ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9p07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC080125.6| Homo sapiens BAC clone RP11-175O15 from 2, comple... 46 0.14
2emb|AL078594.36|HSDJ293L8 Human DNA sequence from clone RP1-293L... 44 0.57
3emb|CR792423.5| Zebrafish DNA sequence from clone CH211-190H10 i... 44 0.57
4gb|DQ096841.1| Xenopus laevis lapl04 mRNA, complete sequence 44 0.57
5gb|AC006284.4| Arabidopsis thaliana chromosome 2 clone T4M8 map ... 44 0.57
6gb|AC005313.3| Arabidopsis thaliana chromosome 2 clone T18E12 ma... 44 0.57
7gb|AC009222.4| Homo sapiens chromosome 17, clone RP11-429O1, com... 44 0.57
8gb|AC087714.6| Homo sapiens chromosome 17, clone RP11-167A1, com... 44 0.57
9emb|BX119902.4| Zebrafish DNA sequence from clone CH211-137I24 i... 44 0.57
10gb|AY743419.2| Palea steindachneri 12S ribosomal RNA gene, compl... 44 0.57
11dbj|AP006270.1| Adoxophyes honmai nucleopolyhedrovirus DNA, comp... 44 0.57
12gb|AC140433.3| Mus musculus BAC clone RP23-96L16 from chromosome... 42 2.3
13gb|AC122381.2| Mus musculus BAC clone RP23-477C4 from chromosome... 42 2.3
14ref|XM_660399.1| Cryptosporidium hominis TU502 hypothetical prot... 42 2.3
15emb|AL391994.28| Human DNA sequence from clone RP11-382D8 on chr... 42 2.3
16gb|AC125283.1| Homo sapiens chromosome 2 clone RP11-268N9, compl... 42 2.3
17gb|AC107211.5| Homo sapiens BAC clone RP11-268N9 from 2, complet... 42 2.3
18gb|AC153494.25| Mus musculus 10 BAC RP23-345J24 (Roswell Park Ca... 40 8.9
19gb|AC093197.2| Drosophila melanogaster clone BACR25N15, complete... 40 8.9
20ref|XM_460282.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 8.9
21gb|AY676201.1| Chinemys reevesi mitochondrion, complete genome 40 8.9
22gb|AC146228.2| Pan troglodytes BAC clone RP43-32P14 from 7, comp... 40 8.9
23gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosom... 40 8.9
24gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome... 40 8.9
25gb|AC004945.1| Homo sapiens PAC clone RP5-997N5 from 7, complete... 40 8.9
26emb|CR405694.7| Zebrafish DNA sequence from clone DKEY-21A6 in l... 40 8.9
27gb|AC092727.2| Bos taurus clone RP42-351K5, complete sequence 40 8.9
28gb|AC151481.4| Medicago truncatula clone mth2-3m11, complete seq... 40 8.9
29emb|AL357892.13| Human DNA sequence from clone RP11-707H15 on ch... 40 8.9
30gb|AC090229.15| Homo sapiens chromosome 18, clone RP11-873E20, c... 40 8.9
31gb|AC073352.22| Homo sapiens 3 BAC RP11-190C22 (Roswell Park Can... 40 8.9
32emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS... 40 8.9
33emb|AL645783.13| Mouse DNA sequence from clone RP23-459H16 on ch... 40 8.9
34emb|CR854945.5| Zebrafish DNA sequence from clone DKEY-155H10 in... 40 8.9
35emb|BX510907.15| Zebrafish DNA sequence from clone CH211-234B6 i... 40 8.9
36gb|AC090220.13| Homo sapiens chromosome 18, clone RP11-712P20, c... 40 8.9
37gb|AF411809.1| Lycopersicon esculentum BAC clone FW2.2, complete... 40 8.9
38gb|AC127020.16| Medicago truncatula clone mth2-9p1, complete seq... 40 8.9
39gb|AC114757.3| Homo sapiens BAC clone RP11-328N19 from 4, comple... 40 8.9
40emb|BX601644.6| Zebrafish DNA sequence from clone DKEY-21O13 in ... 40 8.9
41gb|AC161266.2| Mus musculus BAC clone RP23-231B13 from chromosom... 40 8.9
42emb|BX470098.15| Zebrafish DNA sequence from clone DKEY-148D16 i... 40 8.9
43gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 40 8.9
44gb|AC107672.6| Mus musculus chromosome 1, clone RP24-95P4, compl... 40 8.9
45dbj|AB012104.1| Chelonia mydas mitochondrial DNA, complete sequence 40 8.9
46dbj|AP000057.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 40 8.9
47gb|AC004735.1|AC004735 Drosophila melanogaster, chromosome 2L, r... 40 8.9
48gb|AC129882.3| Ornithorhynchus anatinus clone OA_Bb-265D21, comp... 40 8.9
49gb|AC155293.3| Mus musculus BAC clone RP24-427L24 from chromosom... 40 8.9
50gb|AC093135.2| Pan troglodytes clone RP43-100O17, complete sequence 40 8.9
51gb|AC154136.13| Mus musculus BAC RP23-184A3 (Roswell Park Cance... 40 8.9
52emb|AL928853.14| Mouse DNA sequence from clone RP23-179L7 on chr... 40 8.9
53dbj|BS000192.1| Pan troglodytes chromosome 22 clone:PTB-125M11, ... 40 8.9
54emb|BX005186.9| Zebrafish DNA sequence from clone DKEY-11N4 in l... 40 8.9
55gb|AC109224.16| Mus musculus chromosome 5, clone RP23-150I2, com... 40 8.9
56gb|AE003666.6| Drosophila melanogaster chromosome 2L, section 75... 40 8.9
57dbj|AP001721.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.9
58dbj|AP000330.3| Homo sapiens genomic DNA, chromosome 21 clone:RP... 40 8.9
59emb|CT033778.16| Mouse DNA sequence from clone RP23-424G4 on chr... 40 8.9
60gb|AC126931.4| Mus musculus BAC clone RP23-389M9 from 9, complet... 40 8.9
61emb|AL683810.10| Mouse DNA sequence from clone RP23-10L18 on chr... 40 8.9
62emb|AL669953.7| Mouse DNA sequence from clone RP23-233B9 on chro... 40 8.9
63dbj|AP000172.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 8.9 
>gb|AC080125.6| Homo sapiens BAC clone RP11-175O15 from 2, complete sequence
          Length = 81057

