ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaak4p02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 78 1e-11
2gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 78 1e-11
3emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa... 78 1e-11
4emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa... 78 1e-11
5dbj|AP006090.1| Lotus japonicus genomic DNA, chromosome 1, clone... 48 0.009
6gb|AC150307.3| Rhinolophus ferrumequinum clone VMRC7-71A7, compl... 42 0.56
7gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold 42 0.56
8gb|DQ149611.1| Human adenovirus type 31 hexon protein gene, comp... 40 2.2
9emb|Y17253.1|HAY17253 Human adenovirus type 31 hexon gene (partial) 40 2.2
10gb|AC123659.11| Mus musculus chromosome 17, clone RP23-192P18, c... 38 8.7
11gb|BC008799.2| Homo sapiens cortactin, transcript variant 2, mRN... 38 8.7
12ref|NM_005231.2| Homo sapiens cortactin (CTTN), transcript varia... 38 8.7
13ref|NM_138565.1| Homo sapiens cortactin (CTTN), transcript varia... 38 8.7
14emb|AM041992.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
15emb|AM041990.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
16emb|AM041989.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
17emb|AM041988.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
18emb|AM041987.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
19emb|AM041986.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
20emb|AM041985.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
21emb|AM041983.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
22emb|AM041982.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
23emb|AM041981.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
24emb|AM041980.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
25emb|AM041979.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
26emb|AM041978.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
27emb|AM041977.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
28emb|AM041976.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
29emb|AM041975.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
30emb|AM041974.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
31emb|AM041973.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
32emb|AM041972.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
33emb|AM041971.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
34emb|AM041970.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
35emb|AM041969.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
36emb|AM041968.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
37emb|AM041967.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
38emb|AM041966.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
39emb|AM041965.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
40emb|AM041964.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
41emb|AM041963.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
42emb|AM041962.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
43emb|AM041961.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
44emb|AM041960.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
45emb|AM041959.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
46emb|AM041958.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
47emb|AM041956.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
48emb|AM041955.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
49emb|AM041954.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
50emb|AM041953.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
51emb|AM041952.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
52emb|AM041951.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
53emb|AM041948.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
54emb|AM041947.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
55emb|AM041946.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
56emb|AM041945.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
57emb|AM041944.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
58emb|AM041943.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
59emb|AM041942.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
60emb|AM041941.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
61emb|AM041940.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
62emb|AM041939.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
63emb|AM041938.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
64emb|AM041937.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
65emb|AM041936.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
66emb|AM041934.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
67emb|AM041933.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
68emb|AM041931.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
69emb|AM041930.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
70emb|AM041929.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and T... 38 8.7
71gb|AC125339.4| Mus musculus BAC clone RP24-356P17 from chromosom... 38 8.7
72ref|XM_503490.1| Yarrowia lipolytica CLIB122, YALI0E03234g predi... 38 8.7
73emb|AJ606360.1| Pepino mosaic virus complete genome, isolate LE-... 38 8.7
74emb|AJ606359.1| Pepino mosaic virus complete genome, isolate LE-... 38 8.7
75emb|CR861394.1| Pongo pygmaeus mRNA; cDNA DKFZp459H142 (from clo... 38 8.7
76gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 38 8.7
77gb|AF340024.1| Pepino mosaic virus replicase gene, partial cds; ... 38 8.7
78dbj|AK091778.1| Homo sapiens cDNA FLJ34459 fis, clone HLUNG20029... 38 8.7
79emb|CR600359.1| full-length cDNA clone CS0DI056YA17 of Placenta ... 38 8.7
80gb|AC138310.3| Mus musculus BAC clone RP23-205H21 from chromosom... 38 8.7
81gb|AC090884.1|AC090884 Homo sapiens chromosome 3 clone RP11-165B... 38 8.7
82gb|M98343.1|HUMEMS Homo sapiens amplaxin (EMS1) mRNA, complete cds 38 8.7
83gb|AC090646.2| Homo sapiens chromosome 3 clone RP11-690A6 map 3p... 38 8.7
84gb|AC069462.3| Homo sapiens chromosome 3 clone RP11-271E2 map 3p... 38 8.7
85dbj|AB036705.1| Homo sapiens EMS1 gene for cortactin, partial cds 38 8.7
86gb|AF484251.1| Pepino mosaic virus isolate Sp-13, complete genome 38 8.7
87gb|AC155306.2| Mus musculus BAC clone RP24-211K15 from 13, compl... 38 8.7
88dbj|AP000487.6| Homo sapiens genomic DNA, chromosome 11 clone:CM... 38 8.7
89emb|CR956421.19| Pig DNA sequence from clone PigE-225A14 on chro... 38 8.7
90emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 38 8.7 
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                            
Query: 44       gaggatctggtgccaactccatggggtcaacttcaaaaggccaaacatatcgntcangct 103
                ||||||||||||| | ||||||||| || ||||| |||||||| |||||||| ||| |||
Sbjct: 18959598 gaggatctggtgctagctccatgggatcgacttcgaaaggccagacatatcgctcaggct 18959657

