ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbaak4g23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016462.1| Zea mays clone Contig295 mRNA sequence 280 4e-72
2gb|BT016812.1| Zea mays clone Contig645 mRNA sequence 280 4e-72
3gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds 280 4e-72
4gb|AY109330.1| Zea mays CL45_1 mRNA sequence 280 4e-72
5emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat ... 264 2e-67
6gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 262 9e-67
7dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 262 9e-67
8ref|XM_475365.1| Oryza sativa (japonica cultivar-group), predic... 258 1e-65
9gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome... 244 2e-61
10emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70 244 2e-61
11dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 244 2e-61
12dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 2e-61
13dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 2e-61
14dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clon... 244 2e-61
15gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 244 2e-61
16emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat ... 238 1e-59
17gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 220 3e-54
18gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str... 220 3e-54
19dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 220 3e-54
20gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str... 220 3e-54
21dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 3e-54
22dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 3e-54
23dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 3e-54
24ref|NM_190528.1| Oryza sativa (japonica cultivar-group), predic... 212 7e-52
25dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 212 7e-52
26dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D... 212 7e-52
27dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D... 212 7e-52
28ref|XM_470141.1| Oryza sativa (japonica cultivar-group), mRNA 210 3e-51
29gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic ... 210 3e-51
30dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 3e-51
31dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 3e-51
32gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp7... 186 4e-44
33gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock prote... 178 1e-41
34gb|BT016692.1| Zea mays clone Contig525 mRNA sequence 167 4e-38
35gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence 167 4e-38
36gb|AY104350.1| Zea mays PCO083553 mRNA sequence 163 6e-37
37emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon ... 161 2e-36
38gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein ... 161 2e-36
39emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock... 141 2e-30
40gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70... 141 2e-30
41gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRN... 141 2e-30
42gb|AY106152.1| Zea mays PCO094428 mRNA sequence 131 2e-27
43emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock pro... 127 3e-26
44gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial s... 123 5e-25
45gb|AF161180.1|AF161180 Malus domestica high molecular weight hea... 123 5e-25
46dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein... 119 8e-24
47gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cogna... 115 1e-22
48gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70... 105 1e-19
49gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70... 105 1e-19
50gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70... 105 1e-19
51gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock c... 101 2e-18
52dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 100 8e-18
53dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 100 8e-18
54gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mR... 98 3e-17
55gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-4... 98 3e-17
56gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock c... 98 3e-17
57dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 98 3e-17
58gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate ... 98 3e-17
59gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds 96 1e-16
60gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein... 92 2e-15
61gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, c... 90 7e-15
62gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-... 90 7e-15
63gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) m... 90 7e-15
64gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mR... 90 7e-15
65gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1... 84 5e-13
66gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds 84 5e-13
67gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence 82 2e-12
68emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for hea... 82 2e-12
69gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F... 82 2e-12
70gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) m... 78 3e-11
71gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete s... 78 3e-11
72gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete seq... 78 3e-11
73ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G0... 74 4e-10
74emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein 74 4e-10
75emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene 74 4e-10
76emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognat... 74 4e-10
77gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular... 74 4e-10
78emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, B... 74 4e-10
79gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperon... 74 4e-10
80gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, co... 74 4e-10
81emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Co... 74 4e-10
82gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-... 74 4e-10
83gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70)... 74 4e-10
84emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for hea... 72 2e-09
85gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA... 72 2e-09
86gb|DQ295224.1| Malawimonas jakobiformis cytosolic heat shock pro... 70 7e-09
87gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow t... 68 3e-08
88dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 7... 68 3e-08
89gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2... 66 1e-07
90emb|X62799.1|GMHSP70 Glycine max hsp 70 gene 66 1e-07
91gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, comple... 66 1e-07
92dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ... 66 1e-07
93ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA... 64 4e-07
94gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669... 64 4e-07
95gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds 64 4e-07
96gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperon... 64 4e-07
97emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, par... 64 4e-07
98gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducibl... 62 2e-06
99gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducibl... 62 2e-06
100ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G... 60 7e-06
101gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 hea... 60 7e-06
102emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70 60 7e-06
103gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13... 60 7e-06
104emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA 58 3e-05
105emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA 58 3e-05
106emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA 58 3e-05
107emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA 58 3e-05
108emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA 58 3e-05
109emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA 58 3e-05
110emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA 58 3e-05
111emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA 58 3e-05
112emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA 58 3e-05
113emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA 58 3e-05
114emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA 58 3e-05
115emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA 58 3e-05
116emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA 58 3e-05
117emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA 58 3e-05
118emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA 58 3e-05
119emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA 58 3e-05
120emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA 58 3e-05
121emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA 58 3e-05
122emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA 58 3e-05
123emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA 58 3e-05
124emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA 58 3e-05
125emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA 58 3e-05
126emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA 58 3e-05
127emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA 58 3e-05
128emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA 58 3e-05
129emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA 58 3e-05
130emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA 58 3e-05
131emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA 58 3e-05
132emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA 58 3e-05
133emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA 58 3e-05
134emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA 58 3e-05
135emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA 58 3e-05
136emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA 58 3e-05
137emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA 58 3e-05
138emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA 58 3e-05
139emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA 58 3e-05
140emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA 58 3e-05
141emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA 58 3e-05
142emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA 58 3e-05
143emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA 58 3e-05
144emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA 58 3e-05
145emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA 58 3e-05
146emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA 58 3e-05
147emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA 58 3e-05
148emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA 58 3e-05
149emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA 58 3e-05
150emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA 58 3e-05
151emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA 58 3e-05
152emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA 58 3e-05
153emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA 58 3e-05
154emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA 58 3e-05
155emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA 58 3e-05
156emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA 58 3e-05
157emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA 58 3e-05
158emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA 58 3e-05
159emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA 58 3e-05
160emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA 58 3e-05
161emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA 58 3e-05
162emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA 58 3e-05
163emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA 58 3e-05
164emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA 58 3e-05
165emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA 58 3e-05
166emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA 58 3e-05
167emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA 58 3e-05
168emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA 58 3e-05
169emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA 58 3e-05
170emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA 58 3e-05
171emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70 58 3e-05
172emb|X06932.1|PHHSP70G Petunia hsp70 gene 58 3e-05
173ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock co... 58 3e-05
174dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecula... 58 3e-05
175gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing ... 58 3e-05
176emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock pro... 56 1e-04
177emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA 56 1e-04
178emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA 56 1e-04
179emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA 56 1e-04
180emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA 56 1e-04
181emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA 56 1e-04
182gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds 56 1e-04
183ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G125... 54 4e-04
184emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in ... 54 4e-04
185gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, comp... 54 4e-04
186emb|AJ002551.1|ATAJ2551 Arabidopsis thaliana mRNA for heat shock... 54 4e-04
187gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein... 54 4e-04
188gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70)... 54 4e-04
189gb|AY059885.1| Arabidopsis thaliana 70 kDa heat shock protein (T... 54 4e-04
190gb|AY054190.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, co... 54 4e-04
191gb|AY054183.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, co... 54 4e-04
192gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E... 54 4e-04
193gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) ... 54 4e-04
194dbj|AP002055.2| Arabidopsis thaliana genomic DNA, chromosome 3, ... 54 4e-04
195gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hs... 52 0.002
196gb|AY219845.1| Cyprinus carpio constitutive heat shock protein H... 52 0.002
197dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 52 0.002
198dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 7... 52 0.002
199gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 prote... 52 0.002
200dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cogn... 52 0.002
201gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 52 0.002
202gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3... 50 0.006
203gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (... 50 0.006
204gb|AY524794.1| Thellungiella halophila heat shock cognate protei... 50 0.006
205gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) ... 50 0.006
206emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protei... 50 0.006
207emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Co... 50 0.006
208emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protei... 50 0.006
209gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa p... 50 0.006
210gb|U08820.1|PSU08820 Pisum sativum HSP70b mRNA, partial cds 50 0.006
211gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA 48 0.025
212ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.025
213ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.025
214ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.025
215ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase bin... 48 0.025
216gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein... 48 0.025
217emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA 48 0.025
218ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.025
219ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.025
220ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.025
221ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.025
222ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.025
223ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.025
224emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6 48 0.025
225emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognat... 48 0.025
226emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1 48 0.025
227ref|NM_176503.1| Drosophila melanogaster Heat shock protein cogn... 48 0.025
228ref|NM_176502.1| Drosophila melanogaster Heat shock protein cogn... 48 0.025
229ref|NM_169627.1| Drosophila melanogaster Heat shock protein cogn... 48 0.025
230ref|NM_169626.1| Drosophila melanogaster Heat shock protein cogn... 48 0.025
231ref|NM_169625.1| Drosophila melanogaster Heat shock protein cogn... 48 0.025
232dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock prote... 48 0.025
233ref|NM_079632.4| Drosophila melanogaster Heat shock protein cogn... 48 0.025
234gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA 48 0.025
235ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing fact... 48 0.025
236ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing fact... 48 0.025
237gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene 48 0.025
238gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88... 48 0.025
239emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7 48 0.025
240gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, r... 48 0.025
241ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA 48 0.025
242emb|X95688.1|ACHSP70HM A.cepa mRNA for heat shock protein 70-lik... 48 0.025
243gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46... 48 0.025
244gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 ... 48 0.025
245gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognat... 48 0.025
246gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4)... 48 0.025
247gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytos... 46 0.098
248gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic ... 46 0.098
249gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic s... 46 0.098
250gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 ge... 46 0.098
251ref|XM_508938.1| PREDICTED: Pan troglodytes similar to heat shoc... 46 0.098
252ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa pro... 46 0.098
253ref|XM_518899.1| PREDICTED: Pan troglodytes similar to Heat shoc... 46 0.098
254ref|NM_001003067.1| Canis familiaris heat shock protein 70 (HSP7... 46 0.098
255ref|NM_174550.1| Bos taurus heat shock 70 kD protein 1 (HSPA1A),... 46 0.098
256gb|AY662497.1| Bos taurus heat shock protein 70 kDa mRNA, comple... 46 0.098
257gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG... 46 0.098
258gb|BC063507.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (c... 46 0.098
259gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcri... 46 0.098
260gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcri... 46 0.098
261gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcri... 46 0.098
262gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cD... 46 0.098
263ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8)... 46 0.098
264gb|DQ440299.1| Aedes aegypti clone AET-381 heat shock cognate 70... 46 0.098
265gb|AY559741.1| Homo sapiens sequence in region of NEU1 and HSPA1... 46 0.098
266gb|AY466608.1| Sus scrofa heat shock protein 70.2 (hsp70.2) mRNA... 46 0.098
267gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cD... 46 0.098
268gb|BC009322.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (c... 46 0.098
269gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo... 46 0.098
270ref|XM_812644.1| Trypanosoma cruzi strain CL Brener heat shock p... 46 0.098
271ref|XM_812645.1| Trypanosoma cruzi strain CL Brener heat shock p... 46 0.098
272gb|BC018740.1| Homo sapiens heat shock 70kDa protein 1A, mRNA (c... 46 0.098
273gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNI... 46 0.098
274emb|AL929592.8| Human DNA sequence from clone DAQB-147D11 on chr... 46 0.098
275emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 46 0.098
276emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 46 0.098
277gb|AY149619.1| Bos taurus heat-shock 70-kilodalton protein 1A (H... 46 0.098
278gb|AY149618.1| Bos taurus heat-shock 70-kilodalton protein 1A (H... 46 0.098
279emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cogna... 46 0.098
280emb|X67716.1|TCHSPR70 T.cruzi mRNA for HSP70 46 0.098
281emb|X58715.1|TCHSP70PA T.cruzi hsp70 mRNA for 70 kDa heat shock ... 46 0.098
282emb|CR925990.1| Pongo pygmaeus mRNA; cDNA DKFZp459M2220 (from cl... 46 0.098
283ref|NM_005345.4| Homo sapiens heat shock 70kDa protein 1A (HSPA1... 46 0.098
284gb|DQ451402.1| Homo sapiens heat shock 70kDa protein 1A (HSPA1A)... 46 0.098
285emb|AJ812563.1| Bubalus bubalis partial mRNA for putative heat s... 46 0.098
286emb|CR937348.1| Single read from an extremity of a cDNA clone ma... 46 0.098
287emb|CR937294.1| Single read from an extremity of a cDNA clone ma... 46 0.098
288emb|CR759915.6| Human DNA sequence from clone DAAP-21F2 on chrom... 46 0.098
289gb|BC057397.1| Homo sapiens heat shock 70kDa protein 1B, mRNA (c... 46 0.098
290emb|CR861166.1| Pongo pygmaeus mRNA; cDNA DKFZp459P2416 (from cl... 46 0.098
291emb|CR859344.1| Pongo pygmaeus mRNA; cDNA DKFZp469O0514 (from cl... 46 0.098
292emb|CR860584.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1519 (from cl... 46 0.098
293emb|CR860185.1| Pongo pygmaeus mRNA; cDNA DKFZp469I011 (from clo... 46 0.098
294emb|CR859135.1| Pongo pygmaeus mRNA; cDNA DKFZp459D1928 (from cl... 46 0.098
295emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chr... 46 0.098
296dbj|D87511.1| Trypanosoma cruzi mRNA for heat shock protein 70, ... 46 0.098
297emb|CR626292.1| full-length cDNA clone CS0DF038YK05 of Fetal bra... 46 0.098
298emb|CR625958.1| full-length cDNA clone CS0DF029YC09 of Fetal bra... 46 0.098
299emb|CR624878.1| full-length cDNA clone CS0DF012YA23 of Fetal bra... 46 0.098
300emb|CR623327.1| full-length cDNA clone CL0BB012ZA08 of Neuroblas... 46 0.098
301emb|CR621778.1| full-length cDNA clone CS0DE003YF16 of Placenta ... 46 0.098
302emb|CR620700.1| full-length cDNA clone CS0DM001YK04 of Fetal liv... 46 0.098
303emb|CR618855.1| full-length cDNA clone CS0DA004YH14 of Neuroblas... 46 0.098
304dbj|AK096100.1| Homo sapiens cDNA FLJ38781 fis, clone LIVER20002... 46 0.098
305emb|CR619085.1| full-length cDNA clone CS0DF008YL15 of Fetal bra... 46 0.098
306emb|CR618761.1| full-length cDNA clone CS0DN003YF07 of Adult bra... 46 0.098
307dbj|AK096017.1| Homo sapiens cDNA FLJ38698 fis, clone KIDNE20020... 46 0.098
308emb|CR618452.1| full-length cDNA clone CS0DA004YF21 of Neuroblas... 46 0.098
309emb|CR617847.1| full-length cDNA clone CS0DN003YP05 of Adult bra... 46 0.098
310emb|CR614382.1| full-length cDNA clone CS0CAP006YL11 of Thymus o... 46 0.098
311emb|CR612907.1| full-length cDNA clone CS0DF036YM23 of Fetal bra... 46 0.098
312dbj|AK097113.1| Homo sapiens cDNA FLJ39794 fis, clone SPLEN20039... 46 0.098
313emb|CR609237.1| full-length cDNA clone CL0BA012ZA08 of Placenta ... 46 0.098
314emb|CR609187.1| full-length cDNA clone CS0DF023YF04 of Fetal bra... 46 0.098
315emb|CR609094.1| full-length cDNA clone CS0DF023YO18 of Fetal bra... 46 0.098
316emb|CR608110.1| full-length cDNA clone CS0DJ004YG01 of T cells (... 46 0.098
317emb|CR606872.1| full-length cDNA clone CS0DF021YI09 of Fetal bra... 46 0.098
318emb|CR606370.1| full-length cDNA clone CS0DI037YG01 of Placenta ... 46 0.098
319emb|CR605894.1| full-length cDNA clone CS0DA003YN07 of Neuroblas... 46 0.098
320emb|CR605852.1| full-length cDNA clone CS0DA010YP23 of Neuroblas... 46 0.098
321emb|CR605652.1| full-length cDNA clone CS0DF033YK03 of Fetal bra... 46 0.098
322emb|CR603812.1| full-length cDNA clone CS0DF020YJ02 of Fetal bra... 46 0.098
323emb|CR602771.1| full-length cDNA clone CS0DF004YF23 of Fetal bra... 46 0.098
324emb|CR600856.1| full-length cDNA clone CS0DJ009YJ18 of T cells (... 46 0.098
325emb|CR599778.1| full-length cDNA clone CS0DE006YC12 of Placenta ... 46 0.098
326emb|CR599258.1| full-length cDNA clone CS0DF007YE19 of Fetal bra... 46 0.098
327emb|CR598680.1| full-length cDNA clone CS0DC028YM15 of Neuroblas... 46 0.098
328emb|CR598455.1| full-length cDNA clone CS0DA003YC01 of Neuroblas... 46 0.098
329emb|CR598352.1| full-length cDNA clone CS0DF006YL22 of Fetal bra... 46 0.098
330emb|CR597390.1| full-length cDNA clone CS0DF009YO17 of Fetal bra... 46 0.098
331emb|CR595673.1| full-length cDNA clone CS0DE002YK13 of Placenta ... 46 0.098
332emb|CR593858.1| full-length cDNA clone CS0DF022YI19 of Fetal bra... 46 0.098
333gb|AE012421.1| Xanthomonas campestris pv. campestris str. ATCC 3... 46 0.098
334emb|CR591386.1| full-length cDNA clone CS0DI003YO22 of Placenta ... 46 0.098
335dbj|AB073886.1| Homo sapiens primary neuroblastoma cDNA, clone:N... 46 0.098
336ref|XM_694630.1| PREDICTED: Danio rerio similar to heat shock pr... 46 0.098
337gb|DQ388429.1| Homo sapiens heat shock 70kDa protein 1B (HSPA1B)... 46 0.098
338ref|NM_005346.3| Homo sapiens heat shock 70kDa protein 1B (HSPA1... 46 0.098
339gb|BC015699.1|BC015699 Homo sapiens, clone IMAGE:3906958, mRNA, ... 46 0.098
340gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 46 0.098
341gb|BC103083.1| Bos taurus heat shock 70 kD protein 2, mRNA (cDNA... 46 0.098
342gb|AF217511.1|AF217511 Homo sapiens uncharacterized bone marrow ... 46 0.098
343gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 46 0.098
344gb|DQ022675.1| Bos grunniens heat shock protein 70.2 (hsp70.2) m... 46 0.098
345gb|AF352832.1|AF352832 Homo sapiens constitutive heat shock prot... 46 0.098
346dbj|AK222785.1| Homo sapiens mRNA for heat shock 70kDa protein 8... 46 0.098
347dbj|AB072749.1| Macaca fascicularis testis cDNA clone:QtsA-16150... 46 0.098
348gb|AY974355.1| Culex pipiens heat shock protein 70 mRNA, complet... 46 0.098
349ref|NM_213766.1| Sus scrofa heat shock protein 70.2 (HSP70.2), mRNA 46 0.098
350gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can... 46 0.098
351gb|AF291716.1|AF291716 Leishmania braziliensis heat shock protei... 46 0.098
352gb|AY161271.1| Spodoptera frugiperda heat shock cognate 70 prote... 46 0.098
353dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 46 0.098
354gb|AF142571.1|AF142571 Saguinus oedipus intracellular vitamin D ... 46 0.098
355gb|AY891855.1| Synthetic construct Homo sapiens clone FLH116883.... 46 0.098
356gb|AY889368.1| Synthetic construct Homo sapiens clone FLH116887.... 46 0.098
357dbj|AK000571.1| Homo sapiens cDNA FLJ20564 fis, clone KAT12033 46 0.098
358dbj|AK129885.1| Homo sapiens cDNA FLJ26375 fis, clone HRT06292, ... 46 0.098
359dbj|AB114672.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.098
360dbj|AK110255.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.098
361gb|AY423555.2| Dicentrarchus labrax HSP70 (HSP70) mRNA, complete... 46 0.098
362gb|BC002453.2| Homo sapiens heat shock 70kDa protein 1A, mRNA (c... 46 0.098
363dbj|AB114675.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.098
364dbj|AB114674.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.098
365dbj|AB114673.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.098
366dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 46 0.098
367dbj|AB209818.1| Homo sapiens mRNA for heat shock 70kDa protein 1... 46 0.098
368ref|NM_203322.2| Bos taurus heat shock 70 kD protein 2 (HSPA1B),... 46 0.098
369emb|AL773559.16| Pig DNA sequence from clone XX-711D2, complete ... 46 0.098
370gb|U09861.1|BTU09861 Bos taurus 70 kDA heat-shock protein (hsp70... 46 0.098
371gb|M59830.1|HUMMHHSP2 Human MHC class III HSP70-2 gene (HLA), co... 46 0.098
372gb|M59828.1|HUMMHHSP Human MHC class III HSP70-1 gene (HLA), com... 46 0.098
373gb|L14604.1|LEIHSP70C Leishmania amazonensis heat shock protein ... 46 0.098
374emb|X73685.1|CAHSP C.aethiops hsp70 mRNA 46 0.098
375gb|M11717.1|HUMHSP70D Human heat shock protein (hsp 70) gene, co... 46 0.098
376emb|AL360193.1|HST000239 Homo sapiens mRNA full length insert cD... 46 0.098
377gb|M69100.1|PIGHSP70G Pig hsp70 gene, complete cds 46 0.098
378gb|M26595.1|TRBHSP70AB T.cruzi heat shock protein (HSP70) gene, ... 46 0.098
379gb|U02892.1|BTU02892 Bos taurus Angus 70 kda heat shock protein-... 46 0.098
380gb|U02891.1|BTU02891 Bos taurus Angus 70 kda heat shock protein-... 46 0.098
381dbj|AB075027.1| Canis familiaris hsp70 mRNA for heat shock prote... 46 0.098
382emb|AL773527.8| Pig DNA sequence from clone XX-707F1, complete s... 46 0.098
383gb|AY422994.1| Danio rerio heat shock 70kDa protein 8 (HSPA8) mR... 44 0.39
384gb|AY748350.1| Fenneropenaeus chinensis heat shock protein 70 co... 44 0.39
385gb|AY538777.1| Pimephales promelas heat shock cognate 70 kDa pro... 44 0.39
386emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 44 0.39
387gb|AY288515.1| Trypanoplasma borreli heat shock protein 70 gene,... 44 0.39
388emb|CR635883.2|CNS0EPM9 Tetraodon nigroviridis full-length cDNA 44 0.39
389ref|XM_797014.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
390ref|XM_775743.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
391ref|XM_797002.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
392ref|XM_796989.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
393ref|XM_796976.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
394ref|XM_796964.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
395ref|XM_796945.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
396emb|Y11413.1|DRHSC70 D.rerio hsc70 mRNA 44 0.39
397emb|X62485.1|LB70HSP L.brasiliensis mRNA for 70 Kd heat shock pr... 44 0.39
398gb|M87878.1| Leishmania braziliensis heat shock protein 70 (HSP7... 44 0.39
399gb|L01500.1|DROHSC4A Drosophila melanogaster heat shock protein ... 44 0.39
400gb|AY072815.1| Chlorella zofingiensis heat shock protein 70 mRNA... 44 0.39
401ref|XM_687844.1| PREDICTED: Danio rerio similar to Heat shock pr... 44 0.39
402gb|AF227986.1|AF227986 Rivulus marmoratus HSC71 gene, complete cds 44 0.39
403gb|AY233001.1| Kryptolebias marmoratus heat shock cognate 71 (Hs... 44 0.39
404emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 ... 44 0.39
405dbj|AB013075.1| Canis familiaris gene for heat shock protein 70,... 44 0.39
406gb|BC063228.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 44 0.39
407gb|BC045841.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 44 0.39
408ref|NM_131401.1| Danio rerio heat shock protein 8 (hspa8), mRNA 44 0.39
409dbj|AB006814.1| Paralichthys olivaceus mRNA for hsc71, complete cds 44 0.39
410gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70) mRNA... 44 0.39
411emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ... 44 0.39
412gb|AF053059.1|AF053059 Paralichthys olivaceus heat shock protein... 44 0.39
413gb|U58209.1|ZMU58209 Zea mays lumenal binding protein cBiPe3 mRN... 44 0.39
414gb|U58208.1|ZMU58208 Zea mays lumenal binding protein cBiPe2 mRN... 44 0.39
415gb|BC066491.1| Danio rerio heat shock protein 8, mRNA (cDNA clon... 44 0.39
416gb|M59449.1|MZEB70A Zea mays polypeptide chain-binding protein m... 44 0.39
417gb|AY651255.1| Cryptobia helicis heat shock protein 70 cytosolic... 42 1.5
418gb|AC150414.2| Branchiostoma floridae clone CH302-62C22, complet... 42 1.5
419ref|XM_463631.1| Oryza sativa (japonica cultivar-group), predic... 42 1.5
420gb|AY617976.1| Sterkiella histriomuscorum clone UGC1O0006_M14_R ... 42 1.5
421gb|AY618164.1| Sterkiella histriomuscorum clone UGC1O0006_M22_R ... 42 1.5
422ref|XM_872816.1| PREDICTED: Bos taurus similar to Septin-11, tra... 42 1.5
423ref|XM_864283.1| PREDICTED: Bos taurus similar to Septin-11, tra... 42 1.5
424ref|XM_615857.2| PREDICTED: Bos taurus similar to Septin-11, tra... 42 1.5
425emb|AJ249329.1|CSA249329 Cucumis sativus mRNA for heat shock pro... 42 1.5
426gb|DQ173923.1| Homarus americanus heat shock protein 70 mRNA, co... 42 1.5
427gb|AF474375.1| Penaeus monodon heat shock protein 70 mRNA, compl... 42 1.5
428emb|X85798.1|LIHSP70 L.infantum hsp70 gene 42 1.5
429dbj|AB252419.1| Uncultured bacterium hmbp gene for heavy metal-b... 42 1.5
430gb|AE011965.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 1.5
431dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038 42 1.5
432dbj|AB240143.1| Chlorella pyrenoidosa hsp70 mRNA for heat shock ... 42 1.5
433gb|AF421541.1| Crypthecodinium cohnii Hsp90 mRNA, complete cds 42 1.5
434emb|AL116551.1|CNS01D9R Botrytis cinerea strain T4 cDNA library 42 1.5
435emb|AL116529.1|CNS01D95 Botrytis cinerea strain T4 cDNA library 42 1.5
436emb|AL116524.1|CNS01D90 Botrytis cinerea strain T4 cDNA library 42 1.5
437emb|AL116406.1|CNS01D5Q Botrytis cinerea strain T4 cDNA library 42 1.5
438emb|AL115343.1|CNS01CC7 Botrytis cinerea strain T4 cDNA library 42 1.5
439emb|AL115335.1|CNS01CBZ Botrytis cinerea strain T4 cDNA library 42 1.5
440emb|AL115184.1|CNS01C7S Botrytis cinerea strain T4 cDNA library 42 1.5
441emb|AL113611.1|CNS01B03 Botrytis cinerea strain T4 cDNA library 42 1.5
442emb|AL112912.1|CNS01AGO Botrytis cinerea strain T4 cDNA library 42 1.5
443emb|AL112762.1|CNS01ACI Botrytis cinerea strain T4 cDNA library 42 1.5
444emb|AL112751.1|CNS01AC7 Botrytis cinerea strain T4 cDNA library 42 1.5
445emb|AL112598.1|CNS01A7Y Botrytis cinerea strain T4 cDNA library 42 1.5
446emb|AL112279.1|CNS019Z3 Botrytis cinerea strain T4 cDNA library 42 1.5
447emb|AL110798.1|CNS018TZ Botrytis cinerea strain T4 cDNA library 42 1.5
448gb|AF232230.1|AF232230 Acanthamoeba castellanii 20S proteasome a... 42 1.5
449dbj|AP003437.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
450dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
451gb|AY729863.1| Guillardia theta heat shock protein 90 gene, part... 42 1.5
452gb|L14605.1|LEIHSP70G Leishmania amazonensis heat shock protein ... 42 1.5
453gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 6.1
454gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete... 40 6.1
455gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.1
456gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosom... 40 6.1
457ref|XM_870731.1| PREDICTED: Bos taurus similar to Heat shock cog... 40 6.1
458ref|XM_590005.2| PREDICTED: Bos taurus similar to MEGF11 protein... 40 6.1
459gb|AY645906.1| Litopenaeus vannamei heat shock protein 70 gene, ... 40 6.1
460ref|NM_020804.2| Homo sapiens protein kinase C and casein kinase... 40 6.1
461ref|NM_019400.1| Mus musculus rabaptin, RAB GTPase binding effec... 40 6.1
462gb|AY702003.1| Leishmania donovani strain MHOM/IN/1983/AG83 heat... 40 6.1
463gb|AC116569.6| Mus musculus BAC clone RP23-59O19 from chromosome... 40 6.1
464gb|AC138173.2| Mus musculus strain C57BL/6J clone rp23-364j24 ma... 40 6.1
465ref|XM_751924.1| Ustilago maydis 521 hypothetical protein (UM008... 40 6.1
466ref|XM_389647.1| Gibberella zeae PH-1 chromosome 4 GR78_NEUCR 78... 40 6.1
467gb|AC125075.4| Mus musculus BAC clone RP23-468P13 from chromosom... 40 6.1
468ref|XM_531893.2| PREDICTED: Canis familiaris similar to MEGF10 p... 40 6.1
469gb|BC009814.1| Mus musculus rabaptin, RAB GTPase binding effecto... 40 6.1
470emb|Z80223.1|CEF26D10 Caenorhabditis elegans Cosmid F26D10, comp... 40 6.1
471gb|AY236713.1| Goniomonas sp. ATCC 50108 heat shock protein 90 (... 40 6.1
472gb|AC122207.2| Mus musculus BAC clone RP23-88I22 from 16, comple... 40 6.1
473gb|BC060166.1| Mus musculus rabaptin, RAB GTPase binding effecto... 40 6.1
474emb|CR730635.1|CNS0GQPC Tetraodon nigroviridis full-length cDNA 40 6.1
475emb|CR728398.2|CNS0GOZ8 Tetraodon nigroviridis full-length cDNA 40 6.1
476emb|CR727568.2|CNS0GOC6 Tetraodon nigroviridis full-length cDNA 40 6.1
477emb|CR724923.2|CNS0GMAP Tetraodon nigroviridis full-length cDNA 40 6.1
478emb|CR697314.2|CNS0G0ZY Tetraodon nigroviridis full-length cDNA 40 6.1
479emb|CR688052.2|CNS0FTUO Tetraodon nigroviridis full-length cDNA 40 6.1
480emb|CR680851.1|CNS0FOAN Tetraodon nigroviridis full-length cDNA 40 6.1
481emb|CR679231.2|CNS0FN1N Tetraodon nigroviridis full-length cDNA 40 6.1
482emb|CR678387.2|CNS0FMEC Tetraodon nigroviridis full-length cDNA 40 6.1
483emb|CR678206.2|CNS0FM9E Tetraodon nigroviridis full-length cDNA 40 6.1
484emb|CR677879.2|CNS0FM0F Tetraodon nigroviridis full-length cDNA 40 6.1
485emb|CR676221.1|CNS0FKQH Tetraodon nigroviridis full-length cDNA 40 6.1
486gb|BC040228.1| Homo sapiens protein kinase C and casein kinase s... 40 6.1
487emb|CR675491.2|CNS0FK6H Tetraodon nigroviridis full-length cDNA 40 6.1
488emb|CR673489.2|CNS0FIMV Tetraodon nigroviridis full-length cDNA 40 6.1
489emb|CR672845.2|CNS0FI4Z Tetraodon nigroviridis full-length cDNA 40 6.1
490emb|CR672362.2|CNS0FHRK Tetraodon nigroviridis full-length cDNA 40 6.1
491emb|CR671835.1|CNS0FHCX Tetraodon nigroviridis full-length cDNA 40 6.1
492emb|CR671553.1|CNS0FH53 Tetraodon nigroviridis full-length cDNA 40 6.1
493emb|CR668547.2|CNS0FETL Tetraodon nigroviridis full-length cDNA 40 6.1
494emb|CR667337.2|CNS0FDVZ Tetraodon nigroviridis full-length cDNA 40 6.1
495emb|CR664940.1|CNS0FC1E Tetraodon nigroviridis full-length cDNA 40 6.1
496emb|CR666378.2|CNS0FD5C Tetraodon nigroviridis full-length cDNA 40 6.1
497emb|CR664943.2|CNS0FC1H Tetraodon nigroviridis full-length cDNA 40 6.1
498emb|CR662944.2|CNS0FAHY Tetraodon nigroviridis full-length cDNA 40 6.1
499emb|CR662235.2|CNS0F9Y9 Tetraodon nigroviridis full-length cDNA 40 6.1
500emb|CR661932.2|CNS0F9PU Tetraodon nigroviridis full-length cDNA 40 6.1

