>gb|AC122536.4| Mus musculus BAC clone RP24-542K22 from chromosome 17, complete
             sequence
          Length = 150022

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 45    tatttcatgcatgttatgaa 64
             ||||||||||||||||||||
Sbjct: 26519 tatttcatgcatgttatgaa 26500

>gb|AC122876.4| Mus musculus BAC clone RP23-113K14 from 3, complete sequence
          Length = 190123

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     gttttcttattcctaaaaca 110
              ||||||||||||||||||||
Sbjct: 154189 gttttcttattcctaaaaca 154208

>gb|AC119847.12| Mus musculus chromosome 3, clone RP23-46L5, complete sequence
          Length = 227081

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    gttttcttattcctaaaaca 110
             ||||||||||||||||||||
Sbjct: 29197 gttttcttattcctaaaaca 29216

>emb|AL358913.4|CNS05TEE Human chromosome 14 DNA sequence BAC R-557C9 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 179862

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 95   tcttattcctaaaacatggc 114
            ||||||||||||||||||||
Sbjct: 7805 tcttattcctaaaacatggc 7824

>gb|AC163281.3| Mus musculus BAC clone RP23-443B19 from chromosome 8, complete sequence
          Length = 197609

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 90     tgttttcttattcctaaaa 108
              |||||||||||||||||||
Sbjct: 112825 tgttttcttattcctaaaa 112807

>gb|AC182659.2| Populus trichocarpa clone Pop1-125A14, complete sequence
          Length = 75970

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 85    tagcatgttttcttattcctaaa 107
             |||||||||||| ||||||||||
Sbjct: 14312 tagcatgttttcctattcctaaa 14334

>emb|AL109822.1|SPBC409 S.pombe chromosome II cosmid c409
          Length = 44865

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 86    agcatgttttcttattcct 104
             |||||||||||||||||||
Sbjct: 43332 agcatgttttcttattcct 43314

>gb|AC010698.7| Drosophila melanogaster 3L BAC RP98-15K18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 174631

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                             
Query: 44     atatttcatgcatgttatgaacctagcaaga 74
              |||||||||||| ||||||||  ||||||||
Sbjct: 149158 atatttcatgcaagttatgaatatagcaaga 149188

>gb|AC105263.2| Drosophila melanogaster 3L BAC RP98-48G3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 153440

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                             
Query: 44     atatttcatgcatgttatgaacctagcaaga 74
              |||||||||||| ||||||||  ||||||||
Sbjct: 137212 atatttcatgcaagttatgaatatagcaaga 137182

>gb|AC079319.19| Homo sapiens 12q BAC RP11-118A3 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 152449

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 71    aagagcaagagtggtagca 89
             |||||||||||||||||||
Sbjct: 94340 aagagcaagagtggtagca 94358

>ref|NM_001021382.1| Schizosaccharomyces pombe 972h- elongation factor G (SPBC409.22c),
            partial mRNA
          Length = 1677

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 86   agcatgttttcttattcct 104
            |||||||||||||||||||
Sbjct: 1534 agcatgttttcttattcct 1552

>gb|AC091696.3| Felis catus clone RP86-117J4, complete sequence
          Length = 136083

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 85    tagcatgttttcttattcc 103
             |||||||||||||||||||
Sbjct: 71651 tagcatgttttcttattcc 71669

>gb|AC096717.3| Homo sapiens BAC clone RP11-10O3 from 4, complete sequence
          Length = 109027

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 89    atgttttcttattcctaaa 107
             |||||||||||||||||||
Sbjct: 25124 atgttttcttattcctaaa 25142

>gb|AC098586.3| Homo sapiens BAC clone RP11-109F18 from 4, complete sequence
          Length = 150172

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 88    catgttttcttattcctaa 106
             |||||||||||||||||||
Sbjct: 26419 catgttttcttattcctaa 26437

>gb|AC092725.3| Homo sapiens chromosome 16 clone RP11-673P17, complete sequence
          Length = 205399

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    aaaacccatacaaaccaat 32
             |||||||||||||||||||
Sbjct: 78155 aaaacccatacaaaccaat 78173

>gb|AC026116.26| Homo sapiens 12 BAC RP11-1022B3 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 177267

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 91   gttttcttattcctaaaacatgg 113
            ||||||||||| |||||||||||
Sbjct: 9243 gttttcttatttctaaaacatgg 9265

>gb|AE003543.4| Drosophila melanogaster chromosome 3L, section 42 of 83 of the complete
              sequence
          Length = 276132

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                             
Query: 44     atatttcatgcatgttatgaacctagcaaga 74
              |||||||||||| ||||||||  ||||||||
Sbjct: 123258 atatttcatgcaagttatgaatatagcaaga 123228

>emb|AL833803.8| Mouse DNA sequence from clone RP23-244H7 on chromosome 2, complete
              sequence
          Length = 226251

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 93     tttcttattcctaaaacat 111
              |||||||||||||||||||
Sbjct: 157188 tttcttattcctaaaacat 157206

>emb|AL117187.7|CNS01DRD Human chromosome 14 DNA sequence BAC R-725G5 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 195835

 Score = 38.2 bits (19), Expect = 5.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 90    tgttttcttattcctaaaa 108
             |||||||||||||||||||
Sbjct: 79039 tgttttcttattcctaaaa 79057


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,122,858
Number of Sequences: 3902068
Number of extensions: 1122858
Number of successful extensions: 79943
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79908
Number of HSP's gapped (non-prelim): 35
length of query: 118
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 97
effective length of database: 17,151,101,840
effective search space: 1663656878480
effective search space used: 1663656878480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)