>gb|AC132448.3| Mus musculus BAC clone RP23-180B23 from chromosome 8, complete sequence
          Length = 211388

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 36     aaatttgctatatgcatatgc 56
              |||||||||||||||||||||
Sbjct: 165099 aaatttgctatatgcatatgc 165079

>emb|AL590416.4| Human DNA sequence from clone RP11-89C21 on chromosome 10p13-14
             Contains the 3' end of the gene for a protein related to
             the N terminus of tre (RNTRE) (KIAA0019), gene FLJ34168, a
             novel gene and a CpG island, complete sequence
          Length = 171026

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    gaaagtaatgctaattagaa 98
             ||||||||||||||||||||
Sbjct: 40820 gaaagtaatgctaattagaa 40801

>emb|AL035414.30|HS667H12 Human DNA sequence from clone RP4-667H12 on chromosome 1q32.1-41
             Contains a novel gene, the SERTAD4 gene for SERTA domain
             containing protein 4, a processed pseudogene similar to
             putative tumor suppressor ST13, a processed pseudogene
             similar to ribonuclease H1 (RNASEH1), the 5' end of the
             gene for melanoma antigen recognized by T cells 2 (MART2)
             protein and a CpG island, complete sequence
          Length = 131239

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   tgcaaatcagatgcaaagaa 132
             ||||||||||||||||||||
Sbjct: 92548 tgcaaatcagatgcaaagaa 92567

>gb|AC152833.3| Ornithorhynchus anatinus BAC clone OABb-6A1 from chromosome unknown,
             complete sequence
          Length = 141309

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 100   ctccaggaacctttgcaaatcaga 123
             ||||||||||||||||||| ||||
Sbjct: 52281 ctccaggaacctttgcaaagcaga 52304

>gb|AC026392.7| Homo sapiens chromosome 10 clone RP11-238C10, complete sequence
          Length = 177829

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     gaaagtaatgctaattagaa 98
              ||||||||||||||||||||
Sbjct: 123952 gaaagtaatgctaattagaa 123933

>gb|AC127694.3| Mus musculus BAC clone RP23-235J3 from chromosome 7, complete sequence
          Length = 225732

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 101    tccaggaacctttgcaaat 119
              |||||||||||||||||||
Sbjct: 110939 tccaggaacctttgcaaat 110957

>gb|AC147006.18| Medicago truncatula clone mth2-62m1, complete sequence
          Length = 126833

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     ttgaatttgaaccgaaatt 40
              |||||||||||||||||||
Sbjct: 113116 ttgaatttgaaccgaaatt 113098

>emb|AL031984.13|HS173D1 Human DNA sequence from clone RP1-173D1 on chromosome 1p36.21-36.33
             Contains the 5' UTR of the gene for a novel protein
             (FLJ34970, FLJ20321) and a CpG island, complete sequence
          Length = 117338

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 111   tttgcaaatcagatgcaaa 129
             |||||||||||||||||||
Sbjct: 15780 tttgcaaatcagatgcaaa 15762

>emb|BX284619.11| Zebrafish DNA sequence from clone DKEY-251E24 in linkage group 1,
              complete sequence
          Length = 196931

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 126    caaagaagatctgcacact 144
              |||||||||||||||||||
Sbjct: 155243 caaagaagatctgcacact 155261

>gb|AC096649.1| Homo sapiens BAC clone RP11-12N7 from 2, complete sequence
          Length = 172718

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 124   tgcaaagaagatctgcaca 142
             |||||||||||||||||||
Sbjct: 84298 tgcaaagaagatctgcaca 84280


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,252,432
Number of Sequences: 3902068
Number of extensions: 1252432
Number of successful extensions: 79024
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79005
Number of HSP's gapped (non-prelim): 19
length of query: 161
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 139
effective length of database: 17,147,199,772
effective search space: 2383460768308
effective search space used: 2383460768308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)