                                                       
Query: 104      gcccatttntcgccaagctccaatcatataatcttntct 142
                  ||| || | ||||| |||||||| ||||||||| |||
Sbjct: 18959658 ttccacttcttgccaaactccaatcgtataatcttctct 18959696
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                            
Query: 44       gaggatctggtgccaactccatggggtcaacttcaaaaggccaaacatatcgntcangct 103
                ||||||||||||| | ||||||||| || ||||| |||||||| |||||||| ||| |||
Sbjct: 18885825 gaggatctggtgctagctccatgggatcgacttcgaaaggccagacatatcgctcaggct 18885884

                                                       
Query: 104      gcccatttntcgccaagctccaatcatataatcttntct 142
                  ||| || | ||||| |||||||| ||||||||| |||
Sbjct: 18885885 ttccacttcttgccaaactccaatcgtataatcttctct 18885923
to top
>emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa0028H02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 153064

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                         
Query: 44    gaggatctggtgccaactccatggggtcaacttcaaaaggccaaacatatcgntcangct 103
             ||||||||||||| | ||||||||| || ||||| |||||||| |||||||| ||| |||
Sbjct: 10781 gaggatctggtgctagctccatgggatcgacttcgaaaggccagacatatcgctcaggct 10722

                                                    
Query: 104   gcccatttntcgccaagctccaatcatataatcttntct 142
               ||| || | ||||| |||||||| ||||||||| |||
Sbjct: 10721 ttccacttcttgccaaactccaatcgtataatcttctct 10683
to top
>emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa0018L16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 151203

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                         
Query: 44    gaggatctggtgccaactccatggggtcaacttcaaaaggccaaacatatcgntcangct 103
             ||||||||||||| | ||||||||| || ||||| |||||||| |||||||| ||| |||
Sbjct: 55715 gaggatctggtgctagctccatgggatcgacttcgaaaggccagacatatcgctcaggct 55774

                                                    
Query: 104   gcccatttntcgccaagctccaatcatataatcttntct 142
               ||| || | ||||| |||||||| ||||||||| |||
Sbjct: 55775 ttccacttcttgccaaactccaatcgtataatcttctct 55813
to top
>dbj|AP006090.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT26D17, TM0154,
            complete sequence
          Length = 85795

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 115  gccaagctccaatcatataatctt 138
            ||||||||||||||||||||||||
Sbjct: 9520 gccaagctccaatcatataatctt 9497
to top
>gb|AC150307.3| Rhinolophus ferrumequinum clone VMRC7-71A7, complete sequence
          Length = 137605

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    tcaacttcaaaaggccaaaca 90
             |||||||||||||||||||||
Sbjct: 89248 tcaacttcaaaaggccaaaca 89268
to top
>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold
          Length = 1756392

 Score = 42.1 bits (21), Expect = 0.56
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 70      tcaacttcaaaaggccaaaca 90
               |||||||||||||||||||||
Sbjct: 1708035 tcaacttcaaaaggccaaaca 1708055
to top
>gb|DQ149611.1| Human adenovirus type 31 hexon protein gene, complete cds
          Length = 2769

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 61   tccatggggtcaacttcaaa 80
            ||||||||||||||||||||
Sbjct: 2642 tccatggggtcaacttcaaa 2623
to top
>emb|Y17253.1|HAY17253 Human adenovirus type 31 hexon gene (partial)
          Length = 790

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 61  tccatggggtcaacttcaaa 80
           ||||||||||||||||||||
Sbjct: 687 tccatggggtcaacttcaaa 668
to top
>gb|AC123659.11| Mus musculus chromosome 17, clone RP23-192P18, complete sequence
          Length = 207169

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   ccaagctccaatcatataa 134
             |||||||||||||||||||
Sbjct: 69179 ccaagctccaatcatataa 69197
to top
>gb|BC008799.2| Homo sapiens cortactin, transcript variant 2, mRNA (cDNA clone
            MGC:3591 IMAGE:3637586), complete cds
          Length = 3170

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 2822 ctttgtaggaaactcatct 2840
to top
>ref|NM_005231.2| Homo sapiens cortactin (CTTN), transcript variant 1, mRNA
          Length = 3243

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 2938 ctttgtaggaaactcatct 2956
to top
>ref|NM_138565.1| Homo sapiens cortactin (CTTN), transcript variant 2, mRNA
          Length = 3176