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 200   aaacattagaaatatacaaaatataatggag 230
             |||||||||||| ||| ||||||||||||||
Sbjct: 15005 aaacattagaaaaatataaaatataatggag 15035
to top
>emb|AL078594.36|HSDJ293L8 Human DNA sequence from clone RP1-293L8 on chromosome 6q22.2-22.33
             Contains the 3' part of a novel gene, the 5' part of a
             novel gene, the HEY2 gene for hairy/enhancer-of-split
             related with YRPW motif 2, a novel gene, the 5' part of
             the gene for endoplasmic reticulum associated protein 140
             kDa (ERAP140) (similar to nucleolar protein C7B) and four
             putative CpG islands, complete sequence
          Length = 164808

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 503   cagacaaaacaacacaggaaca 524
             ||||||||||||||||||||||
Sbjct: 83932 cagacaaaacaacacaggaaca 83953
to top
>emb|CR792423.5| Zebrafish DNA sequence from clone CH211-190H10 in linkage group 5,
              complete sequence
          Length = 154548

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 18     tagaaaatgtaatatacatcat 39
              ||||||||||||||||||||||
Sbjct: 132771 tagaaaatgtaatatacatcat 132792
to top
>gb|DQ096841.1| Xenopus laevis lapl04 mRNA, complete sequence
          Length = 1211

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 250 taagcaataagcataagcaagataga 275
           ||||||||||||||||||||| ||||
Sbjct: 672 taagcaataagcataagcaagttaga 647
to top
>gb|AC006284.4| Arabidopsis thaliana chromosome 2 clone T4M8 map CIC11A04, complete
             sequence
          Length = 89137

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 209   aaatatacaaaatataatggagacat 234
             |||||||||||||||||| |||||||
Sbjct: 69644 aaatatacaaaatataattgagacat 69669
to top
>gb|AC005313.3| Arabidopsis thaliana chromosome 2 clone T18E12 map CIC11A04, complete
            sequence
          Length = 91318

