ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbaak4h01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 731 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 676
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 1192 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 1137
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 10793727 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 10793672
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 23604274 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 23604219
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 17450 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 17395
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 66973 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 66918
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 130345 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 130290
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 802 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 747
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 801 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 746
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 1231 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 1176
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 795 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 740
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 800 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 745
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 802 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 747
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 331 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 276
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 800 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 745
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 800 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 745
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 67.9 bits (34), Expect = 3e-09 Identities = 50/56 (89%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||||||||||||||||| ||| || ||||| Sbjct: 781 tcggcgaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctg 726
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 61.9 bits (31), Expect = 2e-07 Identities = 50/57 (87%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctgc 62 |||| ||| ||||| || ||||||||||||||||||||||||| ||| || |||||| Sbjct: 809 tcggagaggtggtcggcgaggttctcgagggggcccttgccggtgacgatggcctgc 753
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 61.9 bits (31), Expect = 2e-07 Identities = 50/57 (87%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctgc 62 |||| ||| ||||| || |||||||||| |||||||||||||| ||| ||||||||| Sbjct: 2666 tcggtgaggtggtcggcgaggttctcgatggggcccttgccggtgacgatagcctgc 2610
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 61.9 bits (31), Expect = 2e-07 Identities = 50/57 (87%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctgc 62 |||||||||||||| || | |||||||||||||||||| |||| ||| || |||||| Sbjct: 1140 tcggcgagatggtccgccaagttctcgagggggcccttcccggtgacgatggcctgc 1084
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 60.0 bits (30), Expect = 6e-07 Identities = 49/56 (87%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||| || ||||||||||| ||||||||||||| ||| || ||||| Sbjct: 755 tcggcgaggtggtcggcgaggttctcgagcgggcccttgccggtgacgatggcctg 700
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 58.0 bits (29), Expect = 2e-06 Identities = 42/47 (89%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||||||||| ||||||||||||| ||| || ||||| Sbjct: 1616 tggtcagcgaggttctcgagcgggcccttgccggtgacgatggcctg 1570
>gb|AY171231.1| Chlamydomonas reinhardtii light-harvesting complex I protein (Lhca) mRNA, complete cds; nuclear gene for chloroplast product Length = 1274 Score = 54.0 bits (27), Expect = 4e-05 Identities = 32/34 (94%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccgg 48 |||||||| ||||| ||||||||||||||||||| Sbjct: 672 tggtcagccaggttgtcgagggggcccttgccgg 639
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 54.0 bits (27), Expect = 4e-05 Identities = 49/57 (85%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctgc 62 |||||||||||||| || | |||||||||||| ||||| |||| ||| || |||||| Sbjct: 920 tcggcgagatggtccgccaagttctcgaggggccccttcccggtgacgatggcctgc 864
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 52.0 bits (26), Expect = 2e-04 Identities = 48/56 (85%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 ||||||| |||||||| |||||||| || ||||||||||||| ||| || ||||| Sbjct: 764 tcggcgatgtggtcagcgaggttctcaagagggcccttgccggtgactatggcctg 709
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 52.0 bits (26), Expect = 2e-04 Identities = 48/56 (85%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 ||||||| ||||| || |||||||||| |||||||||||||| ||| || ||||| Sbjct: 1479 tcggcgatgtggtcggccaggttctcgatggggcccttgccggtgacgatggcctg 1424
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 50.1 bits (25), Expect = 6e-04 Identities = 41/47 (87%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||||||||| |||||||| |||| ||| || ||||| Sbjct: 1746 tggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctg 1700
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 50.1 bits (25), Expect = 6e-04 Identities = 41/47 (87%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||||||||| |||||||| |||| ||| || ||||| Sbjct: 798 tggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctg 752
