ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaak4h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL136164.8| Human DNA sequence from clone RP3-331H24 on chro... 42 0.92
2gb|AC005813.13|AC005813 Drosophila melanogaster, chromosome 3R, ... 42 0.92
3gb|AC008214.4|AC008214 Drosophila melanogaster, chromosome 3R, r... 42 0.92
4gb|AE003756.3| Drosophila melanogaster chromosome 3R, section 94... 42 0.92
5emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chro... 42 0.92
6ref|XM_633680.1| Dictyostelium discoideum hypothetical protein (... 40 3.6
7gb|AE017335.3| Bacillus anthracis str. 'Ames Ancestor' plasmid p... 40 3.6
8gb|AF188935.1| Bacillus anthracis plasmid pXO2, complete sequence 40 3.6
9gb|AC105910.10| Homo sapiens chromosome 8, clone CTD-2036J7, com... 40 3.6
10gb|AE011191.1| Bacillus anthracis str. A2012 plasmid pXO2, compl... 40 3.6
11emb|AL121767.6|CNS01DSC Human chromosome 14 DNA sequence BAC C-2... 40 3.6
12emb|AL133233.2|CNS01DUA Human chromosome 14 DNA sequence BAC R-3... 40 3.6
13emb|AL807234.6| Mouse DNA sequence from clone RP23-293E12 on chr... 40 3.6

>emb|AL136164.8| Human DNA sequence from clone RP3-331H24 on chromosome 6 Contains the
             5' end of a novel gene, the gene for a novel protein
             similar to opioid growth factor receptor and a CpG island,
             complete sequence
          Length = 108253

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 141   ttctaaagtggatgcaaaactgaca 165
             |||||||||||||||||||| ||||
Sbjct: 83740 ttctaaagtggatgcaaaacagaca 83716



to top

>gb|AC005813.13|AC005813 Drosophila melanogaster, chromosome 3R, region 97B2-97B9, BAC clone
              BACR48G23, complete sequence
          Length = 166543

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acacaagataataatataata 90
              |||||||||||||||||||||
Sbjct: 158290 acacaagataataatataata 158270



to top

>gb|AC008214.4|AC008214 Drosophila melanogaster, chromosome 3R, region 97B-97C, BAC clone
             BACR13P17, complete sequence
          Length = 170403

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    acacaagataataatataata 90
             |||||||||||||||||||||
Sbjct: 17793 acacaagataataatataata 17773



to top

>gb|AE003756.3| Drosophila melanogaster chromosome 3R, section 94 of 118 of the complete
              sequence
          Length = 322332

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 70     acacaagataataatataata 90
              |||||||||||||||||||||
Sbjct: 262050 acacaagataataatataata 262030



to top

>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete
             sequence
          Length = 129438

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 66    tgagacacaagataataatataata 90
             ||||| |||||||||||||||||||
Sbjct: 86426 tgagatacaagataataatataata 86450



to top

>ref|XM_633680.1| Dictyostelium discoideum hypothetical protein (DDB0185867), partial
           mRNA
          Length = 1230

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 74  aagataataatataatacta 93
           ||||||||||||||||||||
Sbjct: 374 aagataataatataatacta 393



to top

>gb|AE017335.3| Bacillus anthracis str. 'Ames Ancestor' plasmid pXO2, complete sequence
          Length = 94830

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   gcaaaactgacagccaaatt 173
             ||||||||||||||||||||
Sbjct: 40431 gcaaaactgacagccaaatt 40450



to top

>gb|AF188935.1| Bacillus anthracis plasmid pXO2, complete sequence
          Length = 96231

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   gcaaaactgacagccaaatt 173
             ||||||||||||||||||||
Sbjct: 40929 gcaaaactgacagccaaatt 40948



to top

>gb|AC105910.10| Homo sapiens chromosome 8, clone CTD-2036J7, complete sequence
          Length = 190836

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    cacaagataataatataata 90
             ||||||||||||||||||||
Sbjct: 74661 cacaagataataatataata 74642



to top

>gb|AE011191.1| Bacillus anthracis str. A2012 plasmid pXO2, complete sequence
          Length = 94829

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 154   gcaaaactgacagccaaatt 173
             ||||||||||||||||||||
Sbjct: 40431 gcaaaactgacagccaaatt 40450



to top

>emb|AL121767.6|CNS01DSC Human chromosome 14 DNA sequence BAC C-2593I21 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 208309

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     ataataatataatactacat 96
              ||||||||||||||||||||
Sbjct: 184642 ataataatataatactacat 184661



to top

>emb|AL133233.2|CNS01DUA Human chromosome 14 DNA sequence BAC R-34O18 of library RPCI-11
           from chromosome 14 of Homo sapiens (Human), complete
           sequence
          Length = 168991

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 77  ataataatataatactacat 96
           ||||||||||||||||||||
Sbjct: 428 ataataatataatactacat 447



to top

>emb|AL807234.6| Mouse DNA sequence from clone RP23-293E12 on chromosome 4, complete
              sequence
          Length = 226546

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 54     aacagctgtttatgagacac 73
              ||||||||||||||||||||
Sbjct: 163278 aacagctgtttatgagacac 163297


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,222,102
Number of Sequences: 3902068
Number of extensions: 2222102
Number of successful extensions: 45536
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45521
Number of HSP's gapped (non-prelim): 15
length of query: 278
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 256
effective length of database: 17,147,199,772
effective search space: 4389683141632
effective search space used: 4389683141632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top