 cttcttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacgat 506

              
Query: 632 ctc 634
           |||
Sbjct: 505 ctc 503



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  117 bits (59), Expect = 5e-23
 Identities = 151/179 (84%), Gaps = 2/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccg-tcaaaggctccgccggc 511
           ||||||||||||||||||  |||||||||||||||  ||||| | || ||| |||| |||
Sbjct: 841 acggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgc-ggc 783

                                                                       
Query: 512 caggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgcc 571
            ||||||||||||||||||||||||||||||||||||||||||||    |||||   |||
Sbjct: 782 gaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagcc 723

                                                                      
Query: 572 gcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
              |||||||||  | || ||||||||||| ||||| |||||| ||||||| |||||||
Sbjct: 722 cttcttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 664



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  117 bits (59), Expect = 5e-23
 Identities = 151/179 (84%), Gaps = 2/179 (1%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccg-tcaaaggctccgccggc 511
           ||||||||||||||||||  |||||||||||||||  ||||| | || ||| |||| |||
Sbjct: 840 acggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgc-ggc 782

                                                                       
Query: 512 caggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgcc 571
            ||||||||||||||||||||||||||||||||||||||||||||    |||||   |||
Sbjct: 781 gaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagcc 722

                                                                      
Query: 572 gcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
              |||||||||  | || ||||||||||| ||||| |||||| ||||||| |||||||
Sbjct: 721 cttcttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 663



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  115 bits (58), Expect = 2e-22
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 451 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 510
           ||||||||||||||||||||  ||| |||||||||||  |||||   ||||  ||| |||
Sbjct: 619 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 560

                                                         
Query: 511 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 559 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 514



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| |||||||| ||| ||||||| || ||||||||
Sbjct: 479 gtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 436



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 453 acggcggggccgaaggagacggcggggttca 483
           |||||| ||||||||| ||||||||||||||
Sbjct: 278 acggcgaggccgaaggtgacggcggggttca 248



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 397 cgccggcgaaggggccgagccagtacacccagt 429
           ||||| ||| |||||||| ||||||||||||||
Sbjct: 673 cgccgacgagggggccgacccagtacacccagt 641



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  115 bits (58), Expect = 2e-22
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 451 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 510
           ||||||||||||||||||||  ||| |||||||||||  |||||   ||||  ||| |||
Sbjct: 687 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 628

                                                         
Query: 511 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 627 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 582



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| |||||||| ||| ||||||| || ||||||||
Sbjct: 547 gtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 504



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 453 acggcggggccgaaggagacggcggggttca 483
           |||||| ||||||||| ||||||||||||||
Sbjct: 346 acggcgaggccgaaggtgacggcggggttca 316



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 397 cgccggcgaaggggccgagccagtacacccagt 429
           ||||| ||| |||||||| ||||||||||||||
Sbjct: 741 cgccgacgagggggccgacccagtacacccagt 709



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  115 bits (58), Expect = 2e-22
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 451 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 510
           ||||||||||||||||||||  ||| |||||||||||  |||||   ||||  ||| |||
Sbjct: 696 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 637

                                                         
Query: 511 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 636 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 591



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 453 acggcggggccgaaggagacggcggggttca 483
           |||||| ||||||||| ||||||||||||||
Sbjct: 355 acggcgaggccgaaggtgacggcggggttca 325



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 397 cgccggcgaaggggccgagccagtacacccagt 429
           ||||| ||| |||||||| ||||||||||||||
Sbjct: 750 cgccgacgagggggccgacccagtacacccagt 718



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| |||||||| ||  ||||||| || ||||||||
Sbjct: 556 gtggcgtacacggtgtacaccagagcgaaggtgatcacgatctc 513



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  115 bits (58), Expect = 2e-22
 Identities = 94/106 (88%)
 Strand = Plus / Minus

                                                                       
Query: 451 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 510
           ||||||||||||||||||||  ||| |||||||||||  |||||   ||||  ||| |||
Sbjct: 678 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 619

                                                         
Query: 511 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 618 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 573



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| |||||||| ||| ||||||| || ||||||||
Sbjct: 538 gtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 495



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 453 acggcggggccgaaggagacggcggggttca 483
           |||||| ||||||||| ||||||||||||||
Sbjct: 337 acggcgaggccgaaggtgacggcggggttca 307



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 397 cgccggcgaaggggccgagccagtacacccagt 429
           ||||| ||| |||||||| ||||||||||||||
Sbjct: 732 cgccgacgagggggccgacccagtacacccagt 700



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                            
Query: 442      cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
                |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 13251014 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 13250955

                                                                       
Query: 502      ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
                  ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13250954 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 13250900



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                     
Query: 395     ggcgccggcgaaggggccgagccagtacacccagtggt 432
               |||||||  ||||||||||||| |||||||||||||||
Sbjct: 1762730 ggcgccgatgaaggggccgagctagtacacccagtggt 1762693



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                                
Query: 591      gtggcgtacactgtgtacacgagcccgaaggt 622
                ||||||||||| |||||||| |||||||||||
Sbjct: 13250865 gtggcgtacacggtgtacaccagcccgaaggt 13250834



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 383      ggcggcgatggcggcgccgg 402
                ||||||||||||||||||||
Sbjct: 28065834 ggcggcgatggcggcgccgg 28065853



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 383      ggcggcgatggcggcgccgg 402
                ||||||||||||||||||||
Sbjct: 28023111 ggcggcgatggcggcgccgg 28023092



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 524      gccgacgatgaagccgatggcgat 547
                ||||| ||||||||||||||||||
Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                         
Query: 442   cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
             |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 12824 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 12765

                                                                    
Query: 502   ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
               ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 12764 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 12710



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 591   gtggcgtacactgtgtacacgagcccgaaggt 622
             ||||||||||| |||||||| |||||||||||
Sbjct: 12675 gtggcgtacacggtgtacaccagcccgaaggt 12644



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                          
Query: 442    cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
              |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 168202 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 168143

                                                                     
Query: 502    ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
                ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 168142 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 168088



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 591    gtggcgtacactgtgtacacgagcccgaaggt 622
              ||||||||||| |||||||| |||||||||||
Sbjct: 168053 gtggcgtacacggtgtacaccagcccgaaggt 168022



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 714 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 655

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 654 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 600



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 565 gtggcgtacacggtgtacaccagcccgaaggt 534



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 716 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 657

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 656 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 602



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 567 gtggcgtacacggtgtacaccagcccgaaggt 536



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 594 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 535

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 534 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 480



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 445 gtggcgtacacggtgtacaccagcccgaaggt 414



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 717 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 658

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 657 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 603



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 568 gtggcgtacacggtgtacaccagcccgaaggt 537



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 715 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 656

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 655 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 601



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 566 gtggcgtacacggtgtacaccagcccgaaggt 535



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 717 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 658

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 657 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 603



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 568 gtggcgtacacggtgtacaccagcccgaaggt 537



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  101 bits (51), Expect = 3e-18
 Identities = 99/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||  |||||   ||||
Sbjct: 715 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 656

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 655 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 601



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 566 gtggcgtacacggtgtacaccagcccgaaggt 535



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 148/181 (81%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||| |||||   ||||
Sbjct: 676 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagg 617

                                                                       
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccc 561
             ||| || | ||||||||||||||||||||||||||||||||||| || |||||    |
Sbjct: 616 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatggtgc 557

                                                                       
Query: 562 cgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaagg 621
           |||||   ||   |||||||||  | || ||||||||||| ||||| |||||||||||||
Sbjct: 556 cgagggaccccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaagg 497

            
Query: 622 t 622
           |
Sbjct: 496 t 496



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 148/181 (81%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||| |||||   ||||
Sbjct: 679 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagg 620

                                                                       
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccc 561
             ||| |  | |||||||||||||||||||||||||||||||||||||| |||||    |
Sbjct: 619 ggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgc 560

                                                                       
Query: 562 cgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaagg 621
           |||||   ||   |||||||||  | || ||||||||||| ||||| |||||||||||||
Sbjct: 559 cgagggaacccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaagg 500