>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev Length = 326 Score = 50.1 bits (25), Expect = 6e-04 Identities = 33/36 (91%) Strand = Plus / Plus Query: 8 ggcgagatggtcagcnaggttctcgagggggccctt 43 |||||| |||||||| ||||||||||| |||||||| Sbjct: 3 ggcgaggtggtcagcgaggttctcgagcgggccctt 38
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 50.1 bits (25), Expect = 6e-04 Identities = 41/47 (87%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||||||||| |||||||| |||| ||| || ||||| Sbjct: 1746 tggtcagcgaggttctcgagcgggcccttcccggtgacgatggcctg 1700
>gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding protein (Cab) clone pCab10, 3' end and flank Length = 367 Score = 50.1 bits (25), Expect = 6e-04 Identities = 50/59 (84%) Strand = Plus / Minus Query: 3 ggatcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| ||||||||||| |||||||| | || ||||| |||| ||| |||||||| Sbjct: 179 ggatcggcaagatggtcagcaaggttctccaatggaccctttccggtgacgatagcctg 121
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 48.1 bits (24), Expect = 0.002 Identities = 35/39 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctgc 62 |||||||||| |||||||||||||| ||| || |||||| Sbjct: 755 aggttctcgatggggcccttgccggtgacgatggcctgc 717
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 48.1 bits (24), Expect = 0.002 Identities = 35/39 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctgc 62 |||||||||| |||||||||||||| ||| || |||||| Sbjct: 403 aggttctcgatggggcccttgccggtgacgatggcctgc 365
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Plus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 79045 aggttctcgatggggcccttgccggtgacgatggcctg 79082
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 21808771 aggttctcgatggggcccttgccggtgacgatggcctg 21808734
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 21801800 aggttctcgatggggcccttgccggtgacgatggcctg 21801763
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 46.1 bits (23), Expect = 0.009 Identities = 31/34 (91%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccgg 48 |||||||| ||||||| || |||||||||||||| Sbjct: 739 tggtcagccaggttctggatggggcccttgccgg 706
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 770 aggttctcgatggggcccttgccggtgacgatggcctg 733
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 345 aggttctcgatggggcccttgccggtgacgatggcctg 308
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 759 aggttctcgatggggcccttgccggtgacgatggcctg 722
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 46.1 bits (23), Expect = 0.009 Identities = 45/53 (84%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagc 58 ||||||| |||||||| |||||||| || ||||||||||| | ||| ||||| Sbjct: 755 tcggcgatgtggtcagcgaggttctcaagtgggcccttgcccgtgacgatagc 703
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 46.1 bits (23), Expect = 0.009 Identities = 34/38 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| |||||||||||||| ||| || ||||| Sbjct: 751 aggttctcgatggggcccttgccggtgacgatggcctg 714
>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein Length = 1067 Score = 44.1 bits (22), Expect = 0.037 Identities = 27/29 (93%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggccctt 43 |||||||| |||||||| ||||||||||| Sbjct: 714 tggtcagccaggttctccagggggccctt 686
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 44.1 bits (22), Expect = 0.037 Identities = 41/48 (85%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccggngacaatagcctgc 62 ||||| || |||||||| | ||||||||||||| |||||| |||||| Sbjct: 732 tggtcggcaaggttctccaatgggcccttgccggtgacaatggcctgc 685
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 44.1 bits (22), Expect = 0.037 Identities = 33/37 (89%) Strand = Plus / Minus Query: 26 gttctcgagggggcccttgccggngacaatagcctgc 62 |||||| | |||||||||||||| |||||| |||||| Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgc 1635
>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding protein mRNA, partial cds Length = 191 Score = 44.1 bits (22), Expect = 0.037 Identities = 27/29 (93%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngac 52 |||||||||| |||||||||||||| ||| Sbjct: 37 aggttctcgatggggcccttgccggtgac 9
>emb|CR954257.1| Anopheles gambiae Pen-1 region; BAC clone 32F02 from library NotreDame1 of Anopheles gambiae (African malaria mosquito) strain PEST Length = 137277 Score = 42.1 bits (21), Expect = 0.15 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 caggatcggcgagatggtcag 21 ||||||||||||||||||||| Sbjct: 50192 caggatcggcgagatggtcag 50172
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 42.1 bits (21), Expect = 0.15 Identities = 35/40 (87%) Strand = Plus / Minus Query: 9 gcgagatggtcagcnaggttctcgagggggcccttgccgg 48 ||||| ||||| || | |||||||||||| |||||||||| Sbjct: 651 gcgaggtggtcggccaagttctcgaggggtcccttgccgg 612
>dbj|AB122120.1| Chlamydomonas reinhardtii LhcI-7 gene for light-harvesting chlorophyll-a/b protein of photosystem I, complete cds Length = 2261 Score = 42.1 bits (21), Expect = 0.15 Identities = 24/25 (96%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccgg 48 ||||| ||||||||||||||||||| Sbjct: 1868 aggttgtcgagggggcccttgccgg 1844
>ref|XM_321363.2| Anopheles gambiae str. PEST ENSANGP00000012206 (ENSANGG00000009717), partial mRNA Length = 1521 Score = 42.1 bits (21), Expect = 0.15 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 caggatcggcgagatggtcag 21 ||||||||||||||||||||| Sbjct: 1275 caggatcggcgagatggtcag 1255
