>emb|X97917.1|HVBLT142 H.vulgare blt14.2 gene
          Length = 687

 Score =  571 bits (288), Expect = e-160
 Identities = 297/300 (99%)
 Strand = Plus / Minus

                                                                       
Query: 12  cggatacaaacgctcattgaggaacgtggacatgagcgaaacgcaggtgtttttcttccg 71
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 627 cggatacaaacgctcattgaggaacgtggacatgagcgaaacgcaggtgtttttcttccg 568

                                                                       
Query: 72  ggcgatgccggctatagaaatctagtaaaacccacaagttcagcttcagcttgtatgtat 131
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 567 ggcgatgccggctatagaaatctagtaaaacccacaagttcagcttcagcttgtatgtat 508

                                                                       
Query: 132 gtatgcaagtcagcacatgcacacaagatgatcatgcatgagtagggaccccaggaatca 191
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 507 gtatgcaagtcagcacatgcacacaagatgatcatgcatgagtaggggccccaggaatca 448

                                                                       
Query: 192 ccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccggcaagtccg 251
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 447 ccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccggcaagtccg 388

                                                                       
Query: 252 gcaaccccgaacccgaagaagccttggactcggcgacgccacctccggcgccggcaccac 311
           ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 387 gcaaccccgaacccgaagaagacttggactcggggacgccacctccggcgccggcaccac 328

>emb|Z23258.1|SCACCPROA S.cereale acclimation protein mRNA, complete CDS
          Length = 479

 Score =  101 bits (51), Expect = 1e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                       
Query: 181 cccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcccaccac 240
           ||||||||||||||||||||||||||||||||||||||| ||||||  ||| ||||| ||
Sbjct: 197 cccaggaatcaccaccagcgggccgttaatggtactggttccggtagtggtgcccacgac 138

                          
Query: 241 cggcaagtccggcaa 255
           ||||||||| |||||
Sbjct: 137 cggcaagtctggcaa 123



 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 80/96 (83%), Gaps = 6/96 (6%)
 Strand = Plus / Minus

                                                                       
Query: 35  acgtggacatgagcgaaacgcag--gtgtttttcttccgggcgatgccggctatagaaat 92
           ||||||||||||||||||||| |  ||||||| |||||||||| |||  | || |||| |
Sbjct: 337 acgtggacatgagcgaaacgccggtgtgttttccttccgggcggtgctagttacagaagt 278

                                               
Query: 93  ctagtaaaacccacaagttcagcttcagcttgtatg 128
           ||    ||| |||||||||| |||||||||||||||
Sbjct: 277 ct----aaagccacaagttctgcttcagcttgtatg 246

>gb|L28093.1|WHTCOREG Triticum aestivum pTACR7 (tacr7) mRNA, partial cds
          Length = 292

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234
           ||||| |||||||| |||||||||||||||| ||||||| |||||||||||| |||||||
Sbjct: 277 agggatcccaggaagcaccaccagcgggccggtaatggtgctggtaccggtaacggttcc 218

>gb|AF069331.2|AF069331 Hordeum vulgare clone BLTI-5 low temperature induced protein mRNA,
           complete cds
          Length = 546

 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 158 gatgatcatgcatgagtagggaccccaggaatcaccaccagcgggccgttaatggtactg 217
           ||||||||||  |||| ||||| |||||||| |||||||| |||||||||| |||| |||
Sbjct: 336 gatgatcatgggtgagcagggatcccaggaagcaccaccaacgggccgttagtggtgctg 277

                               
Query: 218 gtaccggtaccggttcccac 237
           ||||||||| | ||||||||
Sbjct: 276 gtaccggtaactgttcccac 257

>emb|AJ132439.1|TAE132439 Triticum aestivum mRNA for protein encoded by lt1.1 gene, partial
          Length = 416

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234
           ||||| |||||||| |||||||||||||||| ||||||| ||||| || |||||||||||
Sbjct: 164 agggatcccaggaagcaccaccagcgggccggtaatggtgctggttcccgtaccggttcc 105

            
Query: 235 c 235
           |
Sbjct: 104 c 104

>emb|X57554.1|HVBLT14 H. vulgare BLT14 mRNA
          Length = 514

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234
           ||||| |||||| |||||||||||||||||| ||||||| || || ||||||||||||||
Sbjct: 253 agggatcccagggatcaccaccagcgggccggtaatggtgcttgttccggtaccggttcc 194