            
Query: 622 t 622
           |
Sbjct: 499 t 499



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 148/181 (81%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||| |||||   ||||
Sbjct: 680 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagg 621

                                                                       
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccc 561
             ||| |  | |||||||||||||||||||||||||||||||||||||| |||||    |
Sbjct: 620 ggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgc 561

                                                                       
Query: 562 cgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaagg 621
           |||||   ||   |||||||||  | || ||||||||||| ||||| |||||||||||||
Sbjct: 560 cgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaagg 501

            
Query: 622 t 622
           |
Sbjct: 500 t 500



to top

>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI)
           mRNA, complete cds
          Length = 1035

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 183/225 (81%), Gaps = 2/225 (0%)
 Strand = Plus / Minus

                                                                       
Query: 411 ccgagccagtacacccagtggttctccca-gacgccgctgaccacggcggggccgaagga 469
           ||||||||||| ||||||||||| | ||| ||| | |||||| || || |||||||||||
Sbjct: 735 ccgagccagtagacccagtggttgttccatgac-cagctgacaacagcagggccgaagga 677

                                                                       
Query: 470 gacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgac 529
            || || ||||||||||| || ||||||||||| || || |||| |||||||||| | ||
Sbjct: 676 cactgcagggttcatggatgcaccgtcaaaggcaccaccagccaagatgttggcggccac 617

                                                                       
Query: 530 gatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagc 589
            ||||  |||||||| | ||| || || | ||||| ||| ||   ||||||||| |||||
Sbjct: 616 aatgagaccgatggccaagggggcaatgatcccgatgtcacccttcttggggtcaacagc 557

                                                        
Query: 590 cgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
            |||||||| || ||||| || |||||||||||||| || |||||
Sbjct: 556 agtggcgtagacggtgtagacaagcccgaaggtcatcacaatctc 512



to top

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 148/181 (81%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | ||||||||||||||||||   || |||||||||||| |||||  |||||
Sbjct: 682 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggaaaagg 623

                                                                       
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccc 561
             ||| |  | ||||||||||||||||| |||||||||||||||||||| |||||    |
Sbjct: 622 ggccggccacgaggatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgc 563

                                                                       
Query: 562 cgaggtcgccgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaagg 621
           |||||   ||   |||||||||  | || ||||||||||| ||||| |||||||||||||
Sbjct: 562 cgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaagg 503

            
Query: 622 t 622
           |
Sbjct: 502 t 502



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 501
           |||||||| | |||||||| |||||||||   || |||||||||||  |||||   ||||
Sbjct: 716 cgccgctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaagg 657

                                                                  
Query: 502 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||| || | ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 656 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 602



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 591 gtggcgtacactgtgtacacgagcccgaaggt 622
           ||||||||||| |||||||| |||||||||||
Sbjct: 567 gtggcgtacacggtgtacaccagcccgaaggt 536



to top

>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein,
           complete cds
          Length = 1122

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           |||||| ||||||||||||||||||   | ||| ||||  || || ||||| || |||||
Sbjct: 731 ccagtagacccagtggttctcccagctccagctcaccaacgccggcccgaangaaacggc 672

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
            |||||||||||||| |||||||| || || || ||||  ||||||||||| ||||||||
Sbjct: 671 cgggttcatggacgctccgtcaaaagccccacccgccaaaatgttggcgccaacgatgaa 612

                                
Query: 536 gccgatggcgatgggcgcgat 556
            || || ||||||||||||||
Sbjct: 611 accaatcgcgatgggcgcgat 591



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
           ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 614 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 555

                                                       
Query: 513 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 554 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 511



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 579 gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 488 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 433



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                            
Query: 453      acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
                ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 26627252 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 26627311

                                                            
Query: 513      aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
                ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 26627312 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 26627355



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                        
Query: 579      gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
                |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 26627378 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 26627433



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 379     cgagggcggcgatggcggcg 398
               ||||||||||||||||||||
Sbjct: 2927635 cgagggcggcgatggcggcg 2927616



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 149/184 (80%)
 Strand = Plus / Minus

                                                                         
Query: 451   ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 510
             ||||||| || |||||||||   || |||||||||||  |||||   ||||  ||| |||
Sbjct: 44845 ccacggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcgg 44786

                                                                         
Query: 511   ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatcaccccgaggtcgc 570
             | ||||||||||||||||||||||||||||| || |||||||||||    ||||||  ||
Sbjct: 44785 cgaggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagc 44726

                                                                         
Query: 571   cgcgcttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
             |   |||||||||  | ||||| |||||||| |||||||| ||| ||||||| || ||||
Sbjct: 44725 ccttcttggggtcggccgccgtcgcgtacaccgtgtacaccagcgcgaaggtgatcacga 44666

                 
Query: 631   tctc 634
             ||||
Sbjct: 44665 tctc 44662



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                          
Query: 453    acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
              ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 169633 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 169692

                                                          
Query: 513    aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
              ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 169693 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 169736



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 579    gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
              |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 169759 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 169814



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Plus

                                                                         
Query: 453   acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
             ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 61413 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 61472

                                                         
Query: 513   aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 61473 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 61516



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 579   gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
             |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 61539 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 61594



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
           ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 687 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 628

                                                       
Query: 513 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 627 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 584



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 579 gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 561 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 506



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
           ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 489 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 430

                                                       
Query: 513 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 429 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 386



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 579 gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 363 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 308



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                          
Query: 453    acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 512
              ||||||||||||||||||   || |||||||||||  |||||   || |  ||| |||| 
Sbjct: 250582 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 250523

                                                          
Query: 513    aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
              ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 250522 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 250479



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                               
Query: 508    cggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
              |||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 332121 cggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 332169



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 579    gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
              |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 332192 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 332247



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 579    gggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
              |||||| | |||||||||||||| |||||||| ||| |||| || |||||||||||
Sbjct: 250456 gggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 250401



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Minus

                                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg-ctccgccggc 511
           ||||| ||||||||||||  ||| |||||||||||   ||||  ||||| | |||||| |
Sbjct: 617 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccg-c 559

                                                       
Query: 512 caggatgttggcgccgacgatgaagccgatggcgatgggcgcga 555
           |||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 558 caggatgttggcaccgacgatgaagccgatggccatgggcgcga 515



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 588 gccgtggcgtacactgtgtacacgagcccgaa 619
           |||||||||||||| |||||||| ||| ||||
Sbjct: 482 gccgtggcgtacaccgtgtacaccagcgcgaa 451



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Plus

                                                                         
Query: 453   acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg-ctccgccggc 511
             ||||| ||||||||||||  ||| |||||||||||   ||||  ||||| | |||||| |
Sbjct: 92562 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccg-c 92620

                                                         
Query: 512   caggatgttggcgccgacgatgaagccgatggcgatgggcgcga 555
             |||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 92621 caggatgttggcaccgacgatgaagccgatggccatgggcgcga 92664



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 588   gccgtggcgtacactgtgtacacgagcccgaa 619
             |||||||||||||| |||||||| ||| ||||
Sbjct: 92697 gccgtggcgtacaccgtgtacaccagcgcgaa 92728



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 90/104 (86%), Gaps = 2/104 (1%)
 Strand = Plus / Plus

                                                                            
Query: 453      acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg-ctccgccggc 511
                ||||| ||||||||||||  ||| |||||||||||   ||||  ||||| | |||||| |
Sbjct: 27568586 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccg-c 27568644

                                                            
Query: 512      caggatgttggcgccgacgatgaagccgatggcgatgggcgcga 555
                |||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 27568645 caggatgttggcaccgacgatgaagccgatggccatgggcgcga 27568688



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                        
Query: 591      gtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
                ||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 26354639 gtggcgtacacggtgtacacgagcccgaacgtcatgacga 26354600



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                            
Query: 477      gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 536
                |||||||||| ||||||||| || |  || ||||| |||||||| |||||  |||  |||
Sbjct: 26354750 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 26354691

                                 
Query: 537      ccgatggcgatgggcgc 553
                |||||||||| ||||||
Sbjct: 26354690 ccgatggcgaggggcgc 26354674