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 42.1 bits (21), Expect = 0.15 Identities = 32/36 (88%) Strand = Plus / Minus Query: 26 gttctcgagggggcccttgccggngacaatagcctg 61 |||||||| |||||||||||||| ||| || ||||| Sbjct: 764 gttctcgatggggcccttgccggtgacgatggcctg 729
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 40.1 bits (20), Expect = 0.58 Identities = 42/50 (84%) Strand = Plus / Minus Query: 12 agatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 ||||||||||| |||||||| | || ||||| |||| ||||||||||| Sbjct: 792 agatggtcagcaaggttctccaaaggaccctttccggtcacaatagcctg 743
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 40.1 bits (20), Expect = 0.58 Identities = 25/27 (92%) Strand = Plus / Minus Query: 36 gggcccttgccggngacaatagcctgc 62 ||||||||||||| |||||| |||||| Sbjct: 916 gggcccttgccggtgacaatggcctgc 890
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 40.1 bits (20), Expect = 0.58 Identities = 22/23 (95%) Strand = Plus / Minus Query: 9 gcgagatggtcagcnaggttctc 31 |||||||||||||| |||||||| Sbjct: 948 gcgagatggtcagcaaggttctc 926
>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex II protein m9 mRNA, partial cds; nuclear gene for chloroplast product Length = 577 Score = 38.2 bits (19), Expect = 2.3 Identities = 30/34 (88%) Strand = Plus / Minus Query: 15 tggtcagcnaggttctcgagggggcccttgccgg 48 ||||||| ||||||| || |||||||||||||| Sbjct: 399 tggtcagtcaggttctggatggggcccttgccgg 366
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 762 aggttctccaaggggcccttgccggtgacgatggcctg 725
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 786 aggttctccaaggggcccttgccggtgacgatggcctg 749
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 786 aggttctccaaggggcccttgccggtgacgatggcctg 749
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 788 aggttctccaaggggcccttgccggtgacgatggcctg 751
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 793 aggttctccaaggggcccttgccggtgacgatggcctg 756
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 826 aggttctccaaggggcccttgccggtgacgatggcctg 789
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 38.2 bits (19), Expect = 2.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 5 atcggcgagatggtcagcnagg 26 |||||||||||||||||| ||| Sbjct: 5692735 atcggcgagatggtcagcgagg 5692756
>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein Length = 1746 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||||| ||| ||||| || | |||||||||||| Sbjct: 1268 aggttctcgatgggaccctttccagtgacaatagcctg 1231
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m9 (Lhcbm9) mRNA, complete cds Length = 1221 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 ||||||| || |||||||||||||| ||||| ||||| Sbjct: 720 aggttctggatggggcccttgccggtcacaatggcctg 683
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 22434799 aggttctccaaggggcccttgccggtgacgatggcctg 22434762
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 95866 aggttctccaaggggcccttgccggtgacgatggcctg 95829
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 762 aggttctccaaggggcccttgccggtgacgatggcctg 725
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 786 aggttctccaaggggcccttgccggtgacgatggcctg 749
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 786 aggttctccaaggggcccttgccggtgacgatggcctg 749
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 793 aggttctccaaggggcccttgccggtgacgatggcctg 756
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 38.2 bits (19), Expect = 2.3 Identities = 33/38 (86%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngacaatagcctg 61 |||||||| | |||||||||||||| ||| || ||||| Sbjct: 791 aggttctccaaggggcccttgccggtgacgatggcctg 754
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 5 atcggcgagatggtcagc 22 |||||||||||||||||| Sbjct: 5484064 atcggcgagatggtcagc 5484081
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Minus Query: 1 caggatcggcgagatggtcagc 22 ||||||| |||||||||||||| Sbjct: 4711956 caggatcagcgagatggtcagc 4711935
>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome Length = 3147090 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 3 ggatcggcgagatggtca 20 |||||||||||||||||| Sbjct: 2190948 ggatcggcgagatggtca 2190965
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 36.2 bits (18), Expect = 9.1 Identities = 26/29 (89%) Strand = Plus / Minus Query: 24 aggttctcgagggggcccttgccggngac 52 |||||||| | |||||||||||||| ||| Sbjct: 787 aggttctccaaggggcccttgccggtgac 759
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 36.2 bits (18), Expect = 9.1 Identities = 46/56 (82%) Strand = Plus / Minus Query: 6 tcggcgagatggtcagcnaggttctcgagggggcccttgccggngacaatagcctg 61 ||||| ||||| ||||| |||||||| | || ||||| |||| ||||||||||| Sbjct: 797 tcggcaagatgatcagcaaggttctccaaaggtccctttccggtcacaatagcctg 742 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 123,225 Number of Sequences: 3902068 Number of extensions: 123225 Number of successful extensions: 6276 Number of sequences better than 10.0: 83 Number of HSP's better than 10.0 without gapping: 83 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 6138 Number of HSP's gapped (non-prelim): 138 length of query: 62 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 41 effective length of database: 17,151,101,840 effective search space: 703195175440 effective search space used: 703195175440 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)