>gb|BT016462.1| Zea mays clone Contig295 mRNA sequence
          Length = 1014

 Score =  280 bits (141), Expect = 4e-72
 Identities = 263/304 (86%), Gaps = 6/304 (1%)
 Strand = Plus / Minus

                                                                       
Query: 153 ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
           |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 848 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 789

                                                                       
Query: 213 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 266
           |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 788 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 729

                                                                       
Query: 267 gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 326
           |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 728 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 669

                                                                       
Query: 327 gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 386
           ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 668 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 609

                                                                       
Query: 387 ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagta 446
           ||| | ||||||||| |||||||||||||||||||| ||||||||||||||||| | |||
Sbjct: 608 ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgtaggcgta 549

               
Query: 447 gttc 450
           ||||
Sbjct: 548 gttc 545



to top

>gb|BT016812.1| Zea mays clone Contig645 mRNA sequence
          Length = 2327

 Score =  280 bits (141), Expect = 4e-72
 Identities = 263/304 (86%), Gaps = 6/304 (1%)
 Strand = Plus / Minus

                                                                        
Query: 153  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
            |||||| ||||||||||||||||||||||||||||||    | ||||||| ||| |||||
Sbjct: 1834 ttagtccacctcctcgatcttggggccagggccgccgctgccggcaggggcgtcctcgtc 1775

                                                                        
Query: 213  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 266
            |||||| ||  |      ||||||  |||| || ||||||||||||||||||||||||||
Sbjct: 1774 catgccgccagcgccgcccatgtcttcacccgcgccctggtacatcttggcgatgatggg 1715

                                                                        
Query: 267  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 326
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 1714 gttgcagaggctctccagctccttcatcttgtcctcgaactcgtccgcctcggcgagctg 1655

                                                                        
Query: 327  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 386
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||| ||
Sbjct: 1654 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcatc 1595

                                                                        
Query: 387  ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagta 446
            ||||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||||
Sbjct: 1594 ggccggcagcttggacgcaatcttctcgtccttgatcgtgttgcgcatgttgtaggagta 1535

                
Query: 447  gttc 450
            ||||
Sbjct: 1534 gttc 1531



to top

>gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds
          Length = 1284

 Score =  280 bits (141), Expect = 4e-72
 Identities = 263/304 (86%), Gaps = 6/304 (1%)
 Strand = Plus / Minus

                                                                        
Query: 153  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
            |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 1123 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 1064

                                                                        
Query: 213  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 266
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 1063 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 1004

                                                                        
Query: 267  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 326
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 1003 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 944

                                                                        
Query: 327  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 386
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 943  gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 884

                                                                        
Query: 387  ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagta 446
            ||| | ||||||||| |||||||||||||||||||| ||||||||||||||||| | |||
Sbjct: 883  ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgtaggcgta 824

                
Query: 447  gttc 450
            ||||
Sbjct: 823  gttc 820



to top

>gb|AY109330.1| Zea mays CL45_1 mRNA sequence
          Length = 3772

 Score =  280 bits (141), Expect = 4e-72
 Identities = 263/304 (86%), Gaps = 6/304 (1%)
 Strand = Plus / Minus

                                                                        
Query: 153  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
            |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 3222 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 3163

                                                                        
Query: 213  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 266
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 3162 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 3103

                                                                        
Query: 267  gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 326
            |||||| |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 3102 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 3043

                                                                        
Query: 327  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 386
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 3042 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 2983

                                                                        
Query: 387  ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagta 446
            ||| | ||||||||| |||||||||||||||||||| ||||||||||||||||| | |||
Sbjct: 2982 ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgtaggcgta 2923

                
Query: 447  gttc 450
            ||||
Sbjct: 2922 gttc 2919



to top

>emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat shock protein 70
          Length = 842

 Score =  264 bits (133), Expect = 2e-67
 Identities = 261/304 (85%), Gaps = 6/304 (1%)
 Strand = Plus / Minus

                                                                       
Query: 153 ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
           |||||| |||||||||||||||||||||||| | |||  | |||| || | ||| |||||
Sbjct: 662 ttagtccacctcctcgatcttggggccaggggcaccgcttccagccggagcgtcctcgtc 603

                                                                       
Query: 213 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 266
           |||||| ||| |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 602 catgccgcccgcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 543

                                                                       
Query: 267 gttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctg 326
           |||  | |||  ||||||||||||||||||||| || |||||||||||||| || |||||
Sbjct: 542 gttcgaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 483

                                                                       
Query: 327 gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 386
           ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 482 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 423

                                                                       
Query: 387 ggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagta 446
           ||| | ||||||||| |||||||||||||||||||| ||||||||||||||||| | |||
Sbjct: 422 ggcagccagcttggacgcgatcttctcgtccttgatcgtgttgcgcatgttgtaggcgta 363

               
Query: 447 gttc 450
           ||||
Sbjct: 362 gttc 359



to top

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  262 bits (132), Expect = 9e-67
 Identities = 258/300 (86%)
 Strand = Plus / Plus

                                                                         
Query: 151   gtttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcg 210
             ||||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 43944 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 44003

                                                                         
Query: 211   tccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 270
             |||||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 44004 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 44063

                                                                         
Query: 271   cacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttc 330
             || | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| 
Sbjct: 44064 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 44123

                                                                         
Query: 331   gtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggcc 390
             ||||| |||||   ||||||  |||||||||| ||||||||| |||||||||||||||| 
Sbjct: 44124 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggcg 44183

                                                                         
Query: 391   ggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
             |  ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 44184 gcgagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaggcgtagttc 44243



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  262 bits (132), Expect = 9e-67
 Identities = 258/300 (86%)
 Strand = Plus / Plus

                                                                            
Query: 151      gtttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcg 210
                ||||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 22454537 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 22454596

                                                                            
Query: 211      tccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 270
                |||||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 22454597 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 22454656

                                                                            
Query: 271      cacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttc 330
                || | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| 
Sbjct: 22454657 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 22454716

                                                                            
Query: 331      gtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggcc 390
                ||||| |||||   ||||||  |||||||||| ||||||||| |||||||||||||||| 
Sbjct: 22454717 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggcg 22454776

                                                                            
Query: 391      ggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
                |  ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 22454777 gcgagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaggcgtagttc 22454836



to top

>ref|XM_475365.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1941

 Score =  258 bits (130), Expect = 1e-65
 Identities = 256/298 (85%)
 Strand = Plus / Minus

                                                                        
Query: 153  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
            ||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||||
Sbjct: 1941 ttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcgtc 1882

                                                                        
Query: 213  catgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||||
Sbjct: 1881 catgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttgca 1822

                                                                        
Query: 273  cagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgt 332
             | | |||||||||||||||||||||| || |||||||| ||||| || |||||||| ||
Sbjct: 1821 gatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttggt 1762

                                                                        
Query: 333  gtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccgg 392
            ||| |||||   ||||||  |||||||||| ||||||||| |||||||||||||||| | 
Sbjct: 1761 gtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggcggc 1702

                                                                      
Query: 393  cagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
             ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 1701 gagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaggcgtagttc 1644



to top

>gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0022E16
              map C481S, complete sequence
          Length = 179668

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                          
Query: 208    tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
              ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 135577 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 135518

                                                                          
Query: 268    ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
              ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 135517 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 135458

                                                                          
Query: 328    ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
              ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 135457 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 135398

                                                                          
Query: 388    gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
              ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 135397 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 135338

                 
Query: 448    ttc 450
              |||
Sbjct: 135337 ttc 135335



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                           
Query: 153    ttagtcgacctcctcgatcttggggccag 181
              |||||||||||||||||||||||||||||
Sbjct: 135638 ttagtcgacctcctcgatcttggggccag 135610



to top

>emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70
          Length = 4791

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                        
Query: 208  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 4513 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 4454

                                                                        
Query: 268  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 4453 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 4394

                                                                        
Query: 328  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 4393 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 4334

                                                                        
Query: 388  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
            ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 4333 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 4274

               
Query: 448  ttc 450
            |||
Sbjct: 4273 ttc 4271



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            |||||||||||||||||||||||||||||
Sbjct: 4574 ttagtcgacctcctcgatcttggggccag 4546



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                            
Query: 208      tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
                ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28177022 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28176963

                                                                            
Query: 268      ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
                ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 28176962 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28176903

                                                                            
Query: 328      ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 28176902 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 28176843

                                                                            
Query: 388      gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
                ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 28176842 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 28176783

                   
Query: 448      ttc 450
                |||
Sbjct: 28176782 ttc 28176780



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 153      ttagtcgacctcctcgatcttggggccag 181
                |||||||||||||||||||||||||||||
Sbjct: 28177083 ttagtcgacctcctcgatcttggggccag 28177055



to top

>dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-E11, full
           insert sequence
          Length = 529

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                       
Query: 208 tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
           ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 253 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 194

                                                                       
Query: 268 ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
           ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 193 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 134

                                                                       
Query: 328 ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
           ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 133 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 74

                                                                       
Query: 388 gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
           ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 73  gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 14

              
Query: 448 ttc 450
           |||
Sbjct: 13  ttc 11



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 153 ttagtcgacctcctcgatcttggggccag 181
           |||||||||||||||||||||||||||||
Sbjct: 314 ttagtcgacctcctcgatcttggggccag 286



to top

>dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-H02, full
            insert sequence
          Length = 2311

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                        
Query: 208  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 2063 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 2004

                                                                        
Query: 268  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 2003 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1944

                                                                        
Query: 328  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 1943 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 1884

                                                                        
Query: 388  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
            ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 1883 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 1824

               
Query: 448  ttc 450
            |||
Sbjct: 1823 ttc 1821



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            |||||||||||||||||||||||||||||
Sbjct: 2124 ttagtcgacctcctcgatcttggggccag 2096



to top

>dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021C17, full
            insert sequence
          Length = 2380

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                        
Query: 208  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 1961 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 1902

                                                                        
Query: 268  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
            ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 1901 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1842

                                                                        
Query: 328  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 1841 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 1782

                                                                        
Query: 388  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
            ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 1781 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 1722

               
Query: 448  ttc 450
            |||
Sbjct: 1721 ttc 1719



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            |||||||||||||||||||||||||||||
Sbjct: 2022 ttagtcgacctcctcgatcttggggccag 1994



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  244 bits (123), Expect = 2e-61
 Identities = 213/243 (87%)
 Strand = Plus / Minus

                                                                            
Query: 208      tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
                ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28161900 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28161841

                                                                            
Query: 268      ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
                ||||| | | |||||||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 28161840 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28161781

                                                                            
Query: 328      ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||  | 
Sbjct: 28161780 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtccgct 28161721

                                                                            
Query: 388      gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
                ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| | ||||
Sbjct: 28161720 gccgggagcttcgaggcgatcttctcatccttgatggtgttgcgcatgttgtaggcgtag 28161661

                   
Query: 448      ttc 450
                |||
Sbjct: 28161660 ttc 28161658



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 153      ttagtcgacctcctcgatcttggggccag 181
                |||||||||||||||||||||||||||||
Sbjct: 28161961 ttagtcgacctcctcgatcttggggccag 28161933



to top

>emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat shock protein 70
          Length = 913

 Score =  238 bits (120), Expect = 1e-59
 Identities = 262/306 (85%), Gaps = 10/306 (3%)
 Strand = Plus / Minus

                                                                       
Query: 153 ttagtcgacctcctcgatcttggggccagggccgccg-gatgcag-caggggtgtcatcg 210
           |||||| |||||||||||||||||||||||  ||||| | ||| | |||||| ||| |||
Sbjct: 662 ttagtccacctcctcgatcttggggccagg--cgccgcgctgccggcaggggcgtcctcg 605

                                                                       
Query: 211 tccatgccacc------ctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
           |||||||| ||      | |||||||  |||| || |||| |||||||||||||||||||
Sbjct: 604 tccatgccgccaggccgccccatgtcttcacccgcgcccttgtacatcttggcgatgatg 545

                                                                       
Query: 265 gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
           |||||||| |||  ||||||||||||||||||||  || |||||||||||||| ||| ||
Sbjct: 544 gggttgcagaggctctccagctccttcatcttgtactcgaactcgtccgcctcggcaggc 485

                                                                       
Query: 325 tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
           ||||  | |||||||||   |||||| || |||||||| |||||||||||||||||||| 
Sbjct: 484 tggtcggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtca 425

                                                                       
Query: 385 tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagag 444
           ||||||||||||||||| || ||||||||||||||||| ||||||||||||||||| |||
Sbjct: 424 tcggccggcagcttggacgcaatcttctcgtccttgatcgtgttgcgcatgttgtaggag 365

                 
Query: 445 tagttc 450
           ||||||
Sbjct: 364 tagttc 359



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                           
Query: 208     tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
               ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9344803 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9344744

                                                                           
Query: 268     ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
               ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 9344743 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9344684

                                                                           
Query: 328     ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
               ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 9344683 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 9344624

                                                                           
Query: 388     gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
                ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 9344623 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 9344564

                  
Query: 448     ttc 450
               |||
Sbjct: 9344563 ttc 9344561



 Score =  210 bits (106), Expect = 3e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                            
Query: 205      tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
                ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34146522 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34146463

                                                                            
Query: 265      gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
                |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 34146462 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34146403

                                                                            
Query: 325      tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
                |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 34146402 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 34146343

                                                                          
Query: 385      tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 442
                || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 34146342 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 34146285



 Score =  170 bits (86), Expect = 3e-39
 Identities = 179/210 (85%)
 Strand = Plus / Plus

                                                                           
Query: 241     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9383971 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9384030

                                                                           
Query: 301     tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
               || |||||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 9384031 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9384090

                                                                           
Query: 361     gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
               || |||||||||||||||||||||||||| || |||||||||||||||||||||||    
Sbjct: 9384091 gcgtcctcgatcttcttcttgtcgtcggcggggagcttggaggcgatcttctcgtcgcgc 9384150

                                             
Query: 421     atggtgttgcgcatgttgtaagagtagttc 450
               |  ||||||||||||||||| | |||||||
Sbjct: 9384151 accgtgttgcgcatgttgtacgcgtagttc 9384180



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 153     ttagtcgacctcctcgatcttggggccagggccgc 187
               |||||| || ||||||||||||||||||| |||||
Sbjct: 9383868 ttagtccacttcctcgatcttggggccagcgccgc 9383902



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 152      tttagtcgacctcctcgatcttggggccag 181
                |||||||||||||||| ||||| |||||||
Sbjct: 34146578 tttagtcgacctcctcaatcttagggccag 34146549



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 152     tttagtcgacctcctcgatcttggg 176
               |||||||||| ||||||||||||||
Sbjct: 9344868 tttagtcgacttcctcgatcttggg 9344844



to top

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                         
Query: 208   tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
             ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 42203 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 42144

                                                                         
Query: 268   ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
             ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 42143 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 42084

                                                                         
Query: 328   ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
             ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 42083 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 42024

                                                                         
Query: 388   gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
              ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 42023 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 41964

                
Query: 448   ttc 450
             |||
Sbjct: 41963 ttc 41961



 Score =  170 bits (86), Expect = 3e-39
 Identities = 179/210 (85%)
 Strand = Plus / Plus

                                                                         
Query: 241   ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
             |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 81371 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 81430

                                                                         
Query: 301   tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
             || |||||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 81431 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 81490

                                                                         
Query: 361   gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
             || |||||||||||||||||||||||||| || |||||||||||||||||||||||    
Sbjct: 81491 gcgtcctcgatcttcttcttgtcgtcggcggggagcttggaggcgatcttctcgtcgcgc 81550