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 588      gccgtggcgtacactgtgtacacgagcccgaa 619
                |||||||||||||| |||||||| ||| ||||
Sbjct: 27568721 gccgtggcgtacaccgtgtacaccagcgcgaa 27568752



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 133/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 471 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 530
           ||||| ||||||||||| ||||||   || ||||| ||||| |||||||| || || |||
Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429

                                                                       
Query: 531 atgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagcc 590
           ||||| || |||||||| || |||||    |||||   ||||  ||||||||| || || 
Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 368 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 325



to top

>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast
           intrinsic protein (OSJNBa0051D19.19), mRNA
          Length = 1186

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 385 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
           |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 854 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 807



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 507 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 732 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 683



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                             
Query: 385   cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
             |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 26109 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 26156



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 507   ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
             ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 26231 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 26280



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 385      cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
                |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 18187019 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 18186972



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                  
Query: 507      ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
                ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 18186897 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 18186848



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 377      gacgagggcggcgatggcggcgccg 401
                ||||||||||||||||| |||||||
Sbjct: 14249963 gacgagggcggcgatggtggcgccg 14249987



to top

>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full
           insert sequence
          Length = 1200

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 385 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
           |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 863 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 816



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 507 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 741 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 692



to top

>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1178

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 385 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
           |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 846 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 799



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 507 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 724 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 675



to top

>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full
           insert sequence
          Length = 1787

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 385 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
           |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 140 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 187



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 507 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 262 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 311



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || ||||||||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 583 cttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatctc 524



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 674 agtagtcggtggtggggagctgctcgtg 647



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 385      cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
                |||||| | |||||||| ||||||||||||||||||||||||||||||
Sbjct: 18196272 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 18196225



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                  
Query: 507      ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
                ||||| || ||||||||||||| || |||||||| |||||  ||||||||
Sbjct: 18196150 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 18196101



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 377      gacgagggcggcgatggcggcgccg 401
                ||||||||||||||||| |||||||
Sbjct: 14258205 gacgagggcggcgatggtggcgccg 14258229



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 408 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 467
           ||||||| |||||| |||||||||||   |||| | ||| || ||| ||| |||||||||
Sbjct: 813 gggccgatccagtagacccagtggtttgtccagtccccggtggccagggccgggccgaag 754

                                                                       
Query: 468 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 527
           |||   || ||||||||||||||||||   |||   |||||||| ||| |||||||||||
Sbjct: 753 gagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccg 694

                  
Query: 528 acgatga 534
           |||||||
Sbjct: 693 acgatga 687



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 179/227 (78%)
 Strand = Plus / Minus

                                                                       
Query: 408 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 467
           ||||||| |||||| ||||||||||| | ||||   |  ||||| | ||| || ||||| 
Sbjct: 719 gggccgacccagtagacccagtggttgttccaggtccaactgactagggctggaccgaat 660

                                                                       
Query: 468 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 527
           || ||||| ||||||||||| || |||   |||||||| ||| ||| ||||||||| || 
Sbjct: 659 gacacggccgggttcatggatgcaccggtgaaggctcctccgaccaagatgttggctcca 600

                                                                       
Query: 528 acgatgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccaca 587
           |||||||| || ||||| || || || || |  ||||||| ||| | |||| |||| |  
Sbjct: 599 acgatgaaaccaatggcaattggggcaatgattccgaggttgcctctcttgtggtcgatg 540

                                                          
Query: 588 gccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||||||||| ||||| || || ||||||||||| || |||||
Sbjct: 539 gccgtggcgtacacggtgtagaccaggccgaaggtcatcacaatctc 493



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 38/39 (97%)
 Strand = Plus / Minus

                                                  
Query: 515 gatgttggcgccgacgatgaagccgatggcgatgggcgc 553
           |||||||||||||||||||||||||||||| ||||||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgc 283



to top

>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water
           channel AT3G26520 (TIP2) mRNA, complete cds
          Length = 1201

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 616 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 557



to top

>ref|XM_473251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
           ||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 506 gtggcgtacacggtgtacacgagcccgaacgtcatgacga 467



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 477 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 536
           |||||||||| ||||||||| || |  || ||||| |||||||| |||||  |||  |||
Sbjct: 617 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 558

                            
Query: 537 ccgatggcgatgggcgc 553
           |||||||||| ||||||
Sbjct: 557 ccgatggcgaggggcgc 541



to top

>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete
           cds
          Length = 1099

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 587 agccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 587 agccgtcgcgtagactgtgtacacgaggccgaaggtcatgactatctc 540



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 416 ccagtacacccagtggttctccca 439
           ||||||||||||||||||||||||
Sbjct: 758 ccagtacacccagtggttctccca 735



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 gcggtggggagctgctcgtg 346
           ||||||||||||||||||||
Sbjct: 847 gcggtggggagctgctcgtg 828



to top

>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10,
              complete sequence
          Length = 141545

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                      
Query: 591    gtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
              ||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 131216 gtggcgtacacggtgtacacgagcccgaacgtcatgacga 131177



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                          
Query: 477    gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 536
              |||||||||| ||||||||| || |  || ||||| |||||||| |||||  |||  |||
Sbjct: 131327 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 131268

                               
Query: 537    ccgatggcgatgggcgc 553
              |||||||||| ||||||
Sbjct: 131267 ccgatggcgaggggcgc 131251



to top

>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 762

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 504 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 445



to top

>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1061

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 131/164 (79%)
 Strand = Plus / Minus

                                                                       
Query: 471 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 530
           ||||| ||||||||||| || |||   || ||||| ||||| |||||||| || || |||
Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611

                                                                       
Query: 531 atgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagcc 590
           ||||| || |||||||| || |||||    |||||    |||  ||||||||| || || 
Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 550 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 507



to top

>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1066

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 571 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 512



to top

>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic
           protein mRNA, complete cds
          Length = 1072

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 131/164 (79%)
 Strand = Plus / Minus

                                                                       
Query: 471 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 530
           ||||| ||||||||||| || |||   || ||||| ||||| |||||||| || || |||
Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623

                                                                       
Query: 531 atgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagcc 590
           ||||| || |||||||| || |||||    |||||    |||  ||||||||| || || 
Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 562 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 519



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 456 gcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccagg 515
           |||||||||||||||   |||||||||||||||||||||   ||||  |||||||| || 
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649

                           
Query: 516 atgttggcgccgacga 531
           | ||||||||||||||
Sbjct: 648 acgttggcgccgacga 633



to top

>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1010

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 131/164 (79%)
 Strand = Plus / Minus

                                                                       
Query: 471 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 530
           ||||| ||||||||||| || |||   || ||||| ||||| |||||||| || || |||
Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599

                                                                       
Query: 531 atgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagcc 590
           ||||| || |||||||| || |||||    |||||    |||  ||||||||| || || 
Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 538 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 495



to top

>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1020

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 552 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 540 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 481



to top

>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 552 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 543 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 484



to top

>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 561 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 502



to top

>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 375 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 316



to top

>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1012

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 552 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1014

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 544 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 485



to top

>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 921

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 552 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 131/164 (79%)
 Strand = Plus / Plus

                                                                         
Query: 471   acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 530
             ||||| ||||||||||| || |||   || ||||| ||||| |||||||| || || |||
Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577

                                                                         
Query: 531   atgaagccgatggcgatgggcgcgatcaccccgaggtcgccgcgcttggggtccacagcc 590
             ||||| || |||||||| || |||||    |||||    |||  ||||||||| || || 
Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637

                                                         
Query: 591   gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
             |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 15638 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 15681



to top

>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full
           insert sequence
          Length = 912

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacga 630
           ||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 572 gtggcgtacacggtgtacacgagcccgaacgtcatgacga 533



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 477 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 536
           |||||||||| ||||||||| || |  || ||||| |||||||| |||||  |||  |||
Sbjct: 683 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 624

                            
Query: 537 ccgatggcgatgggcgc 553
           |||||||||| ||||||
Sbjct: 623 ccgatggcgaggggcgc 607



to top

>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA,
           complete cds
          Length = 1020

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 513 cttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 454



to top

>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence
          Length = 1054