            
Query: 235 c 235
           |
Sbjct: 193 c 193

>gb|L28091.1|BLYTRA Hordeum vulgare transmembrane protein mRNA fragment
          Length = 541

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 175 agggaccccaggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcc 234
           ||||| |||||| |||||||||||||||||| ||||||| || || ||||||||||||||
Sbjct: 282 agggatcccagggatcaccaccagcgggccggtaatggtgcttgttccggtaccggttcc 223

            
Query: 235 c 235
           |
Sbjct: 222 c 222

>emb|X97916.1|HVBLT141 H.vulgare blt14.1 gene
          Length = 963

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 caggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccg 242
           |||||| |||||||| ||| ||| ||| ||| |||||||||||| |||||||||| | ||
Sbjct: 646 caggaagcaccaccaccggaccggtaacggtgctggtaccggtaacggttcccacaagcg 587

                            
Query: 243 gcaagtccggcaacccc 259
           |||| || |||||||||
Sbjct: 586 gcaactctggcaacccc 570

>gb|L28092.1|BLYTRAA Hordeum vulgare transmembrane protein mRNA fragment
          Length = 642

 Score = 65.9 bits (33), Expect = 7e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 caggaatcaccaccagcgggccgttaatggtactggtaccggtaccggttcccaccaccg 242
           |||||| |||||||| ||| ||| ||| ||| |||||||||||| |||||||||| | ||
Sbjct: 337 caggaagcaccaccaccggaccggtaacggtgctggtaccggtaacggttcccacaagcg 278

                            
Query: 243 gcaagtccggcaacccc 259
           |||| || |||||||||
Sbjct: 277 gcaactctggcaacccc 261

>gb|M60733.1|BLYCLDAB Hordeum vulgare cold-regulated mRNA, partial cds
          Length = 770

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 157 agatgatcatgcatgagtagggaccccaggaatcaccaccagcgggccgttaatggtact 216
           |||| ||||||  |||| ||||||| | |||| |||||||| ||||||| ||||||||||
Sbjct: 579 agataatcatgggtgagcagggaccgccggaagcaccaccaccgggccggtaatggtact 520

                               
Query: 217 ggtaccggtaccggttccca 236
           |||||| |||  ||||||||
Sbjct: 519 ggtacccgtaatggttccca 500

>emb|Z23257.1|SCRLT141A S.cereale RLT1412 mRNA, complete CDS
          Length = 525

 Score = 50.1 bits (25), Expect = 0.004
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 14  gatacaaacgctcattgaggaacgtggacatgagcgaaacgcaggtgtttttcttcc 70
           |||||| ||||||||| |||||| ||   ||||||||||||| ||||||| ||||||
Sbjct: 424 gatacagacgctcattaaggaacatgctaatgagcgaaacgccggtgtttatcttcc 368



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 103 ccacaagttcagcttcagcttgta 126
           ||||||||||||||||| ||||||
Sbjct: 336 ccacaagttcagcttcatcttgta 313

>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome
          Length = 3147090

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 285    cgacgccacctccggcgccggc 306
              ||||||||||||||||||||||
Sbjct: 952639 cgacgccacctccggcgccggc 952618

>gb|AC164524.5| Mus musculus  BAC RP23-438F8 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 180937

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 116    ttcagcttgtatgtatgtatg 136
              |||||||||||||||||||||
Sbjct: 145342 ttcagcttgtatgtatgtatg 145322

>gb|AC155657.8| Mus musculus 6 BAC RP24-113L15 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 159299

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 116    ttcagcttgtatgtatgtatg 136
              |||||||||||||||||||||
Sbjct: 141642 ttcagcttgtatgtatgtatg 141662

>gb|AF271260.1|AF271260 Triticum aestivum cold-responsive protein (Wlt10) mRNA, complete
           cds
          Length = 548

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 199 cgggccgttaatggtactggtaccggtaccggttcccacca 239
           ||||||| |||| |||||||||||||||  || ||||||||
Sbjct: 318 cgggccggtaattgtactggtaccggtaatggctcccacca 278



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 31  aggaacgtggacatgagcgaaacgcaggtgtttttc 66
           |||||| |||||||||||| ||||| | ||||||||
Sbjct: 422 aggaacatggacatgagcgcaacgccgatgtttttc 387

>gb|AC154237.1| Mus musculus BAC clone RP24-162O18 from 17, complete sequence
          Length = 168481