                                           
Query: 421   atggtgttgcgcatgttgtaagagtagttc 450
             |  ||||||||||||||||| | |||||||
Sbjct: 81551 accgtgttgcgcatgttgtacgcgtagttc 81580



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 153   ttagtcgacctcctcgatcttggggccagggccgc 187
             |||||| || ||||||||||||||||||| |||||
Sbjct: 81268 ttagtccacttcctcgatcttggggccagcgccgc 81302



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 152   tttagtcgacctcctcgatcttggg 176
             |||||||||| ||||||||||||||
Sbjct: 42268 tttagtcgacttcctcgatcttggg 42244



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                           
Query: 208     tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
               ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9342924 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9342865

                                                                           
Query: 268     ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
               ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 9342864 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9342805

                                                                           
Query: 328     ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
               ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 9342804 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 9342745

                                                                           
Query: 388     gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
                ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 9342744 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 9342685

                  
Query: 448     ttc 450
               |||
Sbjct: 9342684 ttc 9342682



 Score =  210 bits (106), Expect = 3e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                            
Query: 205      tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
                ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34236994 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34236935

                                                                            
Query: 265      gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
                |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 34236934 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34236875

                                                                            
Query: 325      tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
                |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 34236874 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 34236815

                                                                          
Query: 385      tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 442
                || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 34236814 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 34236757



 Score =  170 bits (86), Expect = 3e-39
 Identities = 179/210 (85%)
 Strand = Plus / Plus

                                                                           
Query: 241     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9382092 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9382151

                                                                           
Query: 301     tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
               || |||||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 9382152 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9382211

                                                                           
Query: 361     gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
               || |||||||||||||||||||||||||| || |||||||||||||||||||||||    
Sbjct: 9382212 gcgtcctcgatcttcttcttgtcgtcggcggggagcttggaggcgatcttctcgtcgcgc 9382271

                                             
Query: 421     atggtgttgcgcatgttgtaagagtagttc 450
               |  ||||||||||||||||| | |||||||
Sbjct: 9382272 accgtgttgcgcatgttgtacgcgtagttc 9382301



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 153     ttagtcgacctcctcgatcttggggccagggccgc 187
               |||||| || ||||||||||||||||||| |||||
Sbjct: 9381989 ttagtccacttcctcgatcttggggccagcgccgc 9382023



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 152      tttagtcgacctcctcgatcttggggccag 181
                |||||||||||||||| ||||| |||||||
Sbjct: 34237050 tttagtcgacctcctcaatcttagggccag 34237021



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 152     tttagtcgacctcctcgatcttggg 176
               |||||||||| ||||||||||||||
Sbjct: 9342989 tttagtcgacttcctcgatcttggg 9342965



to top

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Plus

                                                                         
Query: 208   tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
             ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 11162 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 11221

                                                                         
Query: 268   ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
             ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 11222 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 11281

                                                                         
Query: 328   ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
             ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 11282 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 11341

                                                                         
Query: 388   gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
              ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 11342 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 11401

                
Query: 448   ttc 450
             |||
Sbjct: 11402 ttc 11404



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 152   tttagtcgacctcctcgatcttggg 176
             |||||||||| ||||||||||||||
Sbjct: 11097 tttagtcgacttcctcgatcttggg 11121



to top

>dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-129-B01, full
            insert sequence
          Length = 2253

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                        
Query: 208  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1996 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1937

                                                                        
Query: 268  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1936 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1877

                                                                        
Query: 328  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
            ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 1876 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 1817

                                                                        
Query: 388  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
             ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 1816 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 1757

               
Query: 448  ttc 450
            |||
Sbjct: 1756 ttc 1754



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 152  tttagtcgacctcctcgatcttggg 176
            |||||||||| ||||||||||||||
Sbjct: 2061 tttagtcgacttcctcgatcttggg 2037



to top

>dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078D02, full
            insert sequence
          Length = 2243

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                        
Query: 208  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1999 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1940

                                                                        
Query: 268  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1939 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1880

                                                                        
Query: 328  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
            ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 1879 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 1820

                                                                        
Query: 388  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
             ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 1819 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 1760

               
Query: 448  ttc 450
            |||
Sbjct: 1759 ttc 1757



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 152  tttagtcgacctcctcgatcttggg 176
            |||||||||| ||||||||||||||
Sbjct: 2064 tttagtcgacttcctcgatcttggg 2040



to top

>dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139H01, full
            insert sequence
          Length = 2252

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                        
Query: 208  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 267
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 2003 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1944

                                                                        
Query: 268  ttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctgg 327
            ||||| | | |||||||||||||||||||||| || ||||| || ||||| || ||||||
Sbjct: 1943 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1884

                                                                        
Query: 328  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcg 387
            ||  |||| |||||   ||||||| | |||||||| ||||||||||||||||||||| | 
Sbjct: 1883 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcggcc 1824

                                                                        
Query: 388  gccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtag 447
             ||||||||||||| |||||||| ||||||||||||||||| ||||||||||| | ||||
Sbjct: 1823 tccggcagcttggacgcgatcttgtcgtccttgatggtgttccgcatgttgtaggcgtag 1764

               
Query: 448  ttc 450
            |||
Sbjct: 1763 ttc 1761



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 152  tttagtcgacctcctcgatcttggg 176
            |||||||||| ||||||||||||||
Sbjct: 2068 tttagtcgacttcctcgatcttggg 2044



to top

>ref|NM_190528.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1947

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                        
Query: 224  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 283
            ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 1870 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 1811

                                                                        
Query: 284  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 343
            |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 1810 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 1751

                                                                        
Query: 344  ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 403
             ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 1750 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 1691

                                                           
Query: 404  cgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
            ||||||| ||||||||||||||||| | ||||||||| | |||||||
Sbjct: 1690 cgatcttgtcgtccttgatggtgttcctcatgttgtaggcgtagttc 1644



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 157  tcgacctcctcgatcttggggcc 179
            |||||||||||||||||||||||
Sbjct: 1943 tcgacctcctcgatcttggggcc 1921



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                            
Query: 224      ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 283
                ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 36036152 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 36036093

                                                                            
Query: 284      gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 343
                |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 36036092 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 36036033

                                                                            
Query: 344      ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 403
                 ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 36036032 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 36035973

                                                               
Query: 404      cgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
                ||||||| ||||||||||||||||| | ||||||||| | |||||||
Sbjct: 36035972 cgatcttgtcgtccttgatggtgttcctcatgttgtaggcgtagttc 36035926



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 157      tcgacctcctcgatcttggggcc 179
                |||||||||||||||||||||||
Sbjct: 36036225 tcgacctcctcgatcttggggcc 36036203



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 369      gatcttcttcttgtcgtcggccggc 393
                |||||||||||| ||||||||||||
Sbjct: 40186339 gatcttcttcttctcgtcggccggc 40186363



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 27      cacggaataactacgaccac 46
               ||||||||||||||||||||
Sbjct: 5589872 cacggaataactacgaccac 5589853



to top

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                         
Query: 224   ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 283
             ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 48877 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 48818

                                                                         
Query: 284   gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 343
             |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 48817 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 48758

                                                                         
Query: 344   ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 403
              ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 48757 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 48698

                                                            
Query: 404   cgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
             ||||||| ||||||||||||||||| | ||||||||| | |||||||
Sbjct: 48697 cgatcttgtcgtccttgatggtgttcctcatgttgtaggcgtagttc 48651



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 157   tcgacctcctcgatcttggggcc 179
             |||||||||||||||||||||||
Sbjct: 48950 tcgacctcctcgatcttggggcc 48928



to top

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                          
Query: 224    ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 283
              ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 134830 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 134771

                                                                          
Query: 284    gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 343
              |||||||||||||||| || |||||||||||||| || ||||||||  |||| ||||| |
Sbjct: 134770 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 134711

                                                                          
Query: 344    ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggagg 403
               ||||||  | |||||||| ||||||||||||||||||||||| ||||  ||||||||||
Sbjct: 134710 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccgagagcttggagg 134651

                                                             
Query: 404    cgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
              ||||||| ||||||||||||||||| | ||||||||| | |||||||
Sbjct: 134650 cgatcttgtcgtccttgatggtgttcctcatgttgtaggcgtagttc 134604



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 157    tcgacctcctcgatcttggggcc 179
              |||||||||||||||||||||||
Sbjct: 134903 tcgacctcctcgatcttggggcc 134881



to top

>ref|XM_470141.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2522

 Score =  210 bits (106), Expect = 3e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 1990 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1931

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1930 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1871

                                                                        
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
            |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 1870 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 1811

                                                                      
Query: 385  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 442
            || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 1810 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 1753



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  tttagtcgacctcctcgatcttggggccag 181
            |||||||||||||||| ||||| |||||||
Sbjct: 2046 tttagtcgacctcctcaatcttagggccag 2017



to top

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
              sequence
          Length = 163828

 Score =  210 bits (106), Expect = 3e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                          
Query: 205    tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
              ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 110334 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 110275

                                                                          
Query: 265    gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
              |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 110274 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 110215

                                                                          
Query: 325    tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
              |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 110214 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 110155

                                                                        
Query: 385    tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 442
              || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 110154 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 110097



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 152    tttagtcgacctcctcgatcttggggccag 181
              |||||||||||||||| ||||| |||||||
Sbjct: 110390 tttagtcgacctcctcaatcttagggccag 110361



to top

>dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K19, full
            insert sequence
          Length = 2370

 Score =  210 bits (106), Expect = 3e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2023 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1964

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1963 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1904

                                                                        
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
            |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 1903 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 1844

                                                                      
Query: 385  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 442
            || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 1843 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 1786



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  tttagtcgacctcctcgatcttggggccag 181
            |||||||||||||||| ||||| |||||||
Sbjct: 2079 tttagtcgacctcctcaatcttagggccag 2050



to top

>dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030D03, full
            insert sequence
          Length = 2282

 Score =  210 bits (106), Expect = 3e-51
 Identities = 205/238 (86%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2025 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1966

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            |||||||||||| ||||||||||||||||||||||||| ||||| ||  ||||||| |||
Sbjct: 1965 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1906

                                                                        
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
            |||||  |||||||||||||||| ||    ||||  || ||||| ||||| |||||||||
Sbjct: 1905 tggttgttgtccagccactggatcgcctgctcgaccgcgtcctcaatctttttcttgtcg 1846

                                                                      
Query: 385  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgtaag 442
            || || ||||||||||| || ||||||||||| | ||| ||||| | |||||||||||
Sbjct: 1845 tcagctggcagcttggaagcaatcttctcgtcttggatagtgttcctcatgttgtaag 1788



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  tttagtcgacctcctcgatcttggggccag 181
            |||||||||||||||| ||||| |||||||
Sbjct: 2081 tttagtcgacctcctcaatcttagggccag 2052



to top

>gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp70) pseudogene
          Length = 3305

 Score =  186 bits (94), Expect = 4e-44
 Identities = 178/206 (86%)
 Strand = Plus / Minus

                                                                        
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 294
            ||||| |||||||||||||| || |||||||||||||| | | |||||||||||||||||
Sbjct: 3052 ccagctccctggtacatcttcgcaatgatggggttgcagatgccctccagctccttcatc 2993

                                                                        
Query: 295  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagca 354
            |||||||| |||||||| |||||||| ||||||||  ||||||||||   ||||||  ||
Sbjct: 2992 ttgtcttcgaactcgtcggcctcagcgagctggttgctgtccagccagctgatggctcca 2933

                                                                        
Query: 355  tcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcg 414
            ||||  || |||||||||||||||||||| || || || |||| |||||||||||| |||
Sbjct: 2932 tcgacagcgtcctcgatcttcttcttgtcctccgcagggagctcggaggcgatcttgtcg 2873

                                      
Query: 415  tccttgatggtgttgcgcatgttgta 440
            ||||||||||| || | |||||||||
Sbjct: 2872 tccttgatggtattcctcatgttgta 2847



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 153  ttagtcgacctcctcgatcttggg 176
            ||||||||||||||| ||||||||
Sbjct: 3122 ttagtcgacctcctcaatcttggg 3099



to top

>gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock protein (TaHSP70d) mRNA, complete
            cds
          Length = 2311

 Score =  178 bits (90), Expect = 1e-41
 Identities = 180/210 (85%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
            |||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 1967 ccctggtacatcttggcgatgatggggttgcagatgccctccagctccttcatcttgtcc 1908

                                                                        
Query: 301  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
            || |||||||| ||||| || |||||||| | |||||||||   |||||   | ||||| 
Sbjct: 1907 tcgaactcgtcggcctcggcgagctggttggcgtccagccagctgatggtgccctcgatc 1848

                                                                        
Query: 361  gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
            |||||||| | ||||||||||||||| ||    ||||||||||||||||| |||||||||
Sbjct: 1847 gcctcctccaccttcttcttgtcgtccgcgccgagcttggaggcgatcttgtcgtccttg 1788

                                          
Query: 421  atggtgttgcgcatgttgtaagagtagttc 450
            |  ||||||||||||||||| | |||||||
Sbjct: 1787 accgtgttgcgcatgttgtaggcgtagttc 1758



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 153  ttagtcgacctcctcgatcttggggccagggccgccg 189
            |||||| |||||||||||||||||||||| |||||||
Sbjct: 2061 ttagtccacctcctcgatcttggggccagcgccgccg 2025



to top

>gb|BT016692.1| Zea mays clone Contig525 mRNA sequence
          Length = 1806

 Score =  167 bits (84), Expect = 4e-38
 Identities = 171/200 (85%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
            |||||||||||||| ||||||||||||||||| |   |||| ||||||||||||||||||
Sbjct: 1560 ccctggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtct 1501

                                                                        
Query: 301  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
            |||||||| ||| ||||||| ||||||||  ||||||||||   ||||||    || | |
Sbjct: 1500 tcaaactcctccacctcagccagctggttgctgtccagccagctgatggcgctgtcaacg 1441

                                                                        
Query: 361  gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
            || || ||||||||||||||||| || || || ||||||||||||||||| |||||||||
Sbjct: 1440 gcatcttcgatcttcttcttgtcctcagcggggagcttggaggcgatcttgtcgtccttg 1381

                                
Query: 421  atggtgttgcgcatgttgta 440
            |||||||| | |||||||||
Sbjct: 1380 atggtgttcctcatgttgta 1361



to top

>gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence
          Length = 1788

 Score =  167 bits (84), Expect = 4e-38
 Identities = 176/204 (86%), Gaps = 2/204 (0%)
 Strand = Plus / Minus

                                                                        
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 294
            ||||| || ||||||||||||||||||||||||||||| | | |||| ||||||||||||
Sbjct: 1539 ccagcgccttggtacatcttggcgatgatggggttgcagatgccctcgagctccttcatc 1480

                                                                        
Query: 295  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagcca-ctggatggcagc 353
            |||||||| ||||||||| ||||||| ||||||||  |||||||||| |||| ||||   
Sbjct: 1479 ttgtcttcgaactcgtccacctcagctagctggttgctgtccagccagctgg-tggcgct 1421

                                                                        
Query: 354  atcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctc 413
            |||||  || ||||||||||| |||||||| || ||||  ||||||||||||||||| ||
Sbjct: 1420 atcgacagcgtcctcgatctttttcttgtcatctgccgagagcttggaggcgatcttgtc 1361

                                    
Query: 414  gtccttgatggtgttgcgcatgtt 437
             |||||||||||||| | ||||||
Sbjct: 1360 atccttgatggtgttcctcatgtt 1337



to top

>gb|AY104350.1| Zea mays PCO083553 mRNA sequence
          Length = 1167

 Score =  163 bits (82), Expect = 6e-37
 Identities = 178/210 (84%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
           ||||| |||||||| ||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 844 ccctgatacatcttcgcgatgatggggttgcagatgccctccagctccttcatcttgtcc 785

                                                                       
Query: 301 tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
           |||||||| ||  |||| || ||||||||  |||| ||||| | ||||||  | |||| |
Sbjct: 784 tcaaactcatcaacctcggcgagctggttgttgtcgagccaattgatggccccctcgacg 725