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 209  aaatatacaaaatataatggagacat 234
            |||||||||||||||||| |||||||
Sbjct: 3475 aaatatacaaaatataattgagacat 3500
to top
>gb|AC009222.4| Homo sapiens chromosome 17, clone RP11-429O1, complete sequence
          Length = 184304

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 295    agaaagttgagaaattgtaaga 316
              ||||||||||||||||||||||
Sbjct: 167017 agaaagttgagaaattgtaaga 167038
to top
>gb|AC087714.6| Homo sapiens chromosome 17, clone RP11-167A1, complete sequence
          Length = 163377

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 295    agaaagttgagaaattgtaaga 316
              ||||||||||||||||||||||
Sbjct: 158802 agaaagttgagaaattgtaaga 158781
to top
>emb|BX119902.4| Zebrafish DNA sequence from clone CH211-137I24 in linkage group 5,
              complete sequence
          Length = 170241

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 18     tagaaaatgtaatatacatcat 39
              ||||||||||||||||||||||
Sbjct: 138083 tagaaaatgtaatatacatcat 138062
to top
>gb|AY743419.2| Palea steindachneri 12S ribosomal RNA gene, complete sequence;
           mitochondrial
          Length = 972

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 246 acattaagcaataagcataagc 267
           ||||||||||||||||||||||
Sbjct: 181 acattaagcaataagcataagc 202
to top
>dbj|AP006270.1| Adoxophyes honmai nucleopolyhedrovirus DNA, complete genome
          Length = 113220

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 29/30 (96%), Gaps = 1/30 (3%)
 Strand = Plus / Minus

                                           
Query: 193   aacgataaaacattag-aaatatacaaaat 221
             |||||||||||||||| |||||||||||||
Sbjct: 72233 aacgataaaacattagtaaatatacaaaat 72204
to top
>gb|AC140433.3| Mus musculus BAC clone RP23-96L16 from chromosome 16, complete sequence
          Length = 231593

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 501   ttcagacaaaacaacacagga 521
             |||||||||||||||||||||
Sbjct: 64955 ttcagacaaaacaacacagga 64935
to top
>gb|AC122381.2| Mus musculus BAC clone RP23-477C4 from chromosome 16, complete sequence
          Length = 188889

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 501    ttcagacaaaacaacacagga 521
              |||||||||||||||||||||
Sbjct: 163043 ttcagacaaaacaacacagga 163023
to top
>ref|XM_660399.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20434)
           partial mRNA
          Length = 645

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 567 cttaacataattcatcaattt 587
           |||||||||||||||||||||
Sbjct: 201 cttaacataattcatcaattt 181
to top
>emb|AL391994.28| Human DNA sequence from clone RP11-382D8 on chromosome 1 Contains the
             5' end of the ARID4B gene for AT rich interactive domain
             4B (RBP1- like), a ribosomal protein L23a (RPL23A)
             pseudogene, ubiquitin-conjugating enzyme E2G 1 (UBC7
             homolog, C. elegans) (UBE2G10 pseudogene, the GGPS1 gene
             for geranylgeranyl diphosphate synthase 1 and two CpG
             islands, complete sequence
          Length = 142273

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 464   aaactgatcattgcaaactat 484
             |||||||||||||||||||||
Sbjct: 23411 aaactgatcattgcaaactat 23391
to top
>gb|AC125283.1| Homo sapiens chromosome 2 clone RP11-268N9, complete sequence
          Length = 78812

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   ttaaattaaaatgagatacaa 135
             |||||||||||||||||||||
Sbjct: 46855 ttaaattaaaatgagatacaa 46875
to top
>gb|AC107211.5| Homo sapiens BAC clone RP11-268N9 from 2, complete sequence
          Length = 78812

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   ttaaattaaaatgagatacaa 135
             |||||||||||||||||||||
Sbjct: 46855 ttaaattaaaatgagatacaa 46875
to top
>gb|AC153494.25| Mus musculus 10 BAC RP23-345J24 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 231991

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   catggatttaaattaaaatg 127
             ||||||||||||||||||||
Sbjct: 80038 catggatttaaattaaaatg 80019
to top
>gb|AC093197.2| Drosophila melanogaster clone BACR25N15, complete sequence
          Length = 191907