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 574 cttggggtcgacggctgtggcgtaaacggtgtagacgagcccgaaggtcatcacgatctc 515



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcat 484
           |||||||||| ||||||||||||||||||  ||||||||||||
Sbjct: 628 cgccgctgacgacggcggggccgaaggagcgggcggggttcat 586



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 442 cgccgctgaccacggcggggccgaaggagacggcggggttcat 484
           |||||||||| ||||||||||||||||||  ||||||||||||
Sbjct: 670 cgccgctgacgacggcggggccgaaggagcgggcggggttcat 628



to top

>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA,
           complete cds
          Length = 1255

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 103/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 408 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 467
           ||||||| |||||| |||||||||||   |||||| ||| || ||| |||||| ||||||
Sbjct: 812 gggccgatccagtagacccagtggttggtccagaccccggtggccatggcgggaccgaag 753

                                                                       
Query: 468 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 527
           ||    || ||||||||||||||||||   |||   |||||||| ||| |||||||||||
Sbjct: 752 gaccgcgccgggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccg 693

                  
Query: 528 acgatga 534
           || ||||
Sbjct: 692 actatga 686



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 459 gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 518
           ||||||||||||  ||| ||||||||||| ||||||    |||  |||||||| ||||||
Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549

                                 
Query: 519 ttggcgccgacgatgaagccga 540
           ||||||||||||| || |||||
Sbjct: 548 ttggcgccgacgacgaggccga 527



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 459   gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 518
             ||||||||||||  ||| ||||||||||| ||||||    |||  |||||||| ||||||
Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842

                                   
Query: 519   ttggcgccgacgatgaagccga 540
             ||||||||||||| || |||||
Sbjct: 98841 ttggcgccgacgacgaggccga 98820



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 459 gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 518
           ||||||||||||  ||| ||||||||||| ||||||    |||  |||||||| ||||||
Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552

                                 
Query: 519 ttggcgccgacgatgaagccga 540
           ||||||||||||| || |||||
Sbjct: 551 ttggcgccgacgacgaggccga 530



to top

>ref|NM_189871.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 576

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 404 gaaggggccgagccagtacacccagtggt 432
           |||||||||||||||||||||||||||||
Sbjct: 492 gaaggggccgagccagtacacccagtggt 464



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                             
Query: 404      gaaggggccgagccagtacacccagtggt 432
                |||||||||||||||||||||||||||||
Sbjct: 25641797 gaaggggccgagccagtacacccagtggt 25641825



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 387      gcgatggcggcgccggcgaaggggccgagccag 419
                ||||||||||||||| |||| ||||||| ||||
Sbjct: 15355781 gcgatggcggcgccgacgaacgggccgacccag 15355749



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0594D10
          Length = 143200

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                          
Query: 404   gaaggggccgagccagtacacccagtggt 432
             |||||||||||||||||||||||||||||
Sbjct: 95770 gaaggggccgagccagtacacccagtggt 95798



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 515 gatgttggcgccgacgatgaagccgatggcgat 547
           |||||||||||||||||| ||||||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgat 289



to top

>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA
          Length = 969

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 385 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
           |||||| | ||||||||  |||||| ||||||||||||||||||||||
Sbjct: 880 cggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| |||||||| || |||||||||||||| ||||||||
Sbjct: 521 gtggcgtagactgtgtaaactagcccgaaggtcatcacgatctc 478



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 316 ttcagtactcggcggtggggagctgctcgtg 346
           ||||||| ||||||||||||||||| |||||
Sbjct: 793 ttcagtagtcggcggtggggagctgttcgtg 763



to top

>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 628

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 102 gtggcgtagacggtgtagacgagcccgaaggtcattacgatctc 59



to top

>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1062

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| || ||| | ||||||||||||||||| ||||||||
Sbjct: 552 cttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggtcatcacgatctc 493



to top

>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0483F08
          Length = 148985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                              
Query: 385    cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 432
              |||||| | ||||||||  |||||| ||||||||||||||||||||||
Sbjct: 125094 cggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141



to top

>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2)
           mRNA, complete cds
          Length = 1035

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 541 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 498



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 575 cttggggtccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||| || || |||||||| ||||||||||| |  ||||||||||| ||||||||
Sbjct: 606 cttggggtcaacggcagtggcgtagactgtgtacaccaaaccgaaggtcatcacgatctc 547



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 443 gccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgcc 493
           ||||||||| ||||| |||||||| |||  ||| |||||||||||||||||
Sbjct: 712 gccgctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662



to top

>gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) mRNA, complete cds
          Length = 1064

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 114/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 408 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 467
           |||||||||||||| ||||||||| | |||||    | |||||| || || ||||| || 
Sbjct: 763 gggccgagccagtagacccagtggctgtcccatgtccagctgacgacagcagggccaaaa 704

                                                                       
Query: 468 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 527
           || ||||| ||||||||||| || || || || || || ||||| | ||||||||| || 
Sbjct: 703 gacacggctgggttcatggatgcaccatcgaatgcgccaccggctaagatgttggcacca 644

                                  
Query: 528 acgatgaagccgatggcgatggg 550
           || |||||||| ||||| |||||
Sbjct: 643 acaatgaagccaatggcaatggg 621



to top

>gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete sequence
          Length = 136866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 395   ggcgccggcgaaggggccgagccagtacacccagtggt 432
             |||||||  ||||||||||||| |||||||||||||||
Sbjct: 82946 ggcgccgatgaaggggccgagctagtacacccagtggt 82909



to top

>dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0679C08
          Length = 156266

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 395   ggcgccggcgaaggggccgagccagtacacccagtggt 432
             |||||||  ||||||||||||| |||||||||||||||
Sbjct: 87879 ggcgccgatgaaggggccgagctagtacacccagtggt 87842



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 515 gatgttggcgccgacgatgaagccgatggc 544
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 594 gcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||| ||||||||||| |||||||| ||||| || |||||
Sbjct: 242 gcgtagactgtgtacacaagcccgaacgtcattacaatctc 202



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 515 gatgttggcgccgacgatgaagccgatggc 544
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic protein
          Length = 1168

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 477 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 536
           ||||||||||| || ||||| ||||| ||||||||||| || ||||| || || ||||| 
Sbjct: 708 gggttcatggaagccccgtcgaaggcaccgccggccagaatattggcacccactatgaaa 649

                
Query: 537 ccgat 541
           |||||
Sbjct: 648 ccgat 644



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 588 gccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| || ||||| || |||||||| ||||| ||||||||
Sbjct: 597 gccgtggcgtatacagtgtaaaccagcccgaacgtcatcacgatctc 551



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 508 cggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||||| |||||||||||| ||||||||||| || || ||||| |||||
Sbjct: 639 cggccaagatgttggcgcccacgatgaagccaatagcaatgggagcgat 591



to top

>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA,
           partial cds
          Length = 408

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 446 gctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggc 502
           |||||| || ||||| ||||||||||| || ||||||||||| || || ||||||||
Sbjct: 390 gctgacgacagcgggtccgaaggagactgccgggttcatggatgcaccatcaaaggc 334



to top

>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1,
           complete cds
          Length = 1067

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 118/149 (79%)
 Strand = Plus / Minus

                                                                       
Query: 408 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 467
           ||||||| |||||| ||||||||||| ||||||   | ||| ||||| || || || || 
Sbjct: 738 gggccgacccagtagacccagtggttgtcccaggtccagctcaccacagcaggcccaaat 679

                                                                       
Query: 468 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 527
           || || || ||||||||||| || || |||||||| || || || || |||||||| || 
Sbjct: 678 gaaacagccgggttcatggatgccccatcaaaggccccaccagcaagaatgttggctccc 619

                                        
Query: 528 acgatgaagccgatggcgatgggcgcgat 556
           || ||||| || ||||| ||||| |||||
Sbjct: 618 acaatgaaaccaatggcaatgggagcgat 590



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 319 agtactcggcggtggggagctgctcgtg 346
           |||| |||| ||||||||||||||||||
Sbjct: 824 agtaatcggtggtggggagctgctcgtg 797



to top

>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA,
           partial cds
          Length = 529