                                                                       
Query: 361 gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
           || || |||||||| |||||||||||  |||| ||||||||||||||||| |||||  ||
Sbjct: 724 gcgtcatcgatctttttcttgtcgtcctccggtagcttggaggcgatcttgtcgtctctg 665

                                         
Query: 421 atggtgttgcgcatgttgtaagagtagttc 450
           |||||||||||||| ||||| | |||||||
Sbjct: 664 atggtgttgcgcatattgtaggcgtagttc 635



to top

>emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon 2 and 3'-UT (hsp70; clone
            pMON 9502)
          Length = 1934

 Score =  161 bits (81), Expect = 2e-36
 Identities = 168/197 (85%)
 Strand = Plus / Minus

                                                                        
Query: 244  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
            ||||||||||| ||||||||||||||||| |   |||| |||||||||||||||||||| 
Sbjct: 1772 tggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtcttcg 1713

                                                                        
Query: 304  aactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcc 363
            ||||| ||| ||||||| ||||||||  ||||||||||   ||||||  | || | ||| 
Sbjct: 1712 aactcctccacctcagccagctggttgctgtccagccagctgatggcgccgtcaacggca 1653

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            || ||||||||||||||||| || || || ||||||||||||||||| ||||||||||||
Sbjct: 1652 tcttcgatcttcttcttgtcctcagcggggagcttggaggcgatcttgtcgtccttgatg 1593

                             
Query: 424  gtgttgcgcatgttgta 440
            ||||| | |||||||||
Sbjct: 1592 gtgttcctcatgttgta 1576



to top

>gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein mRNA, complete cds
          Length = 1241

 Score =  161 bits (81), Expect = 2e-36
 Identities = 177/209 (84%)
 Strand = Plus / Minus

                                                                       
Query: 232 gcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||||||| ||||||||||||||||||||||||||||| | |  |||||| ||||||
Sbjct: 994 gcaccagcaccttggtacatcttggcgatgatggggttgcagatgctctccagttccttc 935

                                                                       
Query: 292 atcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggca 351
           |||||||| |||||||| || || ||||||||||||||  |||| ||||||||||| || 
Sbjct: 934 atcttgtcatcaaactcatcagcttcagcaagctggttgttgtcgagccactggattgcc 875

                                                                       
Query: 352 gcatcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttc 411
              || || || ||||| ||||||||||||||  | || ||||||||||| || ||||| 
Sbjct: 874 tggtcaattgcatcctcaatcttcttcttgtcagcagcaggcagcttggaagcaatcttg 815

                                        
Query: 412 tcgtccttgatggtgttgcgcatgttgta 440
           || |||||||||||||| | |||||||||
Sbjct: 814 tcatccttgatggtgttcctcatgttgta 786



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||||||||| |||||||| ||||
Sbjct: 1076 ttagtcgacctcctcaatcttgggaccag 1048



to top

>emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock protein of the
            chloroplast envelope membrane
          Length = 2535

 Score =  141 bits (71), Expect = 2e-30
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 2269 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 2210

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            |||||||| | |  ||||| ||||||||||||||| || ||||| || ||||||||||||
Sbjct: 2209 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 2150

                                                                       
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 383
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 2149 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 2091



to top

>gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-1) gene,
            complete cds
          Length = 4349

 Score =  141 bits (71), Expect = 2e-30
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 4091 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 4032

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            |||||||| | |  ||||| ||||||||||||||| || ||||| || ||||||||||||
Sbjct: 4031 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 3972

                                                                       
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 383
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 3971 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 3913



to top

>gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRNA, complete cds
          Length = 2194

 Score =  141 bits (71), Expect = 2e-30
 Identities = 152/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 1936 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 1877

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            |||||||| | |  ||||| ||||||||||||||| || ||||| || ||||||||||||
Sbjct: 1876 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 1817

                                                                       
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 383
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 1816 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 1758



to top

>gb|AY106152.1| Zea mays PCO094428 mRNA sequence
          Length = 1011

 Score =  131 bits (66), Expect = 2e-27
 Identities = 174/210 (82%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
           |||||||||||||  | ||||||||||||||| | |  ||||||||||||||||||||| 
Sbjct: 678 ccctggtacatctgtgagatgatggggttgcagatgctctccagctccttcatcttgtcc 619

                                                                       
Query: 301 tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
           || ||||| || ||||| || ||||||||   ||| ||||||| ||||||  | ||||| 
Sbjct: 618 tcgaactcctcggcctccgcgagctggttgccgtcgagccacttgatggcgtcctcgatc 559

                                                                       
Query: 361 gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
           |  |||||||||||||||||||| ||||| |||||||| || |||||||||||||||   
Sbjct: 558 gtgtcctcgatcttcttcttgtcatcggcgggcagcttcgacgcgatcttctcgtcccgc 499

                                         
Query: 421 atggtgttgcgcatgttgtaagagtagttc 450
           |  |||||||||||||| || | |||||||
Sbjct: 498 accgtgttgcgcatgttatacgcgtagttc 469



to top

>emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock protein 70 isoform-2
          Length = 2617

 Score =  127 bits (64), Expect = 3e-26
 Identities = 129/148 (87%), Gaps = 2/148 (1%)
 Strand = Plus / Minus

                                                                        
Query: 238  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 297
            ||||| |||||||||||||| ||||| |||||||| | |  ||||| |||||||||||||
Sbjct: 2223 gcaccttggtacatcttggcaatgattgggttgcaaatgctctccaactccttcatcttg 2164

                                                                        
Query: 298  tcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatgg-cagcatc 356
            ||||| |||||||| |||||||| |||||||| | ||||||||| ||||||| | || ||
Sbjct: 2163 tcttcgaactcgtcagcctcagctagctggttggcgtccagccattggatggactgc-tc 2105

                                        
Query: 357  gatggcctcctcgatcttcttcttgtcg 384
            |||||| || ||||||||||||||||||
Sbjct: 2104 gatggcatcgtcgatcttcttcttgtcg 2077



to top

>gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial sequence
          Length = 804

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 294
           |||||||| |||||||||||||| || || |||||||| | |  ||||| ||||||||||
Sbjct: 523 ccagcaccttggtacatcttggcaataattgggttgcaaatgctctccaactccttcatc 464

                                                                       
Query: 295 ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagca 354
           ||||||||||| || || | ||||||||||||||| |  || ||||||||||||||    
Sbjct: 463 ttgtcttcaaattcatcagactcagcaagctggttggcatcgagccactggatggcctgc 404

                                                                       
Query: 355 tcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcg 414
           || ||||| ||||| ||||||||| |||   |  | ||||||||||| || |||||||| 
Sbjct: 403 tcaatggcttcctcaatcttcttcctgtttgcctcaggcagcttggatgcaatcttctca 344

                                     
Query: 415 tccttgatggtgttgcgcatgttgta 440
           |||||||||||||| | |||||||||
Sbjct: 343 tccttgatggtgttcctcatgttgta 318



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 153 ttagtcgacctcctcgatcttggggccag 181
           |||||||||||||||||||||||| ||||
Sbjct: 611 ttagtcgacctcctcgatcttgggaccag 583



to top

>gb|AF161180.1|AF161180 Malus domestica high molecular weight heat shock protein (Hsp2) mRNA,
            complete cds
          Length = 2212

 Score =  123 bits (62), Expect = 5e-25
 Identities = 158/190 (83%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            ||||||||||||||||||| ||||| || ||||| | |  ||||||||||||||||||||
Sbjct: 1891 caccctggtacatcttggcaatgatcggattgcagatgctctccagctccttcatcttgt 1832

                                                                        
Query: 299  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 358
            | ||||||||||| |||||||||||||||||   ||| ||||| ||||||||    || |
Sbjct: 1831 cctcaaactcgtcggcctcagcaagctggtttccgtcaagccattggatggcctggtcaa 1772

                                                                        
Query: 359  tggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtcct 418
            | || ||||| ||||||||||||||  | ||    ||||||||||| ||||| |||||||
Sbjct: 1771 ttgcatcctcaatcttcttcttgtcagctgcgtctagcttggaggcaatcttatcgtcct 1712

                      
Query: 419  tgatggtgtt 428
            |||| |||||
Sbjct: 1711 tgatcgtgtt 1702



to top

>dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein 70 cognate, partial
            cds
          Length = 1475

 Score =  119 bits (60), Expect = 8e-24
 Identities = 192/236 (81%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
            ||||| |||||||||||  |||| || || |||||||| || |||||||| || ||||||
Sbjct: 1172 tcatcctccatgccaccacccatatcagctccagcaccttgatacatcttagcaatgatg 1113

                                                                        
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
            || ||||| | |  ||| ||||||||||||||||| |||||||| || |||||||| |||
Sbjct: 1112 ggattgcagatgctctcaagctccttcatcttgtcctcaaactcatctgcctcagcgagc 1053

                                                                        
Query: 325  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
            |||||  |||| ||||||||||| ||    || || || |||||||| ||||||||||||
Sbjct: 1052 tggttgctgtcgagccactggatagcctggtcaatcgcatcctcgattttcttcttgtcg 993

                                                                    
Query: 385  tcggccggcagcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            || ||   |||||| |||  ||||||||| |||||||  ||||| | |||||||||
Sbjct: 992  tctgcacccagcttagagctgatcttctcatccttgacagtgttcctcatgttgta 937



to top

>gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cognate protein 70
            (Hsc70-3) mRNA, complete cds
          Length = 1953

 Score =  115 bits (58), Expect = 1e-22
 Identities = 129/150 (86%), Gaps = 2/150 (1%)
 Strand = Plus / Minus

                                                                        
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 294
            ||||| || |||||||||||||||||||| |||||||| | |  ||||| ||||||||||
Sbjct: 1862 ccagcgccttggtacatcttggcgatgattgggttgcagatgctctccaactccttcatc 1803

                                                                        
Query: 295  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatgg-cagc 353
            |||||||| ||||| || || ||||| |||||||| | ||| ||||||||||||| | ||
Sbjct: 1802 ttgtcttcgaactcatcggcttcagccagctggttggcgtcaagccactggatggactgc 1743

                                          
Query: 354  atcgatggcctcctcgatcttcttcttgtc 383
             |||||||| || |||||||||||||||||
Sbjct: 1742 -tcgatggcatcttcgatcttcttcttgtc 1714



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||| |||||||||||||| ||||
Sbjct: 1953 ttagtcgacttcctcgatcttgggaccag 1925



to top

>gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70 protein (HSC70) mRNA,
            complete cds
          Length = 2184

 Score =  105 bits (53), Expect = 1e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 1911 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 1852

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 1851 tcttatcttcaaactcatcagcctcagcaagctggtt 1815



to top

>gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3alpha)
            gene, complete cds
          Length = 5903

 Score =  105 bits (53), Expect = 1e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 4486 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4427

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 4426 tcttatcttcaaactcatcagcctcagcaagctggtt 4390



to top

>gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3beta) gene,
            complete cds
          Length = 6425

 Score =  105 bits (53), Expect = 1e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 5013 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4954

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||| ||||||||||| || |||||||||||||||||
Sbjct: 4953 tcttatcttcaaactcatcagcctcagcaagctggtt 4917



to top

>gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-1) mRNA, complete cds
          Length = 1959

 Score =  101 bits (51), Expect = 2e-18
 Identities = 126/151 (83%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||||||||||||||| || |  || |||||||| | |  ||| || |||||||
Sbjct: 1864 caccagcaccctggtacatcttagcaacaattgggttgcaaatgctctcaagttccttca 1805

                                                                        
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 352
            | ||||||||||||||||| ||||| ||||| |||||  |||||||||||||||  ||  
Sbjct: 1804 ttttgtcttcaaactcgtcggcctctgcaagttggttattgtccagccactggactgctc 1745

                                           
Query: 353  catcgatggcctcctcgatcttcttcttgtc 383
            | |||||||| || ||||||||||| |||||
Sbjct: 1744 cctcgatggcatcttcgatcttctttttgtc 1714



to top

>dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
            cds
          Length = 1203

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 170/210 (80%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
            ||||||||||| || || |||| ||||||||| ||| |||| || |||||||| ||||||
Sbjct: 1054 ccctggtacatttttgcaatgaaggggttgcagaggccctctagttccttcattttgtct 995

                                                                        
Query: 301  tcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 360
            |||||||| || ||||| |||||||||||    || ||||| ||||||||  | || |||
Sbjct: 994  tcaaactcatcagcctcggcaagctggtttccatcaagccattggatggcttcctcaatg 935

                                                                        
Query: 361  gcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttg 420
            || ||||| |||||||||||||| || || | ||| ||||| || |||||||| || || 
Sbjct: 934  gcatcctcaatcttcttcttgtcttcagcagacagtttggatgcaatcttctcatctttc 875

                                          
Query: 421  atggtgttgcgcatgttgtaagagtagttc 450
            |  ||||| | ||| ||||| |||||||||
Sbjct: 874  acagtgttcctcatattgtatgagtagttc 845



to top

>dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-C
          Length = 351

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 244 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
           |||||||||||||| |||||||||||||| | |  ||| |||||||||||||| ||||||
Sbjct: 233 tggtacatcttggcaatgatggggttgcagatgctctcgagctccttcatcttatcttca 174

                                     
Query: 304 aactcgtccgcctcagcaagctggtt 329
           |||||||| || ||||||||||||||
Sbjct: 173 aactcgtcagcttcagcaagctggtt 148



to top

>gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, partial cds
          Length = 1484

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 121/145 (83%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1198 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1139

                                                                        
Query: 299  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 358
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 1138 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1079

                                     
Query: 359  tggcctcctcgatcttcttcttgtc 383
            |||| ||||| ||||||||||||||
Sbjct: 1078 tggcatcctcaatcttcttcttgtc 1054



to top

>gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-45n16, complete
             sequence
          Length = 107886

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 121/145 (83%)
 Strand = Plus / Plus

                                                                         
Query: 239   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
             |||| |||||||||||||| ||||| |||||||| |   | || || |||||||||||||
Sbjct: 27323 caccttggtacatcttggcaatgatagggttgcagacaccttcaagttccttcatcttgt 27382

                                                                         
Query: 299   cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 358
             | |||||||| || ||||| ||||||||||| |  || ||||||||||| ||||| || |
Sbjct: 27383 cctcaaactcatcagcctctgcaagctggttggcatctagccactggatagcagcctcaa 27442

                                      
Query: 359   tggcctcctcgatcttcttcttgtc 383
             |||  |||||||||||||| |||||
Sbjct: 27443 tggtgtcctcgatcttctttttgtc 27467



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 152   tttagtcgacctcctcgatcttggggccag 181
             |||||||||||||||| ||||| |||||||
Sbjct: 27230 tttagtcgacctcctcaatcttagggccag 27259



to top

>gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-2) mRNA, complete cds
          Length = 1944

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Minus

                                                                        
Query: 224  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 283
            ||||||| || || ||||| |||||||||||||||||||| |||||||| | |  |||||
Sbjct: 1873 ccatgtcagctccggcaccttggtacatcttggcgatgattgggttgcagatgctctcca 1814

                                                                        
Query: 284  gctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 343
             ||||||||||||||| || || || || ||||| || |||||||| |  || |||||||
Sbjct: 1813 actccttcatcttgtcctcgaattcatcggcctccgccagctggttggcatcgagccact 1754

                                                     
Query: 344  ggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
            |||||||    |||||||| || || |||||||||||||||
Sbjct: 1753 ggatggcttgctcgatggcgtcttcaatcttcttcttgtcg 1713



to top

>dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-A
          Length = 422

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 233 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
           ||||||||||||||||||||||||| |||||||| || || | | |||| ||||||||||
Sbjct: 328 caccagcaccctggtacatcttggcaatgatgggattacaaatgccctcaagctccttca 269

                                                
Query: 293 tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
           ||||||| |||||||| || || || |||||||||||
Sbjct: 268 tcttgtcctcaaactcatcagcttctgcaagctggtt 232



to top

>gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate protein (SCHSP70) mRNA,
           complete cds
          Length = 1149

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                       
Query: 233 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
           |||||||||||||||||||||| || || ||||| ||||| |||  |||||| |||||||
Sbjct: 949 caccagcaccctggtacatcttagcaattatgggattgcataggctctccagttccttca 890