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   aaatatacaaaatataatgg 228
             ||||||||||||||||||||
Sbjct: 69928 aaatatacaaaatataatgg 69909
to top
>ref|XM_460282.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0E23925g)
            partial mRNA
          Length = 7164

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 456  ccaaaattaaactgatcatt 475
            ||||||||||||||||||||
Sbjct: 1370 ccaaaattaaactgatcatt 1351
to top
>gb|AY676201.1| Chinemys reevesi mitochondrion, complete genome
          Length = 16576

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 248 attaagcaataagcataagc 267
           ||||||||||||||||||||
Sbjct: 254 attaagcaataagcataagc 273
to top
>gb|AC146228.2| Pan troglodytes BAC clone RP43-32P14 from 7, complete sequence
          Length = 221091

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 468    tgatcattgcaaactataagaggg 491
              ||||||||||||||||||| ||||
Sbjct: 163808 tgatcattgcaaactataataggg 163831
to top
>gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosome 1, complete sequence
          Length = 188928

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 608   agactcaatgcttgccacaa 627
             ||||||||||||||||||||
Sbjct: 56605 agactcaatgcttgccacaa 56624
to top
>gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome 13, complete sequence
          Length = 221980

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 503    cagacaaaacaacacaggaa 522
              ||||||||||||||||||||
Sbjct: 216526 cagacaaaacaacacaggaa 216545
to top
>gb|AC004945.1| Homo sapiens PAC clone RP5-997N5 from 7, complete sequence
          Length = 167372

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 468    tgatcattgcaaactataagaggg 491
              ||||||||||||||||||| ||||
Sbjct: 103751 tgatcattgcaaactataataggg 103774
to top
>emb|CR405694.7| Zebrafish DNA sequence from clone DKEY-21A6 in linkage group 17,
            complete sequence
          Length = 207156

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 498  accttcagacaaaacaacac 517
            ||||||||||||||||||||
Sbjct: 9691 accttcagacaaaacaacac 9672
to top
>gb|AC092727.2| Bos taurus clone RP42-351K5, complete sequence
          Length = 163604

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 502   tcagacaaaacaacacagga 521
             ||||||||||||||||||||
Sbjct: 20122 tcagacaaaacaacacagga 20141
to top
>gb|AC151481.4| Medicago truncatula clone mth2-3m11, complete sequence
          Length = 99012

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   atttaaattaaaatgagata 132
             ||||||||||||||||||||
Sbjct: 76498 atttaaattaaaatgagata 76517
to top
>emb|AL357892.13| Human DNA sequence from clone RP11-707H15 on chromosome 6, complete
             sequence
          Length = 189876

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 205   ttagaaatatacaaaatata 224
             ||||||||||||||||||||
Sbjct: 36276 ttagaaatatacaaaatata 36295
to top
>gb|AC090229.15| Homo sapiens chromosome 18, clone RP11-873E20, complete sequence
          Length = 192106

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 575   aattcatcaatttgaattta 594
             ||||||||||||||||||||
Sbjct: 20434 aattcatcaatttgaattta 20453
to top
>gb|AC073352.22| Homo sapiens 3 BAC RP11-190C22 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 159738

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    aattaaaatgagatacaaag 137
              ||||||||||||||||||||
Sbjct: 101339 aattaaaatgagatacaaag 101358
to top
>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces
               hansenii
          Length = 2037969

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 456     ccaaaattaaactgatcatt 475
               ||||||||||||||||||||
Sbjct: 1871291 ccaaaattaaactgatcatt 1871272
to top
>emb|AL645783.13| Mouse DNA sequence from clone RP23-459H16 on chromosome 13 Contains
            the Foxc1 gene for forkhead box C1, a novel gene, the 3'
            end of the Gmds gene forGDP-mannose 4,6-dehydratase and
            two CpG islands, complete sequence
          Length = 98685

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 477  caaactataagagggacatt 496
            ||||||||||||||||||||
Sbjct: 4936 caaactataagagggacatt 4955
to top
>emb|CR854945.5| Zebrafish DNA sequence from clone DKEY-155H10 in linkage group 13,
             complete sequence
          Length = 231490

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   ataaaacattagaaatatac 216
             ||||||||||||||||||||
Sbjct: 24298 ataaaacattagaaatatac 24317
to top
>emb|BX510907.15| Zebrafish DNA sequence from clone CH211-234B6 in linkage group 5,
             complete sequence
          Length = 154591