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgat 631
           |||||||||||||||||||| |  ||||||||||| |||||
Sbjct: 144 gtggcgtacactgtgtacaccaatccgaaggtcatcacgat 104



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 522 gcgccgacgatgaagccgatggcga 546
           |||||||||||||||||||||||||
Sbjct: 314 gcgccgacgatgaagccgatggcga 290



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 519 ttggcgccgacgatgaagccgatggcgat 547
           |||||||||||||| ||||||||||||||
Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 513 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||||||||| || || ||||||||||||||||| || |||||
Sbjct: 595 aggatgttggcaccaactatgaagccgatggcgattggagcgat 552



to top

>gb|AY626938.1| Sparus aurata aquaporin 1-like mRNA, complete cds
          Length = 1015

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 414 agccagtacacccagtggttctcc 437
           ||||||||||||||||||||||||
Sbjct: 646 agccagtacacccagtggttctcc 623



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 513 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||||||||| || || ||||||||||||||||| || |||||
Sbjct: 557 aggatgttggcaccaactatgaagccgatggcgattggagcgat 514



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 513 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           ||||||||||| || || ||||||||||||||||| || |||||
Sbjct: 585 aggatgttggcaccaactatgaagccgatggcgattggagcgat 542



to top

>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds
          Length = 175

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 416 ccagtacacccagtggttctccca 439
           ||||||||||||||||||||||||
Sbjct: 164 ccagtacacccagtggttctccca 141



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 471 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 530
           |||||||||||||| || || ||||| || || || || ||||  | |||||| || || 
Sbjct: 109 acggcggggttcattgaggctccgtcgaaagcccctcccgccaaaacgttggcacccaca 50

                                     
Query: 531 atgaagccgatggcgatgggcgcgat 556
           ||||| ||||||||||| ||||||||
Sbjct: 49  atgaaaccgatggcgattggcgcgat 24



to top

>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA,
           complete cds
          Length = 1045

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 78/96 (81%)
 Strand = Plus / Minus

                                                                       
Query: 399 ccggcgaaggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcg 458
           |||||||  ||||| | ||||||||||||||||| |  |||||||||   | | ||||||
Sbjct: 770 ccggcgagcgggccaacccagtacacccagtggtgcgtccagacgcccgaggcgacggcg 711

                                               
Query: 459 gggccgaaggagacggcggggttcatggacgcgccg 494
           || ||||||||   ||| ||||||||||| ||||||
Sbjct: 710 ggcccgaaggacctggccgggttcatggaggcgccg 675



to top

>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 573

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 603 gtgtacacgagcccgaaggtcatgacgatctc 634
           ||||| ||||||||||||||||| ||||||||
Sbjct: 49  gtgtagacgagcccgaaggtcatcacgatctc 18



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 513  aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
            ||||||||||| || || ||||||||||||||||| || |||||
Sbjct: 8649 aggatgttggcaccaactatgaagccgatggcgattggagcgat 8692



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.036
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 520     tggcgccgacgatgaagccgatggcgatgggcgcga 555
               |||||||||||||||||||| || ||||||| ||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 522     gcgccgacgatgaagccgatg 542
               |||||||||||||||||||||
Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 508 cggccaggatgttggcgccgacgatgaagccgatggcgatggg 550
           |||||| ||||||||| || || |||||||||||||| |||||
Sbjct: 599 cggccaagatgttggcaccaacaatgaagccgatggcaatggg 557



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 454     cggcggggccgaaggagacggcg 476
               |||||||||||||||||||||||
Sbjct: 8461222 cggcggggccgaaggagacggcg 8461200



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 455     ggcggggccgaaggagacggcg 476
               ||||||||||||||||||||||
Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 377      gacgagggcggcgatggcggcgccggcg 404
                ||||| |||||||||||||||| |||||
Sbjct: 17580352 gacgacggcggcgatggcggcggcggcg 17580379



to top

>gb|AF326504.1|AF326504 Zea mays tonoplast membrane integral protein ZmTIP3-1 mRNA,
           complete cds
          Length = 989

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 394 cggcgccggcgaaggggccgagccagtacacccagtggt 432
           ||||||||  ||| ||||| |||||||||||||||||||
Sbjct: 744 cggcgccgaggaaagggcccagccagtacacccagtggt 706



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 379    cgagggcggcgatggcggcgccggcga 405
              |||| ||||||||||||||||||||||
Sbjct: 292613 cgagcgcggcgatggcggcgccggcga 292587



to top

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 508 cggccaggatgttggcgccgacgatgaagccgatggcgatggg 550
           |||||| ||||||||| || || |||||||||||||| |||||
Sbjct: 296 cggccaagatgttggcaccaacaatgaagccgatggcaatggg 254



to top

>gb|AY104541.1| Zea mays PCO074685 mRNA sequence
          Length = 633

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 394 cggcgccggcgaaggggccgagccagtacacccagtggt 432
           ||||||||  ||| ||||| |||||||||||||||||||
Sbjct: 354 cggcgccgaggaaagggcccagccagtacacccagtggt 392



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 454     cggcggggccgaaggagacggcg 476
               |||||||||||||||||||||||
Sbjct: 8461105 cggcggggccgaaggagacggcg 8461083



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 455     ggcggggccgaaggagacggcg 476
               ||||||||||||||||||||||
Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 377      gacgagggcggcgatggcggcgccggcg 404
                ||||| |||||||||||||||| |||||
Sbjct: 17534723 gacgacggcggcgatggcggcggcggcg 17534750



to top

>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146444

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 454   cggcggggccgaaggagacggcg 476
             |||||||||||||||||||||||
Sbjct: 67885 cggcggggccgaaggagacggcg 67863



 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 455   ggcggggccgaaggagacggcg 476
             ||||||||||||||||||||||
Sbjct: 80400 ggcggggccgaaggagacggcg 80379



to top

>gb|BT017952.1| Zea mays clone EL01N0522D02.c mRNA sequence
          Length = 502

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 383 ggcggcgatggcggcgccggcgaagg 408
           |||||||| |||||||||||||||||
Sbjct: 156 ggcggcgagggcggcgccggcgaagg 131



to top

>gb|AC136491.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0062E06,
              complete sequence
          Length = 158842

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 385    cggcgatggcggcgccggcgaagggg 410
              ||||| ||||||||||||||||||||
Sbjct: 105361 cggcggtggcggcgccggcgaagggg 105386



to top

>emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P3 on chromosome 10 Contains a
              novel gene, the 5' end of the TCF8 gene for transcription
              factor 8 (represses interleukin 2 expression)
              (BZP,ZEB,ZEB1,AREB6,ZFHEP,NIL-2A,ZFHX1A,NIL-2-A), a
              pseudogene similar to part of serine palmitoyltransferase,
              long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1,
              SPT1, SPTI) and two CpG islands, complete sequence
          Length = 187517

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 171    cacacacagtttaccctgaatt 192
              ||||||||||||||||||||||
Sbjct: 184855 cacacacagtttaccctgaatt 184834



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 511 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||| |||||||| ||||||||||| ||||| || ||||| |||||
Sbjct: 585 ccagaatgttggcaccgacgatgaatccgatcgcaatgggagcgat 540



to top

>emb|BX572595.1| Rhodopseudomonas palustris CGA009 complete genome; segment 3/16
          Length = 349260

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 384    gcggcgatggcggcgccggcga 405
              ||||||||||||||||||||||
Sbjct: 189463 gcggcgatggcggcgccggcga 189484



to top

>emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete genome; segment 4/29
          Length = 298450

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 377   gacgagggcggcgatggcggcgccggcgaa 406
             |||||||||||||| ||||||| |||||||
Sbjct: 98340 gacgagggcggcgacggcggcgacggcgaa 98369



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 382   gggcggcgatggcggcgccggcga 405
             |||||||||||||||| |||||||
Sbjct: 26201 gggcggcgatggcggcaccggcga 26224



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 385      cggcgatggcggcgccggcgaagggg 410
                ||||| ||||||||||||||||||||
Sbjct: 17815710 cggcggtggcggcgccggcgaagggg 17815735