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 116    ttcagcttgtatgtatgtatg 136
              |||||||||||||||||||||
Sbjct: 110671 ttcagcttgtatgtatgtatg 110691

>gb|AC164419.3| Mus musculus chromosome 5, clone RP23-309G12, complete sequence
          Length = 159565

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 123   tgtatgtatgtatgcaagtc 142
             ||||||||||||||||||||
Sbjct: 94335 tgtatgtatgtatgcaagtc 94316

>gb|AC027133.3| Oryza sativa (japonica cultivar-group) chromosome 12 clone OSJNBb0003F09,
              complete sequence
          Length = 159600

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 285    cgacgccacctccggcgccggcac 308
              |||||||||||||| |||||||||
Sbjct: 144351 cgacgccacctccgccgccggcac 144328

>gb|AC102446.8| Mus musculus chromosome 5, clone RP24-201G17, complete sequence
          Length = 176748

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    tgtatgtatgtatgcaagtc 142
              ||||||||||||||||||||
Sbjct: 149398 tgtatgtatgtatgcaagtc 149379

>gb|AY568280.1| Halanaerobium congolense putative rhodanese-like protein gene,
           complete cds
          Length = 921

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 76  atgccggctatagaaatcta 95
           ||||||||||||||||||||
Sbjct: 797 atgccggctatagaaatcta 816

>gb|AC069292.12| Homo sapiens BAC clone RP11-648L18 from 7, complete sequence
          Length = 159624

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    atggtactggtaccggtacc 228
              ||||||||||||||||||||
Sbjct: 141710 atggtactggtaccggtacc 141691

>emb|AL360157.12| Human DNA sequence from clone RP11-801I18 on chromosome 6q14.2-16.1
             Contains part of a novel gene, complete sequence
          Length = 197431

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   atggtactggtaccggtacc 228
             ||||||||||||||||||||
Sbjct: 72256 atggtactggtaccggtacc 72275

>emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genome; segment 15/16
          Length = 345012

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 293    cctccggcgccggcaccacc 312
              ||||||||||||||||||||
Sbjct: 342634 cctccggcgccggcaccacc 342615

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 220     accggtaccggttcccacca 239
               ||||||||||||||||||||
Sbjct: 5903024 accggtaccggttcccacca 5903005

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 284     gcgacgccacctccggcgcc 303
               ||||||||||||||||||||
Sbjct: 4249197 gcgacgccacctccggcgcc 4249216

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 288     cgccacctccggcgccggca 307
               ||||||||||||||||||||
Sbjct: 2108436 cgccacctccggcgccggca 2108417

>emb|BX001031.19| Zebrafish DNA sequence from clone CH211-242A9, complete sequence
          Length = 192207

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 109   gttcagcttcagcttgtatg 128
             ||||||||||||||||||||
Sbjct: 44969 gttcagcttcagcttgtatg 44988

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 285      cgacgccacctccggcgccggcac 308
                |||||||||||||| |||||||||
Sbjct: 27021965 cgacgccacctccgccgccggcac 27021942

>gb|U85056.1|HSU85056 Homo sapiens FSHD-associated repeat DNA, proximal region
          Length = 27574

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   ttcagcttgtatgtatgtat 135
             ||||||||||||||||||||
Sbjct: 17552 ttcagcttgtatgtatgtat 17533

>emb|BX897671.5| Zebrafish DNA sequence from clone CH211-214K5 in linkage group 4,
              complete sequence
          Length = 201108

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 111    tcagcttcagcttgtatgta 130
              ||||||||||||||||||||
Sbjct: 161677 tcagcttcagcttgtatgta 161696

>emb|BX005054.7| Zebrafish DNA sequence from clone DKEY-209N16 in linkage group 6,
              complete sequence
          Length = 230686

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 109    gttcagcttcagcttgtatg 128
              ||||||||||||||||||||
Sbjct: 190075 gttcagcttcagcttgtatg 190094

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 285      cgacgccacctccggcgccggcac 308
                |||||||||||||| |||||||||
Sbjct: 26947554 cgacgccacctccgccgccggcac 26947531


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,862,721
Number of Sequences: 3902068
Number of extensions: 2862721
Number of successful extensions: 257544
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 257179
Number of HSP's gapped (non-prelim): 365
length of query: 312
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 290
effective length of database: 17,147,199,772
effective search space: 4972687933880
effective search space used: 4972687933880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)