>gb|AY013246.1| Hordeum vulgare chromosome 5 BAC 635P2, complete sequence
          Length = 102433

 Score =  137 bits (69), Expect = 2e-29
 Identities = 110/126 (87%), Gaps = 2/126 (1%)
 Strand = Plus / Minus

                                                                         
Query: 5     tgttggcgttatccagagtggaatacgtatatat--cagaatgtgggttacatatgatgg 62
             |||||||||||| |||||||||||||||||||||  ||||||||| |||||||||| |||
Sbjct: 81036 tgttggcgttatacagagtggaatacgtatatatatcagaatgtgcgttacatatggtgg 80977

                                                                         
Query: 63    atcccaacgaaatggtgtctgnctaaccgaggaggnnnnnnnnnaccaggcaaggaaaca 122
             ||||||||||||||||||||  |||||||||||||         ||||||||||||||||
Sbjct: 80976 atcccaacgaaatggtgtctacctaaccgaggaggagagagatcaccaggcaaggaaaca 80917

                   
Query: 123   ctattg 128
             ||||||
Sbjct: 80916 ctattg 80911

>gb|AF459639.1| Triticum monococcum BAC clones 116F2 and 115G1 gene sequence
          Length = 215241

 Score = 48.1 bits (24), Expect = 0.011
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 5      tgttggcgttatccagagtggaatacgt 32
              ||||||||||||| ||||||||||||||
Sbjct: 193728 tgttggcgttatcgagagtggaatacgt 193701


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 708,285
Number of Sequences: 3902068
Number of extensions: 708285
Number of successful extensions: 42049
Number of sequences better than 10.0: 2
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42045
Number of HSP's gapped (non-prelim): 3
length of query: 209
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 187
effective length of database: 17,147,199,772
effective search space: 3206526357364
effective search space used: 3206526357364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)