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 383      ggcggcgatggcggcgccggcgaa 406
                |||||||||||||||| |||||||
Sbjct: 11934523 ggcggcgatggcggcggcggcgaa 11934546



to top

>gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete sequence
          Length = 198084

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 171   cacacacagtttaccctgaatt 192
             ||||||||||||||||||||||
Sbjct: 67269 cacacacagtttaccctgaatt 67248



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 382    gggcggcgatggcggcgccggc 403
              ||||||||||||||||||||||
Sbjct: 870643 gggcggcgatggcggcgccggc 870664



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 527     gacgatgaagccgatggcgatgggcg 552
               ||||||| ||||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139



to top

>gb|AY108015.1| Zea mays PCO111497 mRNA sequence
          Length = 495

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 383 ggcggcgatggcggcgccggcgaagg 408
           |||||||| |||||||||||||||||
Sbjct: 150 ggcggcgagggcggcgccggcgaagg 125



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 385      cggcgatggcggcgccggcgaagggg 410
                ||||| ||||||||||||||||||||
Sbjct: 17910026 cggcggtggcggcgccggcgaagggg 17910051



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 383      ggcggcgatggcggcgccggcgaa 406
                |||||||||||||||| |||||||
Sbjct: 12012930 ggcggcgatggcggcggcggcgaa 12012953



to top

>gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds
          Length = 993

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 582 tccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||| || ||||| ||||||||||| || || ||||||||||| || |||||
Sbjct: 541 tccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcacaatctc 489



to top

>ref|NM_196526.1| Oryza sativa (japonica cultivar-group) putative submergence induced
           protein 2 (OSJNBa0006I13.13), mRNA
          Length = 1155

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 377 gacgagggcggcgatggcggcgccg 401
           ||||||||||||||||| |||||||
Sbjct: 666 gacgagggcggcgatggtggcgccg 642



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 907 gcgatggcggcgccgacgaacgggccgacccag 875



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 909 gcgatggcggcgccgacgaacgggccgacccag 877



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 910 gcgatggcggcgccgacgaacgggccgacccag 878



to top

>ref|XM_470514.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 843

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 392 ggcggcgccggcgaaggggcc 412
           |||||||||||||||||||||
Sbjct: 756 ggcggcgccggcgaaggggcc 736



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 515     gatgttggcgccgacgatgaagccg 539
               ||||||| |||||||||||||||||
Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061



to top

>gb|BT012976.1| Lycopersicon esculentum clone 114187R, mRNA sequence
          Length = 972

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 408 gggccgagccagtacacccagtggttctcccag 440
           ||||||||||| || ||||||||||| ||||||
Sbjct: 719 gggccgagccaatagacccagtggttgtcccag 687



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 505    cgccggccaggatgttggcgc 525
              |||||||||||||||||||||
Sbjct: 926947 cgccggccaggatgttggcgc 926927



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 383     ggcggcgatggcggcgccgg 402
               ||||||||||||||||||||
Sbjct: 2915284 ggcggcgatggcggcgccgg 2915265



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 383     ggcggcgatggcggcgccgg 402
               ||||||||||||||||||||
Sbjct: 1997572 ggcggcgatggcggcgccgg 1997591



to top

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 455 ggcggggccgaaggagacggcggggttcatgga 487
           ||||||||||||||||  ||| |||||||||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556



to top

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 455 ggcggggccgaaggagacggcggggttcatgga 487
           ||||||||||||||||  ||| |||||||||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541



to top

>gb|AC124174.4| Mus musculus BAC clone RP23-181O22 from chromosome 3, complete sequence
          Length = 197553

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 421    acacccagtggttctcccaga 441
              |||||||||||||||||||||
Sbjct: 157776 acacccagtggttctcccaga 157796



to top

>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP)
          Length = 933

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 316 ttcagtactcggcggtggggagctgctcgtgtg 348
           ||||||| |||| ||| ||||||||||||||||
Sbjct: 790 ttcagtagtcggtggttgggagctgctcgtgtg 758



to top

>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete
              sequence
          Length = 164179

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 392    ggcggcgccggcgaaggggcc 412
              |||||||||||||||||||||
Sbjct: 119111 ggcggcgccggcgaaggggcc 119091



to top

>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 515    gatgttggcgccgacgatgaagccg 539
              ||||| |||||||||||||||||||
Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461



to top

>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14
          Length = 348014

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 515   gatgttggcgccgacgatgaagccg 539
             ||||| |||||||||||||||||||
Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442



to top

>gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3)
           mRNA, complete cds
          Length = 1133

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 582 tccacagccgtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||| || ||||| ||||||||||| || || ||||||||||| || |||||
Sbjct: 561 tccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcacaatctc 509



to top

>dbj|AK147805.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library,
           clone:G270047M03 product:similar to Putative RNA
           methyltransferase [Homo sapiens], full insert sequence
          Length = 1417

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 389 gatggcggcgccggcgaaggg 409
           |||||||||||||||||||||
Sbjct: 18  gatggcggcgccggcgaaggg 38



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 473 gcgatggcggcgccgacgaacgggccgacccag 441



to top

>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome 10,
              complete sequence
          Length = 142737

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 377    gacgagggcggcgatggcggcgccg 401
              ||||||||||||||||| |||||||
Sbjct: 122036 gacgagggcggcgatggtggcgccg 122060



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 387   gcgatggcggcgccggcgaaggggccgagccag 419
             ||||||||||||||| |||| ||||||| ||||
Sbjct: 62780 gcgatggcggcgccgacgaacgggccgacccag 62748



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 907 gcgatggcggcgccgacgaacgggccgacccag 875



to top

>ref|XM_314890.2| Anopheles gambiae str. PEST ENSANGP00000012326
           (ENSANGG00000009837), partial mRNA
          Length = 1641

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 411 ccgagccagtacacccagtggttctccca 439
           |||| |||||||||||||||||| |||||
Sbjct: 752 ccgacccagtacacccagtggttgtccca 724



to top

>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full
           insert sequence
          Length = 1099

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 392 ggcggcgccggcgaaggggcc 412
           |||||||||||||||||||||
Sbjct: 844 ggcggcgccggcgaaggggcc 824



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 501 gcgatggcggcgccgacgaacgggccgacccag 469



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 907 gcgatggcggcgccgacgaacgggccgacccag 875



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 909 gcgatggcggcgccgacgaacgggccgacccag 877



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 910 gcgatggcggcgccgacgaacgggccgacccag 878



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 387 gcgatggcggcgccggcgaaggggccgagccag 419
           ||||||||||||||| |||| ||||||| ||||
Sbjct: 897 gcgatggcggcgccgacgaacgggccgacccag 865



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 383     ggcggcgatggcggcgccggc 403
               |||||||||||||||||||||
Sbjct: 3194246 ggcggcgatggcggcgccggc 3194266



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 508 cggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 556
           |||| ||||||||||| ||||||||||  || ||||||| ||| |||||
Sbjct: 603 cggctaggatgttggcaccgacgatgagaccaatggcgaggggagcgat 555



to top

>ref|XM_550294.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1011

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 381 agggcggcgatggcggcgccggcg 404
           |||||||||||||||||| |||||
Sbjct: 959 agggcggcgatggcggcggcggcg 982



to top

>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 370     tgtcgtagacgagggcggcg 389
               ||||||||||||||||||||
Sbjct: 1078647 tgtcgtagacgagggcggcg 1078628



to top

>ref|XM_480022.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1572

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 383  ggcggcgatggcggcgccgg 402
            ||||||||||||||||||||
Sbjct: 1356 ggcggcgatggcggcgccgg 1337



to top

>ref|XM_469996.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 588

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 383 ggcggcgatggcggcgccggcgaagggg 410
           |||||||||||||| | |||||||||||
Sbjct: 48  ggcggcgatggcgggggcggcgaagggg 75



to top

>ref|XM_450702.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1563

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 385  cggcgatggcggcgccggcg 404
            ||||||||||||||||||||
Sbjct: 1479 cggcgatggcggcgccggcg 1498



to top

>gb|AC168309.2| Mus musculus chromosome 1, clone wi1-2866I16, complete sequence
          Length = 40737