                                                
Query: 293 tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
           |||| ||||||||||| || || ||||||||||||||
Sbjct: 889 tcttatcttcaaactcatcagcttcagcaagctggtt 853



to top

>gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds
          Length = 491

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 accagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcat 293
           |||||||||||| |||||||| || || ||||| ||||| | |  |||||||||||||||
Sbjct: 192 accagcaccctgatacatctttgcaattatgggattgcagatgctctccagctccttcat 133

                                               
Query: 294 cttgtcttcaaactcgtccgcctcagcaagctggtt 329
           |||||| |||||||| |||||||| |||||||||||
Sbjct: 132 cttgtcctcaaactcatccgcctcggcaagctggtt 97



to top

>gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein (Hsc70) mRNA, complete cds
          Length = 2184

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 175/218 (80%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  ||||| ||||||||
Sbjct: 1930 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaactccttca 1871

                                                                        
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 352
            ||||||| || ||||| || |||||| | | ||| ||  | ||||||||||| || ||  
Sbjct: 1870 tcttgtcctcgaactcatcagcctcacccaactgattgttctccagccactgaatcgcct 1811

                                                                        
Query: 353  catcgatggcctcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttct 412
              || || || ||||||||||||||||||||  | ||||| |||||     | |||||||
Sbjct: 1810 gctcaatagcgtcctcgatcttcttcttgtctgcagccggtagcttctcaccaatcttct 1751

                                                  
Query: 413  cgtccttgatggtgttgcgcatgttgtaagagtagttc 450
            |||||| ||||||||| | ||||||||||| |||||||
Sbjct: 1750 cgtcctggatggtgttcctcatgttgtaagcgtagttc 1713



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                        
Query: 153  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 212
            |||||||||||| |||||||| |||||||  ||||| || |||| ||| |  ||||||||
Sbjct: 2007 ttagtcgacctcttcgatcttagggccagcaccgcctgaggcaggaggagcatcatcgtc 1948

               
Query: 213  cat 215
            |||
Sbjct: 1947 cat 1945



to top

>gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, complete cds
          Length = 3290

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 3048 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 2989

                                                                        
Query: 299  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 358
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 2988 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 2929

                                     
Query: 359  tggcctcctcgatcttcttcttgtc 383
            | || ||||| ||||||||||||||
Sbjct: 2928 tcgcatcctcaatcttcttcttgtc 2904



to top

>gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete
            cds
          Length = 3208

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 2928 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 2869

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||| ||||||||||| || || ||||||||||||||
Sbjct: 2868 tcttatcttcaaactcatcagcttcagcaagctggtt 2832



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 406  atcttctcgtccttgatggtgttgcgcatgttgta 440
            |||||||||||||| |||||||| | |||||||||
Sbjct: 2755 atcttctcgtcctttatggtgttcctcatgttgta 2721



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 153  ttagtcgacctcctcgatcttggg 176
            ||||||||||||||| ||||||||
Sbjct: 3011 ttagtcgacctcctcaatcttggg 2988



to top

>gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) mRNA, complete cds
          Length = 2259

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 1966 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 1907

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||| ||||||||||| || || ||||||||||||||
Sbjct: 1906 tcttatcttcaaactcatcagcttcagcaagctggtt 1870



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 406  atcttctcgtccttgatggtgttgcgcatgttgta 440
            |||||||||||||| |||||||| | |||||||||
Sbjct: 1793 atcttctcgtcctttatggtgttcctcatgttgta 1759



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 153  ttagtcgacctcctcgatcttggg 176
            ||||||||||||||| ||||||||
Sbjct: 2049 ttagtcgacctcctcaatcttggg 2026



to top

>gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2224

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1914 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1855

                                                                        
Query: 299  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 358
            | |||||||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 1854 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1795

                                     
Query: 359  tggcctcctcgatcttcttcttgtc 383
            | || ||||| ||||||||||||||
Sbjct: 1794 tcgcatcctcaatcttcttcttgtc 1770



to top

>gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1 mRNA, complete cds
          Length = 2218

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||| ||||||||||| ||||||||||| ||||| | |  ||||| ||||||||
Sbjct: 1948 caccagcaccttggtacatcttagcgatgatgggattgcatatgctctccaactccttca 1889

                                                  
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggttc 330
            ||||||| ||||| || || |||||| |||| ||||||
Sbjct: 1888 tcttgtcctcaaattcatcagcctcaccaagttggttc 1851



to top

>gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds
          Length = 276

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 114/138 (82%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaa 305
           |||||||||||| || || |||||||| | | |||||||||| |||||||| ||||||||
Sbjct: 276 gtacatcttggcaataattgggttgcagatgccctccagctctttcatcttatcttcaaa 217

                                                                       
Query: 306 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctc 365
           ||| || ||||| || |||||||||  ||| ||||| ||||||||  | || ||||| ||
Sbjct: 216 ctcatctgcctctgcgagctggttcccgtcaagccattggatggcctcctcaatggcatc 157

                             
Query: 366 ctcgatcttcttcttgtc 383
            || || |||||||||||
Sbjct: 156 ttcaattttcttcttgtc 139



to top

>gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence
          Length = 2190

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1959 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1900

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            ||||||| |||||||| ||  | || |||||||||||
Sbjct: 1899 tcttgtcctcaaactcatcaacttctgcaagctggtt 1863



to top

>emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for heat shock protein 70 kD
          Length = 2120

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1907 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1848

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            ||||||| |||||||| ||  | || |||||||||||
Sbjct: 1847 tcttgtcctcaaactcatcaacttctgcaagctggtt 1811



to top

>gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F01 mRNA sequence
          Length = 262

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Minus

                                                                       
Query: 246 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaa 305
           |||||||||||| |||||||| ||||| |||  ||||||||||||||||||||| || ||
Sbjct: 262 gtacatcttggctatgatgggattgcaaaggctctccagctccttcatcttgtcctcgaa 203

                                                        
Query: 306 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggc 350
            || || |||||||| ||||| ||  |||| ||||||| ||||||
Sbjct: 202 ttcatctgcctcagctagctgattactgtcaagccacttgatggc 158



to top

>gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) mRNA, complete cds
          Length = 2302

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            |||| ||||||||||| || ||||| |||||||| | ||  || ||||||||||||||||
Sbjct: 1962 caccttggtacatctttgcaatgattgggttgcagatggtttcaagctccttcatcttgt 1903

                                           
Query: 299  cttcaaactcgtccgcctcagcaagctggtt 329
            |||| ||||| || || ||||||||||||||
Sbjct: 1902 cttcgaactcatcggcttcagcaagctggtt 1872



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||||||||| |||||||| ||||
Sbjct: 2054 ttagtcgacctcctcaatcttgggaccag 2026



to top

>gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete sequence
          Length = 135915

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                          
Query: 239    caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
              |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 118421 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 118480

                                             
Query: 299    cttcaaactcgtccgcctcagcaagctggtt 329
              |||||||||| || || ||||||||||||||
Sbjct: 118481 cttcaaactcatcggcttcagcaagctggtt 118511



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 162/203 (79%)
 Strand = Plus / Minus

                                                                         
Query: 247   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaac 306
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| |||||||||
Sbjct: 35431 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 35372

                                                                         
Query: 307   tcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcc 366
             || || ||||| || | ||||||  |||||| |||||| || ||||| || || || || 
Sbjct: 35371 tcatcagcctctgccaactggttactgtccaaccactgaattgcagcgtcaattgcatca 35312

                                                                         
Query: 367   tcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatggtg 426
             || |||||||| ||||| || |  |  ||||| ||  | ||||||||||| || || |||
Sbjct: 35311 tcaatcttctttttgtcctcaggtgaaagctttgaaccaatcttctcgtctttaattgtg 35252

                                    
Query: 427   ttgcgcatgttgtaagagtagtt 449
             || | ||||||||||| ||||||
Sbjct: 35251 ttcctcatgttgtaagcgtagtt 35229



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 153    ttagtcgacctcctcgatcttggggccag 181
              ||||||||||||||| |||||||| ||||
Sbjct: 118329 ttagtcgacctcctcaatcttgggaccag 118357



to top

>gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete sequence
          Length = 111486

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 239   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
             |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 93989 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 94048

                                            
Query: 299   cttcaaactcgtccgcctcagcaagctggtt 329
             |||||||||| || || ||||||||||||||
Sbjct: 94049 cttcaaactcatcggcttcagcaagctggtt 94079



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 162/203 (79%)
 Strand = Plus / Minus

                                                                         
Query: 247   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaac 306
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| |||||||||
Sbjct: 10998 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 10939

                                                                         
Query: 307   tcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcc 366
             || || ||||| || | ||||||  |||||| |||||| || ||||| || || || || 
Sbjct: 10938 tcatcagcctctgccaactggttactgtccaaccactgaattgcagcgtcaattgcatca 10879

                                                                         
Query: 367   tcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatggtg 426
             || |||||||| ||||| || |  |  ||||| ||  | ||||||||||| || || |||
Sbjct: 10878 tcaatcttctttttgtcctcaggtgaaagctttgaaccaatcttctcgtctttaattgtg 10819

                                    
Query: 427   ttgcgcatgttgtaagagtagtt 449
             || | ||||||||||| ||||||
Sbjct: 10818 ttcctcatgttgtaagcgtagtt 10796



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 153   ttagtcgacctcctcgatcttggggccag 181
             ||||||||||||||| |||||||| ||||
Sbjct: 93897 ttagtcgacctcctcaatcttgggaccag 93925



to top

>ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G02500 (HSC70-1) mRNA,
            complete cds
          Length = 2371

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1969 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1910

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1909 tcttgtcttcgaactcatcagcctcagccaactggtt 1873



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1838 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1779

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1778 gtgttcctcatgttgtaagcgtagttc 1752



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 2061 ttagtcgacctcctcgatctt 2041



to top

>emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein
          Length = 830

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 233 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
           |||||||||| || ||||||||| | ||||| |||||||| | | |||||||||||||||
Sbjct: 560 caccagcaccttgatacatcttgccaatgatagggttgcaaatgccctccagctccttca 501

                        
Query: 293 tcttgtcttcaaa 305
           ||||||| |||||
Sbjct: 500 tcttgtcctcaaa 488



to top

>emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene
          Length = 4297

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 2146 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 2087

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 2086 tcttgtcttcgaactcatcagcctcagccaactggtt 2050



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 2015 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1956

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1955 gtgttcctcatgttgtaagcgtagttc 1929



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 2238 ttagtcgacctcctcgatctt 2218



to top

>emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognate protein
          Length = 2209

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1938 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1879

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1878 tcttgtcttcgaactcatcagcctcagccaactggtt 1842



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1807 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1748

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1747 gtgttcctcatgttgtaagcgtagttc 1721



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 2030 ttagtcgacctcctcgatctt 2010



to top

>gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular chaperone hsc70.1
           protein (At5g02500) mRNA, partial cds
          Length = 860

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                       
Query: 233 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
           ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 556 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 497

                                                
Query: 293 tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
           |||||||||| ||||| || |||||||| | ||||||
Sbjct: 496 tcttgtcttcgaactcatcagcctcagccaactggtt 460



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 364 tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
           ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 425 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 366

                                      
Query: 424 gtgttgcgcatgttgtaagagtagttc 450
           ||||| | ||||||||||| |||||||
Sbjct: 365 gtgttcctcatgttgtaagcgtagttc 339



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 153 ttagtcgacctcctcgatctt 173
           |||||||||||||||||||||
Sbjct: 648 ttagtcgacctcctcgatctt 628



to top

>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project)
          Length = 96424

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                         
Query: 233   caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
             ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 35077 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 35136

                                                  
Query: 293   tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
             |||||||||| ||||| || |||||||| | ||||||
Sbjct: 35137 tcttgtcttcgaactcatcagcctcagccaactggtt 35173



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                         
Query: 244   tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
             ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 31335 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 31394

                     
Query: 304   aactcgtc 311
             ||||||||
Sbjct: 31395 aactcgtc 31402



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                         
Query: 364   tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
             ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 35208 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 35267

                                        
Query: 424   gtgttgcgcatgttgtaagagtagttc 450
             ||||| | ||||||||||| |||||||
Sbjct: 35268 gtgttcctcatgttgtaagcgtagttc 35294



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 153   ttagtcgacctcctcgatctt 173
             |||||||||||||||||||||
Sbjct: 34985 ttagtcgacctcctcgatctt 35005



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 153   ttagtcgacctcctcgatcttggggccag 181
             ||||||||| |||||||||||||| ||||
Sbjct: 31226 ttagtcgacttcctcgatcttgggaccag 31254



to top

>gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1
            (At5g02500) mRNA, complete cds
          Length = 2254

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1837 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1778

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1777 gtgttcctcatgttgtaagcgtagttc 1751



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 2060 ttagtcgacctcctcgatctt 2040



to top

>gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, complete cds
          Length = 2228

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1837 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1778

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1777 gtgttcctcatgttgtaagcgtagttc 1751



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 2060 ttagtcgacctcctcgatctt 2040



to top

>emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH75ZA02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2188

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1949 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1890

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1889 tcttgtcttcgaactcatcagcctcagccaactggtt 1853



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1818 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1759

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1758 gtgttcctcatgttgtaagcgtagttc 1732



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 2041 ttagtcgacctcctcgatctt 2021



to top

>gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-type molecular
            chaperone hsc70.1 protein (At5g02500) mRNA, complete cds
          Length = 1987

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 292
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1864 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1805

                                                 
Query: 293  tcttgtcttcaaactcgtccgcctcagcaagctggtt 329
            |||||||||| ||||| || |||||||| | ||||||
Sbjct: 1804 tcttgtcttcgaactcatcagcctcagccaactggtt 1768



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                        
Query: 364  tcctcgatcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatg 423
            ||||||||||||||||||||  | ||||| |||||     | ||||||||||| | ||||
Sbjct: 1733 tcctcgatcttcttcttgtctgcagccgggagcttctcaccaatcttctcgtcttggatg 1674

                                       
Query: 424  gtgttgcgcatgttgtaagagtagttc 450
            ||||| | ||||||||||| |||||||
Sbjct: 1673 gtgttcctcatgttgtaagcgtagttc 1647



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 153  ttagtcgacctcctcgatctt 173
            |||||||||||||||||||||
Sbjct: 1956 ttagtcgacctcctcgatctt 1936



to top

>gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70) gene, partial cds
          Length = 1839

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
            |||||||||| ||||||||||||||| |||||||    |||||| |||||| ||||||  
Sbjct: 1757 ccctggtacagcttggcgatgatgggtttgcacacttgctccagttccttcttcttgtgc 1698

                                                     
Query: 301  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 341
            ||| ||||||||  |||||| ||||||||  ||||||||||
Sbjct: 1697 tcatactcgtccttctcagccagctggttgctgtccagcca 1657



to top

>emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for heat shock protein cognate 70
          Length = 2117

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 223  tccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcc 282
            ||||||||  |||| || || |||||||| || || ||||| |||||||| ||   ||| 
Sbjct: 1946 tccatgtcaccacctgctccttggtacatttttgcaatgatagggttgcaaagactctct 1887

                                                                        
Query: 283  agctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 342
            ||||||||||||||||| |||||||| || |||||||| ||||||||    || ||||||
Sbjct: 1886 agctccttcatcttgtcctcaaactcttcagcctcagcgagctggttaccatcaagccac 1827

                    
Query: 343  tggatggc 350
            ||||||||
Sbjct: 1826 tggatggc 1819



to top

>gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA, complete cds
          Length = 2631

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                        
Query: 242  cctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtctt 301
            ||||||||| ||||| |||||||||||| ||||   ||||||||||||||  ||||| ||
Sbjct: 1924 cctggtacaacttggtgatgatggggttacacactccctccagctccttctgcttgtgtt 1865

                                                    
Query: 302  caaactcgtccgcctcagcaagctggttcgtgtccagcca 341
            | ||||| |||  ||| ||||||||||| | |||||||||
Sbjct: 1864 cgaactcatccttctcggcaagctggttagagtccagcca 1825



to top

>gb|DQ295224.1| Malawimonas jakobiformis cytosolic heat shock protein 70 (HSP70)
            gene, partial cds
          Length = 1937