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 336   taagactttccgcaaaagaa 355
             ||||||||||||||||||||
Sbjct: 45491 taagactttccgcaaaagaa 45510
to top
>gb|AC090220.13| Homo sapiens chromosome 18, clone RP11-712P20, complete sequence
          Length = 194334

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 575    aattcatcaatttgaattta 594
              ||||||||||||||||||||
Sbjct: 173561 aattcatcaatttgaattta 173580
to top
>gb|AF411809.1| Lycopersicon esculentum BAC clone FW2.2, complete sequence
          Length = 127892

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 112  gatttaaattaaaatgagat 131
            ||||||||||||||||||||
Sbjct: 3070 gatttaaattaaaatgagat 3089
to top
>gb|AC127020.16| Medicago truncatula clone mth2-9p1, complete sequence
          Length = 127642

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 577    ttcatcaatttgaatttaag 596
              ||||||||||||||||||||
Sbjct: 108916 ttcatcaatttgaatttaag 108935
to top
>gb|AC114757.3| Homo sapiens BAC clone RP11-328N19 from 4, complete sequence
          Length = 61528

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 495   ttgaccttcagacaaaacaa 514
             ||||||||||||||||||||
Sbjct: 12809 ttgaccttcagacaaaacaa 12790
to top
>emb|BX601644.6| Zebrafish DNA sequence from clone DKEY-21O13 in linkage group 9,
             complete sequence
          Length = 217065

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 562   ttaatcttaacataattcat 581
             ||||||||||||||||||||
Sbjct: 24911 ttaatcttaacataattcat 24892
to top
>gb|AC161266.2| Mus musculus BAC clone RP23-231B13 from chromosome 13, complete sequence
          Length = 190192

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 503    cagacaaaacaacacaggaa 522
              ||||||||||||||||||||
Sbjct: 133914 cagacaaaacaacacaggaa 133895
to top
>emb|BX470098.15| Zebrafish DNA sequence from clone DKEY-148D16 in linkage group 12,
             complete sequence
          Length = 249826

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 568   ttaacataattcatcaattt 587
             ||||||||||||||||||||
Sbjct: 16754 ttaacataattcatcaattt 16773
to top
>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome
          Length = 2174500

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 81     aaagttcacgcaaaacttga 100
              ||||||||||||||||||||
Sbjct: 535285 aaagttcacgcaaaacttga 535266
to top
>gb|AC107672.6| Mus musculus chromosome 1, clone RP24-95P4, complete sequence
          Length = 178519

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 559    atgttaatcttaacataatt 578
              ||||||||||||||||||||
Sbjct: 107419 atgttaatcttaacataatt 107438
to top
>dbj|AB012104.1| Chelonia mydas mitochondrial DNA, complete sequence
          Length = 16497

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 248 attaagcaataagcataagc 267
           ||||||||||||||||||||
Sbjct: 256 attaagcaataagcataagc 275
to top
>dbj|AP000057.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 28/28, complete
             sequence
          Length = 107897

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   cacatggatttaaattaaaa 125
             ||||||||||||||||||||
Sbjct: 17859 cacatggatttaaattaaaa 17878
to top
>gb|AC004735.1|AC004735 Drosophila melanogaster, chromosome 2L, region 38A7-38C9, P1 clone
             DS04178, complete sequence
          Length = 74534

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   aaatatacaaaatataatgg 228
             ||||||||||||||||||||
Sbjct: 54922 aaatatacaaaatataatgg 54903
to top
>gb|AC129882.3| Ornithorhynchus anatinus clone OA_Bb-265D21, complete sequence
          Length = 149952

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 436    aacataaagctcatgatcaaccaa 459
              ||||||||||||||| ||||||||
Sbjct: 121227 aacataaagctcatgctcaaccaa 121250
to top
>gb|AC155293.3| Mus musculus BAC clone RP24-427L24 from chromosome 12, complete
             sequence
          Length = 156472

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   tttgctcctatagaaagttg 303
             ||||||||||||||||||||
Sbjct: 85135 tttgctcctatagaaagttg 85116
to top
>gb|AC093135.2| Pan troglodytes clone RP43-100O17, complete sequence
          Length = 172105