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 236  gatgacacgatgacacttgcttgatttc 263
            ||||||| ||||||| ||||||||||||
Sbjct: 2691 gatgacatgatgacaattgcttgatttc 2664



to top

>gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0046A04,
              complete sequence
          Length = 141001

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 383    ggcggcgatggcggcgccggcgaa 406
              |||||||||||||||| |||||||
Sbjct: 136250 ggcggcgatggcggcggcggcgaa 136273



to top

>gb|DQ195081.1| Oryza sativa (indica cultivar-group) putative leucine-rich repeat
             receptor-like kinase gene cluster, complete sequence;
             ternary complex factor MIP1-like gene, complete cds;
             putative membrane-associated protein and gag-pol
             precursor, pseudogenes, complete sequence; and unknown
             genes
          Length = 94077

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 379   cgagggcggcgatggcggcg 398
             ||||||||||||||||||||
Sbjct: 48532 cgagggcggcgatggcggcg 48551



to top

>gb|AC103551.7| Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete
             sequence
          Length = 137709

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 383   ggcggcgatggcggcgccggcgaagggg 410
             |||||||||||||||| |||||| ||||
Sbjct: 88824 ggcggcgatggcggcggcggcgaggggg 88851



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 385     cggcgatggcggcgccggcg 404
               ||||||||||||||||||||
Sbjct: 3793448 cggcgatggcggcgccggcg 3793467



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 385     cggcgatggcggcgccggcg 404
               ||||||||||||||||||||
Sbjct: 1489653 cggcgatggcggcgccggcg 1489634



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    cggcgatggcggcgccggcg 404
              ||||||||||||||||||||
Sbjct: 625314 cggcgatggcggcgccggcg 625333



to top

>ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (MG08844.4) partial
           cds
          Length = 702

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 381 agggcggcgatggcggcgccggcgaagg 408
           ||||||||||||||| ||| ||||||||
Sbjct: 59  agggcggcgatggcgccgcgggcgaagg 86



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 516     atgttggcgccgacgatgaagccgatgg 543
               |||| |||||||| ||||||||||||||
Sbjct: 3114875 atgtaggcgccgaagatgaagccgatgg 3114848



to top

>gb|AC145376.3| Pan troglodytes BAC clone RP43-59A12 from 7, complete sequence
          Length = 221727

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 236    gatgacacgatgacacttgc 255
              ||||||||||||||||||||
Sbjct: 108005 gatgacacgatgacacttgc 107986



to top

>ref|XM_656638.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4126.2), mRNA
          Length = 1515

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 385 cggcgatggcggcgccggcg 404
           ||||||||||||||||||||
Sbjct: 691 cggcgatggcggcgccggcg 672



to top

>gb|AY756174.4| Oryza rufipogon putative leucine-rich repeat receptor-like kinases and
             ternary complex factor MIP1-like genes, complete cds;
             retrotransposon putative membrane-associated protein and
             gag-pol precursor, pseudogenes, complete sequence; and
             unknown genes
          Length = 102522

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 379   cgagggcggcgatggcggcg 398
             ||||||||||||||||||||
Sbjct: 56943 cgagggcggcgatggcggcg 56962



to top

>gb|AC102374.7| Mus musculus chromosome 1, clone RP23-278G2, complete sequence
          Length = 170448

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 236   gatgacacgatgacacttgcttgatttc 263
             ||||||| ||||||| ||||||||||||
Sbjct: 25899 gatgacatgatgacaattgcttgatttc 25926



to top

>gb|AF523823.1| Streptomyces chromofuscus phospholipase D precursor, gene, complete
            cds
          Length = 1575

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 535  agccgatggcgatgggcgcgatca 558
            |||||||||||| |||||||||||
Sbjct: 1042 agccgatggcgaagggcgcgatca 1019



to top

>gb|AC135563.5| Oryza sativa chromosome 3 BAC OSJNBb0015I02 genomic sequence, complete
             sequence
          Length = 122815

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 383   ggcggcgatggcggcgccggcgaagggg 410
             |||||||||||||| | |||||||||||
Sbjct: 16418 ggcggcgatggcgggggcggcgaagggg 16445



to top

>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551),
           mRNA
          Length = 1556

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 448 tgaccacggcggggccgaaggagacggcggggttcatgga 487
           ||||||| ||||||||||| |||  ||| |||||||||||
Sbjct: 802 tgaccactgcggggccgaaagagcgggccgggttcatgga 763



to top

>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12
          Length = 294800

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 536    gccgatggcgatgggcgcga 555
              ||||||||||||||||||||
Sbjct: 252331 gccgatggcgatgggcgcga 252350



to top

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 348     ggacgctggccgatgaagcagatg 371
               ||||||| ||||||||||||||||
Sbjct: 2262603 ggacgctcgccgatgaagcagatg 2262580



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 382    gggcggcgatggcggcgccg 401
              ||||||||||||||||||||
Sbjct: 734071 gggcggcgatggcggcgccg 734052



to top

>emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chromosome 1 Contains a
             ribosomal protein S15 (RPS15) pseudogene, three novel
             genes (LOC388753), the 3' end of the TARBP1 gene for TAR
             (HIV) RNA binding protein 1 and a CpG island, complete
             sequence
          Length = 92628

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 147   acaagagattattcctgactgact 170
             ||||||| ||||||||||||||||
Sbjct: 68131 acaagagcttattcctgactgact 68108



to top

>gb|AC090498.4| Homo sapiens chromosome 7 clone RP11-84E17, complete sequence
          Length = 188036

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 236   gatgacacgatgacacttgc 255
             ||||||||||||||||||||
Sbjct: 67930 gatgacacgatgacacttgc 67911



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 379    cgagggcggcgatggcggcgccgg 402
              |||| |||||||||||||||||||
Sbjct: 446204 cgagcgcggcgatggcggcgccgg 446227



to top

>gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109471

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 233   actgatgacacgatgacact 252
             ||||||||||||||||||||
Sbjct: 67496 actgatgacacgatgacact 67515



to top

>emb|BX842582.1| Mycobacterium tuberculosis H37Rv complete genome; segment 11/13
          Length = 349563

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    cggcgatggcggcgccggcg 404
              ||||||||||||||||||||
Sbjct: 334910 cggcgatggcggcgccggcg 334929



to top

>emb|BX842576.1| Mycobacterium tuberculosis H37Rv complete genome; segment 5/13
          Length = 348264

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 385    cggcgatggcggcgccggcg 404
              ||||||||||||||||||||
Sbjct: 105396 cggcgatggcggcgccggcg 105377



to top

>emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome; segment 2/13
          Length = 342416

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    cggcgatggcggcgccggcg 404
              ||||||||||||||||||||
Sbjct: 281956 cggcgatggcggcgccggcg 281975



to top

>emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genome; segment 16/16
          Length = 227214

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 504   ccgccggccaggatgttggc 523
             ||||||||||||||||||||
Sbjct: 85688 ccgccggccaggatgttggc 85707



to top

>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
            13/14
          Length = 316050

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 385  cggcgatggcggcgccggcg 404
            ||||||||||||||||||||
Sbjct: 3841 cggcgatggcggcgccggcg 3860



to top

>emb|BX248335.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 2/14
          Length = 324050

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 385    cggcgatggcggcgccggcg 404
              ||||||||||||||||||||
Sbjct: 282106 cggcgatggcggcgccggcg 282125



to top

>emb|BX248338.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 5/14
          Length = 299450

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 385    cggcgatggcggcgccggcg 404
              ||||||||||||||||||||
Sbjct: 171874 cggcgatggcggcgccggcg 171855



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| || || ||||||||||| ||||||||
Sbjct: 561 gtggcgtagacggtgtagactagtccgaaggtcatcacgatctc 518



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| || ||||| || || ||||||||||| ||||||||
Sbjct: 249 gtggcgtagacggtgtagactagtccgaaggtcatcacgatctc 206



to top

>emb|AL954726.31| Zebrafish DNA sequence from clone CH211-274A9 in linkage group 23,
              complete sequence
          Length = 164507