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 400  gaggcgatcttctcgtccttgatggtgttgcgcatgttgtaagagtagttc 450
            ||||||| |||||||||||||| |||||||||||||||||| | |||||||
Sbjct: 1723 gaggcgaacttctcgtccttgacggtgttgcgcatgttgtaggcgtagttc 1673



to top

>gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow trout, testes,
            Genomic, 6825 nt]
          Length = 6825

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcaca 274
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 6055 caccagcaccctggtacagcttggtgatgatggggttgcaca 6014



to top

>dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 70kDa protein 8
            isoform a, complete cds
          Length = 2359

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcaca 274
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1958 caccagcaccctggtacagcttggtgatgatggggttgcaca 1917



to top

>gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2 mRNA, complete cds
          Length = 2264

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 116/143 (81%), Gaps = 3/143 (2%)
 Strand = Plus / Minus

                                                                        
Query: 205  tcatcgtccatgccaccctccatgtcggcaccagcacc---ctggtacatcttggcgatg 261
            ||||||||||| |||||  ||||||| | |||||||||   ||||||||||||||| |||
Sbjct: 1905 tcatcgtccattccacctcccatgtctggaccagcacctccctggtacatcttggcaatg 1846

                                                                        
Query: 262  atggggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagca 321
            || || ||||| | |   ||||  |||||||| ||||| |||||||| || |||||  ||
Sbjct: 1845 ataggattgcagatgctttccaattccttcattttgtcctcaaactcatctgcctctcca 1786

                                   
Query: 322  agctggttcgtgtccagccactg 344
            || |||||  |||||||||||||
Sbjct: 1785 agttggttgctgtccagccactg 1763



to top

>emb|X62799.1|GMHSP70 Glycine max hsp 70 gene
          Length = 3272

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 236  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatct 295
            ||||||||||||||||||| || |||||||||||||| |   | |||| |||||||  ||
Sbjct: 2628 cagcaccctggtacatcttagcaatgatggggttgcagatcccttccaactccttctgct 2569

                             
Query: 296  tgtcttcaaactcgtcc 312
            |||| ||||||||||||
Sbjct: 2568 tgtcctcaaactcgtcc 2552



to top

>gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, complete cds
          Length = 3573

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
            |||||||||||||| ||||| ||||||||||| | |  ||| ||||||||||||||||| 
Sbjct: 3206 ccctggtacatcttcgcgataatggggttgcatatgctctcaagctccttcatcttgtcc 3147

                 
Query: 301  tcaaa 305
            |||||
Sbjct: 3146 tcaaa 3142



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 394  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            ||||| ||||||||||| || |||||||||||||| | |||||||||
Sbjct: 3053 agctttgaggcgatcttgtcatccttgatggtgttcctcatgttgta 3007



to top

>dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-B
          Length = 313

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 165/209 (78%)
 Strand = Plus / Minus

                                                                       
Query: 205 tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 264
           ||||| |||||| ||||  |||||||  |||| ||||| |||||||| ||||| ||||| 
Sbjct: 215 tcatcatccatggcaccgcccatgtcaccacctgcaccttggtacattttggcaatgatt 156

                                                                       
Query: 265 gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagcaagc 324
           || ||||| | |  |||||   ||||||| ||||| ||||| || || | ||||||||||
Sbjct: 155 ggattgcagatgctctccaatcccttcattttgtcctcaaattcatcagactcagcaagc 96

                                                                       
Query: 325 tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 384
           ||||| |  || |||||||| ||||| |  || ||||| || ||||||||||| ||||| 
Sbjct: 95  tggttggcatcaagccactgtatggctgactcaatggcatcttcgatcttctttttgtca 36

                                        
Query: 385 tcggccggcagcttggaggcgatcttctc 413
            |  | ||||||||||| || ||||||||
Sbjct: 35  gcctcaggcagcttggatgcaatcttctc 7



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 153 ttagtcgacctcctcgatctt 173
           |||||||||||||||||||||
Sbjct: 273 ttagtcgacctcctcgatctt 253



to top

>ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA, complete cds
          Length = 2303

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 244  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 304  aactcgtc 311
            ||||||||
Sbjct: 1873 aactcgtc 1866



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||| |||||||||||||| ||||
Sbjct: 2042 ttagtcgacttcctcgatcttgggaccag 2014



to top

>gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669, complete cds
          Length = 2723

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagg 276
            |||||||||||||||| | ||||| |||||||||||||||||||
Sbjct: 1874 caccagcaccctggtatagcttggtgatgatggggttgcacagg 1831



to top

>gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds
          Length = 1962

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 244  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1853 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1794

                    
Query: 304  aactcgtc 311
            ||||||||
Sbjct: 1793 aactcgtc 1786



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||| |||||||||||||| ||||
Sbjct: 1962 ttagtcgacttcctcgatcttgggaccag 1934



to top

>gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1-like
            (At5g02490) mRNA, complete cds
          Length = 2124

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 244  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 304  aactcgtc 311
            ||||||||
Sbjct: 1873 aactcgtc 1866



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||| |||||||||||||| ||||
Sbjct: 2042 ttagtcgacttcctcgatcttgggaccag 2014



to top

>emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, partial
          Length = 315

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 303
           ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 206 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 147

                   
Query: 304 aactcgtc 311
           ||||||||
Sbjct: 146 aactcgtc 139



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 153 ttagtcgacctcctcgatcttggggccag 181
           |||||||||||||||||||||||| ||||
Sbjct: 315 ttagtcgacctcctcgatcttgggaccag 287



to top

>gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            gene, complete cds
          Length = 6449

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 153  ttagtcgacctcctcgatcttggggccagggccgc 187
            ||||||||||||||||||||||||||||| |||||
Sbjct: 5694 ttagtcgacctcctcgatcttggggccagcgccgc 5660



to top

>gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            mRNA, complete cds
          Length = 1950

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 153  ttagtcgacctcctcgatcttggggccagggccgc 187
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1950 ttagtcgacctcctcgatcttggggccagcgccgc 1916



to top

>ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G56410 (HSP70T-1) mRNA,
            complete cds
          Length = 1854

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 279  ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771



to top

>gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 heat shock cognate 70
            kDa protein/HSC70/HSP70 (At1g56410) mRNA, complete cds
          Length = 1854

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 279  ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771



to top

>emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70
          Length = 1005

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 239 caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
           ||||||||||||||||||| ||||| |||||||| |||   || || |||||||| ||||
Sbjct: 684 caccctggtacatcttggcaatgattgggttgcagaggctttcaagttccttcattttgt 625

                     
Query: 299 cttcaaactc 308
           | ||||||||
Sbjct: 624 cctcaaactc 615



to top

>gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13N6 genomic sequence, complete
             sequence
          Length = 90698

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 279   ctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
             ||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 29212 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 29171



to top

>emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA
          Length = 1868

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1577 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1521



to top

>emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1884



to top

>emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA
          Length = 1982

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1687 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1631



to top

>emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 854 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 798



to top

>emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA
          Length = 2232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1933 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1877



to top

>emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1886



to top

>emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1927 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1871



to top

>emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA
          Length = 1557

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 801 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 745



to top

>emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA
          Length = 1874

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1575 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1519



to top

>emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1078 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1022



to top

>emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 347 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 291



to top

>emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA
          Length = 956

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 657 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 601



to top

>emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 324 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 268



to top

>emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA
          Length = 1151

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 870 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 814



to top

>emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA
          Length = 1414

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1114 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1058



to top

>emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA
          Length = 1664

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321



to top

>emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA
          Length = 1096

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 800 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 744



to top

>emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA
          Length = 1645

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1349 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1293



to top

>emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA
          Length = 433

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78



to top

>emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA
          Length = 1832

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1543 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1487



to top

>emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA
          Length = 2230

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1931 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1875



to top

>emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA
          Length = 1683

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1393 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1337



to top

>emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA
          Length = 2235

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1883



to top

>emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA
          Length = 1779

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1485 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1429



to top

>emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA
          Length = 1419

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1123 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1067



to top

>emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 725 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 669



to top

>emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1929 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1873



to top

>emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA
          Length = 2234

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1937 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1881



to top

>emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA
          Length = 2217

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1932 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1876



to top

>emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA
          Length = 1538

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1253 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1197



to top

>emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 679 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 623



to top

>emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321



to top

>emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA
          Length = 1581

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1281 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1225



to top

>emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 746 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 690



to top

>emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA
          Length = 1226

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 948 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 892



to top

>emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA
          Length = 1296

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1005 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 949



to top

>emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA
          Length = 1467

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1170 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1114



to top

>emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA
          Length = 1580

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1282 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1226



to top

>emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA
          Length = 1459

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1167 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1111



to top

>emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 963 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 907



to top

>emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1262 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1206



to top

>emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA
          Length = 917

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 617 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 561



to top

>emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA
          Length = 2047

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1762 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1706



to top

>emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA
          Length = 1285

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1002 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 946



to top

>emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA
          Length = 1562

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1263 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1207



to top

>emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 874



to top

>emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA
          Length = 1801

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1505 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1449



to top

>emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA
          Length = 1372

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1088 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1032



to top

>emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1212 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1156



to top

>emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA
          Length = 2215

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1874



to top

>emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA
          Length = 1228

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 938 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 882



to top

>emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 954 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 898



to top

>emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 883



to top

>emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 968 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 912



to top

>emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA
          Length = 1642

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321



to top

>emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA
          Length = 2038

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1753 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1697



to top

>emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 847 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 791



to top

>emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA
          Length = 431

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78



to top

>emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA
          Length = 1937

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1640 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1584



to top

>emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1199 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1143



to top

>emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA
          Length = 1245

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 946 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 890



to top

>emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA
          Length = 1887

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1586 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1530



to top

>emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 886



to top

>emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 146 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 90



to top

>emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA
          Length = 2037

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1756 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1700



to top

>emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA
          Length = 1618

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1323 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1267



to top

>emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA
          Length = 2122

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 89/109 (81%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            ||||||||||||||||||| ||||| |||||||| |     ||||  |||||||| ||||
Sbjct: 1890 caccctggtacatcttggcaatgatagggttgcagacactttccaattccttcattttgt 1831

                                                             
Query: 299  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggat 347
            | |||||||| || ||||| ||||| |||||  |||| | |||||||||
Sbjct: 1830 cctcaaactcatctgcctctgcaagttggttgctgtctaaccactggat 1782



to top

>emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70
          Length = 2079

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 280  tccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagc 339
            |||| ||||||||||||||||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 1802 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 1743

                                                     
Query: 340  cactggatggcagcatcgatggcctcctcgatcttcttctt 380
            |||| ||| ||  |||| || || ||||| ||| |||||||
Sbjct: 1742 cacttgatagcttcatcaattgcatcctcaatcctcttctt 1702



to top

>emb|X06932.1|PHHSP70G Petunia hsp70 gene
          Length = 2958

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 280  tccagctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagc 339
            |||| ||||||||||||||||||||| || || ||||| ||||| |||||  |||| |||
Sbjct: 2678 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 2619

                                                     
Query: 340  cactggatggcagcatcgatggcctcctcgatcttcttctt 380
            |||| ||| ||  |||| || || ||||| ||| |||||||
Sbjct: 2618 cacttgatagcttcatcaattgcatcctcaatcctcttctt 2578



to top

>ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock cognate 70 kDa protein
            (LOC562935), mRNA
          Length = 2448

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                        
Query: 241  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
            |||||||||| ||||| ||||||||||||||| ||   |||||||||||||  || ||  
Sbjct: 2057 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttctgctggtgc 1998

                                                     
Query: 301  tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 341
            |||||||| |||  ||| |||  ||||||| ||||||||||
Sbjct: 1997 tcaaactcctccttctctgcagtctggttcttgtccagcca 1957



to top

>dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecular chaperone hsc70.1 -
            like, partial cds, clone: RAFL22-80-J10
          Length = 1371

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 279  ctccagctccttcatcttgtcttcaaactcgtc 311
            ||||| |||||||||||||||||||||||||||
Sbjct: 1071 ctccaactccttcatcttgtcttcaaactcgtc 1039



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||| |||||||||||||| ||||
Sbjct: 1215 ttagtcgacttcctcgatcttgggaccag 1187



to top

>gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing frame-shift errors
          Length = 1375

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 83/101 (82%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 300
           |||||||||| ||||| ||||||||||||||| ||   |||||||||||||  || ||  
Sbjct: 970 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttctgctggtgc 911

                                                    
Query: 301 tcaaactcgtccgcctcagcaagctggttcgtgtccagcca 341
           |||||||| |||  ||| |||  ||||||| ||||||||||
Sbjct: 910 tcaaactcctccttctctgcagtctggttcttgtccagcca 870



to top

>emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock protein 70 isoform-1
          Length = 2370

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 91/112 (81%)
 Strand = Plus / Minus

                                                                        
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 294
            |||||||| || |||||||| || | |||||||||||| |    ||| ||||||||||| 
Sbjct: 2055 ccagcaccttgatacatcttagcaacgatggggttgcaaatactctcaagctccttcatt 1996

                                                                
Query: 295  ttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactgga 346
            || ||||| ||||| || || |||||||| |||||  |||| ||||||||||
Sbjct: 1995 ttatcttcgaactcatcagcttcagcaagttggttgttgtcaagccactgga 1944



to top

>emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA
          Length = 1839

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 236  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            |||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1541 cagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1486



to top

>emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcaca 274
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcaca 1901



to top

>emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA
          Length = 2204

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcaca 274
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1922 ccagcactctggtacatctttgtgatgatggggttgcaca 1883



to top

>emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcaca 274
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1274 ccagcactctggtacatctttgtgatgatggggttgcaca 1235



to top

>emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA
          Length = 1198

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 235 ccagcaccctggtacatcttggcgatgatggggttgcaca 274
           ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 902 ccagcactctggtacatctttgtgatgatggggttgcaca 863



to top

>gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds
          Length = 2161

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 241  ccctggtacatcttggcgatgatggggttgca 272
            |||||||||||||||| |||||||||||||||
Sbjct: 1953 ccctggtacatcttggtgatgatggggttgca 1922



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 150  tgtttagtcgacctcctcgat 170
            |||||||||||||||||||||
Sbjct: 2074 tgtttagtcgacctcctcgat 2054



to top

>ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G12580 (HSP70) mRNA,
            complete cds
          Length = 2281

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 394  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1805 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1759



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1934 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1879



to top

>emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in linkage group 15, complete
              sequence
          Length = 205513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                 
Query: 241    ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
              |||||||||| ||||| ||||||||||||||| ||   |||||||||||||
Sbjct: 138774 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttc 138824



to top

>gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, complete cds
          Length = 1953

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            |||| |||| |||||||| ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccggcactctggtacaacttggtgatgatggggttgcacaccttctccagctccttc 1788



to top

>emb|AJ002551.1|ATAJ2551 Arabidopsis thaliana mRNA for heat shock protein 70
          Length = 2171

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 394  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1787 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1741



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1916 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1861



to top

>gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 4808

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 153  ttagtcgacctcctcgatcttggggcc 179
            |||||||||||||||||||||||||||
Sbjct: 3799 ttagtcgacctcctcgatcttggggcc 3773



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 258  gatgatggggttgcacagggcctccagctcctt 290
            ||||||||||||||||||  |||||||||||||
Sbjct: 3682 gatgatggggttgcacagcccctccagctcctt 3650



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 420  gatggtgttgcgcatgttgta 440
            |||||||||||||||||||||
Sbjct: 3520 gatggtgttgcgcatgttgta 3500



to top

>gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2250

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            |||||||||||||||||| |||||  ||||| ||||||||||    |||||||||||||
Sbjct: 1901 caccagcaccctggtacagcttggtaatgatcgggttgcacactttctccagctccttc 1843



to top

>gb|AY059885.1| Arabidopsis thaliana 70 kDa heat shock protein (T16H11.7) mRNA,
            complete cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 394  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1804 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1758



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1933 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1878



to top

>gb|AY054190.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, complete cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 394  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1804 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1758



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1933 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1878



to top

>gb|AY054183.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, complete cds
          Length = 2284

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 394  agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
            ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 1805 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 1759



