>emb|BX890572.9| Zebrafish DNA sequence from clone CH211-234F20 in linkage group 4
Contains the gene for a novel protein containing two notch
(DSL) domains and an EF hand domain, the gene for a novel
protein similar to vertebrate myosin binding protein H
(MYBPH), the gene for a novel protein sinilar to human and
mouse CWF19-like 1, cell cycle control (S. pombe)
(CWF19L1), the gene for a novel protein (zgc:55718), the
gene for a novel protein containing Kelch motifs and a
BTB/POZ domain, the sycp3 gene for synaptonemal complex
protein 3, a novel gene and a CpG island, complete sequence
Length = 166208
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 4 tactacaataatgcacaagt 23
||||||||||||||||||||
Sbjct: 135655 tactacaataatgcacaagt 135674
>gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, complete sequence
Length = 200190
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 142 tatcagctgatgctgcccag 161
||||||||||||||||||||
Sbjct: 128112 tatcagctgatgctgcccag 128093
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,859,649
Number of Sequences: 3902068
Number of extensions: 4859649
Number of successful extensions: 94036
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93735
Number of HSP's gapped (non-prelim): 297
length of query: 568
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 545
effective length of database: 17,143,297,704
effective search space: 9343097248680
effective search space used: 9343097248680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)