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 2828 ctttgtaggaaactcatct 2846
to top
>emb|AM041992.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Na
           04.1 TGB, isolate 1
          Length = 1270

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 528 tggggtcaacttcaaaagg 510
to top
>emb|AM041990.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.18 TGB, isolate 1
          Length = 1272

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 530 tggggtcaacttcaaaagg 512
to top
>emb|AM041989.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.17 TGB, isolate 1
          Length = 1270

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 529 tggggtcaacttcaaaagg 511
to top
>emb|AM041988.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.16 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 526 tggggtcaacttcaaaagg 508
to top
>emb|AM041987.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.15 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041986.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.14 TGB, isolate 1
          Length = 1268

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041985.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.13 TGB, isolate 1
          Length = 1265

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041983.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.11 TGB, isolate 1
          Length = 1267

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 526 tggggtcaacttcaaaagg 508
to top
>emb|AM041982.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.10 TGB, isolate 1
          Length = 1268

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041981.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.9 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041980.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.8 TGB, isolate 1
          Length = 1268

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 526 tggggtcaacttcaaaagg 508
to top
>emb|AM041979.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.7 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041978.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.6 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041977.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.5 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041976.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.4, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041975.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.3 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041974.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.2 TGB, isolate 1
          Length = 1268

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041973.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           04.1 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041972.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Am
           04.2 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041971.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Am
           04.1 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041970.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.15 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041969.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Ba
           03.1 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041968.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.14 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041967.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.13 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041966.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.12 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041965.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.11 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041964.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.10 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041963.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.9 TGB, isolate 1
          Length = 1256

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 514 tggggtcaacttcaaaagg 496
to top
>emb|AM041962.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.8 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041961.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.7 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041960.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.6 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041959.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.5 TGB, isolate 1
          Length = 1263

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 521 tggggtcaacttcaaaagg 503
to top
>emb|AM041958.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.4 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041956.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.2 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041955.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           03.1 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041954.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Al
           01.3 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 525 tggggtcaacttcaaaagg 507
to top
>emb|AM041953.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Al
           01.2 TGB, isolate 1
          Length = 1248

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 525 tggggtcaacttcaaaagg 507
to top
>emb|AM041952.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Al
           01.1 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041951.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.10 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041948.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone CI
           01.2 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041947.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone CI
           01.1 TGB, isolate 1
          Length = 1265

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041946.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Am
           01.2 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041945.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Am
           01.1 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041944.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.9 TGB, isolate 1
          Length = 1256

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 514 tggggtcaacttcaaaagg 496
to top
>emb|AM041943.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.8 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041942.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.7 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041941.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.6 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041940.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.5 TGB, isolate 1
          Length = 1256

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 514 tggggtcaacttcaaaagg 496
to top
>emb|AM041939.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.4 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041938.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.3, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041937.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.2, isolate 1
          Length = 1265

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 523 tggggtcaacttcaaaagg 505
to top
>emb|AM041936.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           01.1 TGB, isolate 1
          Length = 1267

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041934.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           00.5 TGB, isolate 1
          Length = 1269

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 527 tggggtcaacttcaaaagg 509
to top
>emb|AM041933.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           00.4 TGB, isolate 1
          Length = 1265

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041931.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           00.2 TGB, isolate 1
          Length = 1261

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041930.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           00.1 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>emb|AM041929.1| Pepino mosaic virus TGBp1 gene, TGBp2 gene and TGBp3 gene, clone Mu
           98.1 TGB, isolate 1
          Length = 1266

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 65  tggggtcaacttcaaaagg 83
           |||||||||||||||||||
Sbjct: 524 tggggtcaacttcaaaagg 506
to top
>gb|AC125339.4| Mus musculus BAC clone RP24-356P17 from chromosome 17, complete
             sequence
          Length = 156282

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   ccaagctccaatcatataa 134
             |||||||||||||||||||
Sbjct: 25306 ccaagctccaatcatataa 25324
to top
>ref|XM_503490.1| Yarrowia lipolytica CLIB122, YALI0E03234g predicted mRNA
          Length = 2493

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 22   aactcatcttcccgttcct 40
            |||||||||||||||||||
Sbjct: 2039 aactcatcttcccgttcct 2021
to top
>emb|AJ606360.1| Pepino mosaic virus complete genome, isolate LE-2002
          Length = 6449

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 65   tggggtcaacttcaaaagg 83
            |||||||||||||||||||
Sbjct: 4909 tggggtcaacttcaaaagg 4891
to top
>emb|AJ606359.1| Pepino mosaic virus complete genome, isolate LE-2000
          Length = 6450