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     tttgtacaaacattaatctt 103
              ||||||||||||||||||||
Sbjct: 115044 tttgtacaaacattaatctt 115063



to top

>gb|AC010068.8| Drosophila melanogaster 3L BAC RP98-15K24 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 178607

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 388    cgatggcggcgccggcgaag 407
              ||||||||||||||||||||
Sbjct: 152620 cgatggcggcgccggcgaag 152601



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 511     ccaggatgttggcgccgacg 530
               ||||||||||||||||||||
Sbjct: 4466178 ccaggatgttggcgccgacg 4466159



to top

>gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 167026

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 388  cgatggcggcgccggcgaag 407
            ||||||||||||||||||||
Sbjct: 1301 cgatggcggcgccggcgaag 1282



to top

>gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of the complete genome
          Length = 11136

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 523  cgccgacgatgaagccgatg 542
            ||||||||||||||||||||
Sbjct: 8892 cgccgacgatgaagccgatg 8873



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 379     cgagggcggcgatggcggcg 398
               ||||||||||||||||||||
Sbjct: 2205798 cgagggcggcgatggcggcg 2205779



to top

>ref|NM_141113.2| Drosophila melanogaster CG7442-RA (CG7442), mRNA
          Length = 2085

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 388  cgatggcggcgccggcgaag 407
            ||||||||||||||||||||
Sbjct: 1815 cgatggcggcgccggcgaag 1796



to top

>gb|AY027524.1| Frankia sp. CpI1 plasmid pFQ12, complete plasmid sequence
          Length = 22437

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 385  cggcgatggcggcgccggcg 404
            ||||||||||||||||||||
Sbjct: 8376 cggcgatggcggcgccggcg 8357



to top

>gb|AF290617.1|AF290617 Nicotiana glauca putative delta TIP (MIP1) mRNA, partial cds
          Length = 265

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 591 gtggcgtacactgtgtacac 610
           ||||||||||||||||||||
Sbjct: 213 gtggcgtacactgtgtacac 194



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 385      cggcgatggcggcgccggcg 404
                ||||||||||||||||||||
Sbjct: 12313580 cggcgatggcggcgccggcg 12313599



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 383     ggcggcgatggcggcgccgg 402
               ||||||||||||||||||||
Sbjct: 2262773 ggcggcgatggcggcgccgg 2262792



to top

>gb|BC093081.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, transcript
           variant 1, mRNA (cDNA clone MGC:111493 IMAGE:30407786),
           complete cds
          Length = 3990

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 383 ggcggcgatggcggcgccggcgaagggg 410
           ||||||| |||||||| |||||||||||
Sbjct: 14  ggcggcggtggcggcggcggcgaagggg 41



to top

>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane
           protein 1 mRNA, complete cds
          Length = 1162

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 453 acggcggggccgaaggagacggcggggttcatggacgcgccgtc 496
           ||||| || ||||| || ||||||||||||||||| || |||||
Sbjct: 679 acggctggtccgaatgacacggcggggttcatggatgctccgtc 636



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           |||||||| ||||||||||| |  || |||||||| ||||||||
Sbjct: 541 gtggcgtaaactgtgtacaccaatccaaaggtcatcacgatctc 498



to top

>dbj|AP004797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0547F09
          Length = 140615

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 383    ggcggcgatggcggcgccgg 402
              ||||||||||||||||||||
Sbjct: 110653 ggcggcgatggcggcgccgg 110672



 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 383   ggcggcgatggcggcgccgg 402
             ||||||||||||||||||||
Sbjct: 67930 ggcggcgatggcggcgccgg 67911



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 520     tggcgccgacgatgaagccg 539
               ||||||||||||||||||||
Sbjct: 4875529 tggcgccgacgatgaagccg 4875548



to top

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 545     gatgggcgcgatcaccccgaggtc 568
               ||||||||||||||||| ||||||
Sbjct: 2060908 gatgggcgcgatcacccagaggtc 2060885



to top

>dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0089K24
          Length = 154137

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 381   agggcggcgatggcggcgccggcg 404
             |||||||||||||||||| |||||
Sbjct: 83884 agggcggcgatggcggcggcggcg 83861



to top

>dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0460H04
          Length = 166490

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 524    gccgacgatgaagccgatggcgat 547
              ||||| ||||||||||||||||||
Sbjct: 107970 gccgaggatgaagccgatggcgat 107947



to top

>dbj|AP007224.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0463E12
          Length = 161081

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 379   cgagggcggcgatggcggcg 398
             ||||||||||||||||||||
Sbjct: 53274 cgagggcggcgatggcggcg 53255



to top

>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L
          Length = 1057

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 104/132 (78%)
 Strand = Plus / Minus

                                                                       
Query: 416 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 475
           ||||||||||||||| || ||||||   | ||||||||  || || ||||| || || ||
Sbjct: 708 ccagtacacccagtgattttcccagctccagctgaccaaagctggtccgaacgacactgc 649

                                                                       
Query: 476 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 535
           ||||||||| || || ||||| || ||||| || ||||  ||||| || || ||||| ||
Sbjct: 648 ggggttcattgatgcaccgtcgaatgctcctcccgccaaaatgttagcaccaacgataaa 589

                       
Query: 536 gccgatggcgat 547
            ||||| |||||
Sbjct: 588 accgatagcgat 577



to top

>dbj|AP005872.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1168F12
          Length = 141524

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 385   cggcgatggcggcgccggcg 404
             ||||||||||||||||||||
Sbjct: 97134 cggcgatggcggcgccggcg 97153



to top

>dbj|AP005542.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0473D02
          Length = 146185

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 383   ggcggcgatggcggcgccgg 402
             ||||||||||||||||||||
Sbjct: 10272 ggcggcgatggcggcgccgg 10291



to top

>dbj|AP003911.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1368_G08
          Length = 107074

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 383   ggcggcgatggcggcgccgg 402
             ||||||||||||||||||||
Sbjct: 60900 ggcggcgatggcggcgccgg 60919



to top

>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 591 gtggcgtacactgtgtacacgagcccgaaggtcatgacgatctc 634
           ||||||||||| |||||||| | ||| || ||||| ||||||||
Sbjct: 585 gtggcgtacaccgtgtacaccaacccaaacgtcatcacgatctc 542



to top

>ref|XM_314891.2| Anopheles gambiae str. PEST ENSANGP00000012352
           (ENSANGG00000009863), partial mRNA
          Length = 936

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 416 ccagtacacccagtggttctccca 439
           |||||||||||||||||| |||||
Sbjct: 285 ccagtacacccagtggttgtccca 262



to top

>dbj|AK109762.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-146-G11, full
           insert sequence
          Length = 1040

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 524 gccgacgatgaagccgatggcgat 547
           ||||| ||||||||||||||||||
Sbjct: 593 gccgaggatgaagccgatggcgat 616



to top

>gb|AC009999.2|T20M3 Sequence of BAC T20M3 from Arabidopsis thaliana chromosome 1,
            complete sequence
          Length = 79554

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 87   gtacaaacattaatcttgac 106
            ||||||||||||||||||||
Sbjct: 5058 gtacaaacattaatcttgac 5039



to top

>dbj|AK073605.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048N16, full
           insert sequence
          Length = 1059

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 383 ggcggcgatggcggcgccggcgaa 406
           |||||||||||||||| |||||||
Sbjct: 54  ggcggcgatggcggcggcggcgaa 77



to top

>gb|AE003596.5| Drosophila melanogaster chromosome 3L, section 77 of 83 of the complete
             sequence
          Length = 249021

 Score = 40.1 bits (20), Expect = 8.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 388   cgatggcggcgccggcgaag 407
             ||||||||||||||||||||
Sbjct: 63668 cgatggcggcgccggcgaag 63649


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,699,544
Number of Sequences: 3902068
Number of extensions: 4699544
Number of successful extensions: 110307
Number of sequences better than 10.0: 254
Number of HSP's better than 10.0 without gapping: 271
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 105269
Number of HSP's gapped (non-prelim): 5002
length of query: 637
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 614
effective length of database: 17,143,297,704
effective search space: 10525984790256
effective search space used: 10525984790256
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top