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 265  gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
            |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 1934 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 1879



to top

>gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete
             sequence
          Length = 105768

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 394   agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
             ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 36057 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 36011



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                     
Query: 265   gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
             |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 36186 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 36131



to top

>gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) mRNA, complete cds
          Length = 1950

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||||| |||||| | ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccagcactctggtatagcttggtgatgatggggttgcacactttctccagctccttc 1788



to top

>dbj|AP002055.2| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T16H11
          Length = 21024

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 394   agcttggaggcgatcttctcgtccttgatggtgttgcgcatgttgta 440
             ||||| || |||||||||||||||||||| ||||| | |||||||||
Sbjct: 18872 agcttagatgcgatcttctcgtccttgatcgtgttcctcatgttgta 18918



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                     
Query: 265   gggttgcacagggcctccagctccttcatcttgtcttcaaactcgtccgcctcagc 320
             |||||||| || | ||| |||||||||||||| || || ||||| || ||||||||
Sbjct: 18743 gggttgcaaagagactcgagctccttcatcttatcctcgaactcatctgcctcagc 18798



to top

>gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hsp70a) gene,
           complete cds
          Length = 4220

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 146 cgactgtttagtcgacctcctcgatcttggggcc 179
           |||||| ||||||||||||||| |||||||||||
Sbjct: 407 cgactgcttagtcgacctcctcaatcttggggcc 440



to top

>gb|AY219845.1| Cyprinus carpio constitutive heat shock protein HSC70-2 (hsc70-2)
            mRNA, partial cds
          Length = 1935

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgca 272
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1829 ccagcactctggtacagcttggtgatgatggggttgca 1792



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 355     tcgatggcctcctcgatcttcttcttgtcg 384
               ||||||||| ||||||||||||||||||||
Sbjct: 1338539 tcgatggccgcctcgatcttcttcttgtcg 1338510



to top

>dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 70kDa protein 8
            isoform b, partial cds
          Length = 1864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgcaca 274
            |||| |||| |||||||| ||||| |||||||||||||||||
Sbjct: 1507 caccggcactctggtacagcttggtgatgatggggttgcaca 1466



to top

>gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 protein mRNA, complete cds
          Length = 2116

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 86/106 (81%)
 Strand = Plus / Minus

                                                                        
Query: 238  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 297
            ||||||||||||| ||||| |||||| |||||||| | | | || |||||||||  ||||
Sbjct: 1926 gcaccctggtacagcttggtgatgatcgggttgcagatgccttcgagctccttctgcttg 1867

                                                          
Query: 298  tcttcaaactcgtccgcctcagcaagctggttcgtgtccagccact 343
            | |||| |||| |||   || || |||||||||| ||| |||||||
Sbjct: 1866 tgttcatactcctccttgtcggcgagctggttcgagtctagccact 1821



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 150  tgtttagtcgacctcctcgat 170
            |||||||||||||||||||||
Sbjct: 2047 tgtttagtcgacctcctcgat 2027



to top

>dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cognate 70 kDa, partial
            cds
          Length = 2208

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgca 272
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1792 ccagcactctggtacagcttggtgatgatggggttgca 1755



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 355     tcgatggcctcctcgatcttcttcttgtcg 384
               ||||||||| ||||||||||||||||||||
Sbjct: 1362119 tcgatggccgcctcgatcttcttcttgtcg 1362090



to top

>gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3 mRNA, complete cds
          Length = 2314

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                        
Query: 239  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 298
            ||||||||||||| ||||| ||||| || ||||| | |   ||||  |||||||| || |
Sbjct: 1935 caccctggtacattttggcaatgataggattgcagacgctttccaattccttcattttat 1876

                                                             
Query: 299  cttcaaactcgtccgcctcagcaagctggttcgtgtccagccactggat 347
            | |||||||| || ||||| |||||||||||  |||||| ||| |||||
Sbjct: 1875 cctcaaactcatctgcctctgcaagctggttgctgtccaaccattggat 1827



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 152  tttagtcgacctcctcgatcttggggccag 181
            |||||||||| ||||| |||||||||||||
Sbjct: 2034 tttagtcgacttcctcaatcttggggccag 2005



to top

>gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 1974

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 243  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||||||||||  ||||| |||||||| | | ||||||||||||||
Sbjct: 1845 ctggtacatcttggtcatgatcgggttgcatatgtcctccagctccttc 1797



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 153  ttagtcgacctcctcgatcttggg 176
            ||||||||||||||||| ||||||
Sbjct: 1974 ttagtcgacctcctcgaccttggg 1951



to top

>gb|AY524794.1| Thellungiella halophila heat shock cognate protein 70 (hsc70) mRNA,
            complete cds
          Length = 2208

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 157/201 (78%)
 Strand = Plus / Minus

                                                                        
Query: 250  atcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaaactcg 309
            |||||||| ||||| |||||||| | |  |||||  |||||||||||| |||| ||||| 
Sbjct: 1886 atcttggcaatgattgggttgcaaatgctctccaattccttcatcttggcttcgaactca 1827

                                                                        
Query: 310  tccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcctcg 369
            || |||||||| | ||||||    || ||||||||||| ||    || || |  ||||||
Sbjct: 1826 tcagcctcagccaactggttaccctcgagccactggatcgcctgctcaatcgagtcctcg 1767

                                                                        
Query: 370  atcttcttcttgtcgtcggccggcagcttggaggcgatcttctcgtccttgatggtgttg 429
            |||||||||||||   | ||||| |||||     | ||||||||||||| ||||||||| 
Sbjct: 1766 atcttcttcttgtttgcagccggaagcttctcaccaatcttctcgtcctggatggtgttc 1707

                                 
Query: 430  cgcatgttgtaagagtagttc 450
            | ||||||||| | |||||||
Sbjct: 1706 ctcatgttgtaggcgtagttc 1686



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 144  atcgactgtttagtcgacctcctcgatcttggggccag 181
            |||||| | ||||||||||||||| |||||||| ||||
Sbjct: 2004 atcgacagattagtcgacctcctcaatcttgggaccag 1967



to top

>gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) mRNA, complete cds
          Length = 2652

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 152  tttagtcgacctcctcgatcttggg 176
            |||||||||||||||||||||||||
Sbjct: 2014 tttagtcgacctcctcgatcttggg 1990



to top

>emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protein 70
          Length = 2126

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 153  ttagtcgacctcctcgatcttggggccag 181
            ||||||||||||||||| |||||||||||
Sbjct: 2126 ttagtcgacctcctcgaccttggggccag 2098



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 243  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 2006 ctggtacatcttggtcatgatcgggttgcatacgctctccagctccttc 1958



to top

>emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZH03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 767

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 279 ctccagctccttcatcttgtcttcaaactcgtc 311
           ||||| ||||||||||||||||| |||||||||
Sbjct: 543 ctccaactccttcatcttgtctttaaactcgtc 511



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 152 tttagtcgacctcctcgatcttggggccagg 182
           |||||||||| |||||||||||||| |||||
Sbjct: 689 tttagtcgacttcctcgatcttgggaccagg 659



to top

>emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protein 70
          Length = 554

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 153 ttagtcgacctcctcgatcttggggccag 181
           ||||||||||||||| |||||||||||||
Sbjct: 397 ttagtcgacctcctcaatcttggggccag 369



to top

>gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa protein mRNA, complete cds
          Length = 2136

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 242  cctggtacatcttggcgatgatggggttgcaca 274
            ||||||||||||| ||||| |||||||||||||
Sbjct: 1843 cctggtacatcttcgcgattatggggttgcaca 1811



to top

>gb|U08820.1|PSU08820 Pisum sativum HSP70b mRNA, partial cds
          Length = 487

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 283 agctccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccac 342
           |||||||||||||| ||||||||||| || || ||||| |  |||||  | |||| ||||
Sbjct: 409 agctccttcatcttatcttcaaactcatctgcttcagccaattggttactatccaaccac 350

                                                    
Query: 343 tggatggcagcatcgatggcctcctcgatcttcttcttgtc 383
           || || ||||| || || || || || ||||||||||||||
Sbjct: 349 tgaattgcagcctcaattgcatcatctatcttcttcttgtc 309



to top

>gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA
          Length = 2773

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2458 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2419



to top

>ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 6 (LOC504785), mRNA
          Length = 3746

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 276 ggcctccagctccttcatcttgtcttca 303
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 5 (LOC504785), mRNA
          Length = 3824

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 276 ggcctccagctccttcatcttgtcttca 303
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 4 (LOC504785), mRNA
          Length = 1229

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 276 ggcctccagctccttcatcttgtcttca 303
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 2 (LOC504785), mRNA
          Length = 3845

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 276 ggcctccagctccttcatcttgtcttca 303
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831



to top

>gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein 70 (hsp70) mRNA,
           partial cds
          Length = 821

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 152 tttagtcgacctcctcgatcttggggcc 179
           |||||||||||||||||| |||||||||
Sbjct: 814 tttagtcgacctcctcgaccttggggcc 787



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 243 ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
           ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 693 ctggtacatcttggtcatgatcgggttgcatacgttctccagctccttc 645



to top

>emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA
          Length = 1722

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 235  ccagcaccctggtacatcttggcgatgatggggttgcaca 274
            ||||||| |||||||||||| |  ||||||||||||||||
Sbjct: 1415 ccagcactctggtacatctttgtcatgatggggttgcaca 1376



to top

>ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 7 (LOC576276), mRNA
          Length = 2475

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 6 (LOC576276), mRNA
          Length = 2069

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 5 (LOC576276), mRNA
          Length = 2045

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 1 (LOC576276), mRNA
          Length = 2075

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938



to top

>ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 4 (LOC576276), mRNA
          Length = 1449

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1357 caccagcagcttggtacatcttggtgatgatgggggtgca 1318



to top

>ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 3 (LOC576276), mRNA
          Length = 1976

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1887 caccagcagcttggtacatcttggtgatgatgggggtgca 1848



to top

>emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6
          Length = 3758

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 152  tttagtcgacctcctcgatcttggggcc 179
            |||||||||||||||||| |||||||||
Sbjct: 2265 tttagtcgacctcctcgaccttggggcc 2238



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 243  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 291
            ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 2144 ctggtacatcttggtcatgatcgggttgcatacgctctccagctccttc 2096



to top

>emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognate 70
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 243  ctggtacatcttggcgatgatggggttgcaca 274
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851



to top

>emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1
          Length = 1119

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 152 tttagtcgacctcctcgatcttggggcc 179
           |||||||||||||||||| |||||||||
Sbjct: 64  tttagtcgacctcctcgaccttggggcc 37



to top

>ref|NM_176503.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RF,
            transcript variant F (Hsc70-4), mRNA
          Length = 2362

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2062 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2023



to top

>ref|NM_176502.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RE,
            transcript variant E (Hsc70-4), mRNA
          Length = 2287

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1987 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1948



to top

>ref|NM_169627.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RD,
            transcript variant D (Hsc70-4), mRNA
          Length = 2355

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2055 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2016



to top

>ref|NM_169626.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RC,
            transcript variant C (Hsc70-4), mRNA
          Length = 2283

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1983 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1944



to top

>ref|NM_169625.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RB,
            transcript variant B (Hsc70-4), mRNA
          Length = 2342

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2042 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2003



to top

>dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock protein, complete cds
          Length = 2269

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 243  ctggtacatcttggcgatgatggggttgcaca 274
            |||||||| ||||| |||||||||||||||||
Sbjct: 1962 ctggtacagcttggtgatgatggggttgcaca 1931



to top

>ref|NM_079632.4| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RA,
            transcript variant A (Hsc70-4), mRNA
          Length = 2413

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2113 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2074



to top

>gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA
          Length = 2425

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2112 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2073



to top

>ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing factor 3B subunit 2
           (Spliceosome associated protein 145) (SAP 145) (SF3b150)
           (Pre-mRNA splicing factor SF3b 145 kDa subunit)
           (LOC570994), partial mRNA
          Length = 858

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 353 catcgatggcctcctcgatcttcttctt 380
           |||| |||||||||||||||||||||||
Sbjct: 562 catccatggcctcctcgatcttcttctt 535



to top

>ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing factor 3B subunit 2
           (Spliceosome associated protein 145) (SAP 145) (SF3b150)
           (Pre-mRNA splicing factor SF3b 145 kDa subunit)
           (LOC567725), mRNA
          Length = 462

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 353 catcgatggcctcctcgatcttcttctt 380
           |||| |||||||||||||||||||||||
Sbjct: 133 catccatggcctcctcgatcttcttctt 106



to top

>gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene
          Length = 4730

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 4195 caccagcactctggtacagcttggtaatgatggggttgca 4156



to top

>gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88E-88E, BAC clone
              BACR32A03, complete sequence
          Length = 182601

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                      
Query: 151    gtttagtcgacctcctcgatcttggggccagggccgccgg 190
              ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 156340 gtttagtcgacctcctcgatggtggggccagcaccgccgg 156301



to top

>emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7
          Length = 747

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 243 ctggtacatcttggcgatgatggggttgcaca 274
           |||||||| ||||| |||||||||||||||||
Sbjct: 351 ctggtacagcttggtgatgatggggttgcaca 320



to top

>gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, region 88E-88F, BAC clone
            BACR13A02, complete sequence
          Length = 166141

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 5374 gtttagtcgacctcctcgatggtggggccagcaccgccgg 5335



to top

>ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 243  ctggtacatcttggcgatgatggggttgcaca 274
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851



to top

>emb|X95688.1|ACHSP70HM A.cepa mRNA for heat shock protein 70-like protein
          Length = 396

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 77/95 (81%)
 Strand = Plus / Minus

                                                                       
Query: 286 tccttcatcttgtcttcaaactcgtccgcctcagcaagctggttcgtgtccagccactgg 345
           ||||||| |||||| ||||||||  | |||||||| | ||||||  | |||| |||||| 
Sbjct: 291 tccttcancttgtcatcaaactcagcagcctcagccaactggttgttatccaaccactga 232

                                              
Query: 346 atggcagcatcgatggcctcctcgatcttcttctt 380
           || ||  |||| || |||||||| |||||||||||
Sbjct: 231 atcgcctcatctatagcctcctctatcttcttctt 197



to top

>gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46 of 118 of the
             complete sequence
          Length = 236375

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 151   gtttagtcgacctcctcgatcttggggccagggccgccgg 190
             ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 49806 gtttagtcgacctcctcgatggtggggccagcaccgccgg 49767



to top

>gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 mRNA, partial cds
          Length = 1739

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 364  tcctcgatcttcttcttgtcgtcg 387
            ||||||||||||||||||||||||
Sbjct: 1315 tcctcgatcttcttcttgtcgtcg 1292



to top

>gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognate form of hsp70) mRNA,
            complete cds
          Length = 2243

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 233  caccagcaccctggtacatcttggcgatgatggggttgca 272
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 1895 caccagcactctggtacagcttggtaatgatggggttgca 1856



to top

>gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4) gene, exon 2
          Length = 2082

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 151  gtttagtcgacctcctcgatcttggggccagggccgccgg 190
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1983 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1944



to top

>gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytosolic isoform gene,
            partial cds
          Length = 1828

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 238  gcaccctggtacatcttggcgat 260
            |||||||||||||||||||||||
Sbjct: 1791 gcaccctggtacatcttggcgat 1769



to top

>gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic sequence
          Length = 340

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 233 caccagcaccctggtacatcttggcgatgatgggg 267
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1



to top

>gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic sequence
          Length = 343

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 233 caccagcaccctggtacatcttggcgatgatgggg 267
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1



to top

>gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 genomic sequence
          Length = 360

 Score = 46.1 bits (23), Expect = 0.098
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 233 caccagcaccctggtacatcttggcgatgatgggg 267
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 326 caccagcaccctggtatagcttggtgatgatgggg 360


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,614,032
Number of Sequences: 3902068
Number of extensions: 3614032
Number of successful extensions: 74351
Number of sequences better than 10.0: 577
Number of HSP's better than 10.0 without gapping: 582
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72499
Number of HSP's gapped (non-prelim): 1809
length of query: 451
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 429
effective length of database: 17,147,199,772
effective search space: 7356148702188
effective search space used: 7356148702188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top