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 65   tggggtcaacttcaaaagg 83
            |||||||||||||||||||
Sbjct: 4909 tggggtcaacttcaaaagg 4891
to top
>emb|CR861394.1| Pongo pygmaeus mRNA; cDNA DKFZp459H142 (from clone DKFZp459H142)
          Length = 3128

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 2811 ctttgtaggaaactcatct 2829
to top
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 70      tcaacttcaaaaggccaaa 88
               |||||||||||||||||||
Sbjct: 2699119 tcaacttcaaaaggccaaa 2699137



 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 70      tcaacttcaaaaggccaaa 88
               |||||||||||||||||||
Sbjct: 1385290 tcaacttcaaaaggccaaa 1385308
to top
>gb|AF340024.1| Pepino mosaic virus replicase gene, partial cds; and Orf2, Orf3,
            Orf4, and putative coat protein genes, complete cds
          Length = 3599

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 65   tggggtcaacttcaaaagg 83
            |||||||||||||||||||
Sbjct: 2102 tggggtcaacttcaaaagg 2084
to top
>dbj|AK091778.1| Homo sapiens cDNA FLJ34459 fis, clone HLUNG2002916, highly similar to
            SRC SUBSTRATE CORTACTIN
          Length = 2457

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 2157 ctttgtaggaaactcatct 2175
to top
>emb|CR600359.1| full-length cDNA clone CS0DI056YA17 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1732

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 1469 ctttgtaggaaactcatct 1487
to top
>gb|AC138310.3| Mus musculus BAC clone RP23-205H21 from chromosome 17, complete sequence
          Length = 195483

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 116    ccaagctccaatcatataa 134
              |||||||||||||||||||
Sbjct: 169161 ccaagctccaatcatataa 169179
to top
>gb|AC090884.1|AC090884 Homo sapiens chromosome 3 clone RP11-165B2 map 3p, complete sequence
          Length = 166991

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    ctttgtaggaaactcatct 30
             |||||||||||||||||||
Sbjct: 50812 ctttgtaggaaactcatct 50830
to top
>gb|M98343.1|HUMEMS Homo sapiens amplaxin (EMS1) mRNA, complete cds
          Length = 3248

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 12   ctttgtaggaaactcatct 30
            |||||||||||||||||||
Sbjct: 2938 ctttgtaggaaactcatct 2956
to top
>gb|AC090646.2| Homo sapiens chromosome 3 clone RP11-690A6 map 3p, complete sequence
          Length = 165681

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    ctttgtaggaaactcatct 30
             |||||||||||||||||||
Sbjct: 18897 ctttgtaggaaactcatct 18915
to top
>gb|AC069462.3| Homo sapiens chromosome 3 clone RP11-271E2 map 3p, complete sequence
          Length = 161577

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     ctttgtaggaaactcatct 30
              |||||||||||||||||||
Sbjct: 140026 ctttgtaggaaactcatct 140044
to top
>dbj|AB036705.1| Homo sapiens EMS1 gene for cortactin, partial cds
          Length = 46235

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    ctttgtaggaaactcatct 30
             |||||||||||||||||||
Sbjct: 44793 ctttgtaggaaactcatct 44811
to top
>gb|AF484251.1| Pepino mosaic virus isolate Sp-13, complete genome
          Length = 6450

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 65   tggggtcaacttcaaaagg 83
            |||||||||||||||||||
Sbjct: 4909 tggggtcaacttcaaaagg 4891
to top
>gb|AC155306.2| Mus musculus BAC clone RP24-211K15 from 13, complete sequence
          Length = 153008

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    acttcaaaaggccaaacat 91
             |||||||||||||||||||
Sbjct: 44234 acttcaaaaggccaaacat 44216
to top
>dbj|AP000487.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-66H16, complete
              sequence
          Length = 177076

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     ctttgtaggaaactcatct 30
              |||||||||||||||||||
Sbjct: 133904 ctttgtaggaaactcatct 133922
to top
>emb|CR956421.19| Pig DNA sequence from clone PigE-225A14 on chromosome 6, complete
             sequence
          Length = 127959

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    ctccatggggtcaacttca 78
             |||||||||||||||||||
Sbjct: 33086 ctccatggggtcaacttca 33104
to top
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia
              lipolytica
          Length = 4224103

 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     aactcatcttcccgttcct 40
              |||||||||||||||||||
Sbjct: 352956 aactcatcttcccgttcct 352974


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 778,919
Number of Sequences: 3902068
Number of extensions: 778919
Number of successful extensions: 57302
Number of sequences better than 10.0: 90
Number of HSP's better than 10.0 without gapping: 90
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57140
Number of HSP's gapped (non-prelim): 162
length of query: 178
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 156
effective length of database: 17,147,199,772
effective search space: 2674963164432
effective search space used: 2674963164432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top