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 468    tgatcattgcaaactataagaggg 491
              ||||||||||||||||||| ||||
Sbjct: 164646 tgatcattgcaaactataataggg 164669
to top
>gb|AC154136.13| Mus musculus  BAC RP23-184A3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 220233

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 456    ccaaaattaaactgatcattgcaa 479
              ||||| ||||||||||||||||||
Sbjct: 182785 ccaaatttaaactgatcattgcaa 182808
to top
>emb|AL928853.14| Mouse DNA sequence from clone RP23-179L7 on chromosome 2, complete
             sequence
          Length = 63216

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   tttgctcctatagaaagttg 303
             ||||||||||||||||||||
Sbjct: 56259 tttgctcctatagaaagttg 56240
to top
>dbj|BS000192.1| Pan troglodytes chromosome 22 clone:PTB-125M11, map 22, complete
              sequences
          Length = 189269

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    cacatggatttaaattaaaa 125
              ||||||||||||||||||||
Sbjct: 141058 cacatggatttaaattaaaa 141077
to top
>emb|BX005186.9| Zebrafish DNA sequence from clone DKEY-11N4 in linkage group 21, complete
              sequence
          Length = 119595

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 106    cacatggatttaaattaaaa 125
              ||||||||||||||||||||
Sbjct: 116148 cacatggatttaaattaaaa 116129
to top
>gb|AC109224.16| Mus musculus chromosome 5, clone RP23-150I2, complete sequence
          Length = 202994

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    tagaaatatacaaaatataa 225
              ||||||||||||||||||||
Sbjct: 100680 tagaaatatacaaaatataa 100699
to top
>gb|AE003666.6| Drosophila melanogaster chromosome 2L, section 75 of 83 of the complete
             sequence
          Length = 318277

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   aaatatacaaaatataatgg 228
             ||||||||||||||||||||
Sbjct: 88750 aaatatacaaaatataatgg 88769
to top
>dbj|AP001721.1| Homo sapiens genomic DNA, chromosome 21q, section 65/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   cacatggatttaaattaaaa 125
             ||||||||||||||||||||
Sbjct: 59730 cacatggatttaaattaaaa 59749
to top
>dbj|AP000330.3| Homo sapiens genomic DNA, chromosome 21 clone:RP1-140K16, complete
              sequence
          Length = 170368

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 106    cacatggatttaaattaaaa 125
              ||||||||||||||||||||
Sbjct: 144319 cacatggatttaaattaaaa 144338
to top
>emb|CT033778.16| Mouse DNA sequence from clone RP23-424G4 on chromosome 14, complete
             sequence
          Length = 184788

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   tttgctcctatagaaagttg 303
             ||||||||||||||||||||
Sbjct: 84667 tttgctcctatagaaagttg 84648
to top
>gb|AC126931.4| Mus musculus BAC clone RP23-389M9 from 9, complete sequence
          Length = 189423

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    tttgctcctatagaaagttg 303
              ||||||||||||||||||||
Sbjct: 162943 tttgctcctatagaaagttg 162962
to top
>emb|AL683810.10| Mouse DNA sequence from clone RP23-10L18 on chromosome 2, complete
              sequence
          Length = 186882

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 284    tttgctcctatagaaagttg 303
              ||||||||||||||||||||
Sbjct: 112251 tttgctcctatagaaagttg 112270
to top
>emb|AL669953.7| Mouse DNA sequence from clone RP23-233B9 on chromosome 4, complete
              sequence
          Length = 179680

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 215    acaaaatataatggagacat 234
              ||||||||||||||||||||
Sbjct: 103459 acaaaatataatggagacat 103478
to top
>dbj|AP000172.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
            clone B2344F14-f50E8, segment 8/9, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 106  cacatggatttaaattaaaa 125
            ||||||||||||||||||||
Sbjct: 8489 cacatggatttaaattaaaa 8508


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,218,517
Number of Sequences: 3902068
Number of extensions: 7218517
Number of successful extensions: 155287
Number of sequences better than 10.0: 63
Number of HSP's better than 10.0 without gapping: 62
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 155066
Number of HSP's gapped (non-prelim): 222
length of query: 653
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 630
effective length of database: 17,143,297,704
effective search space: 10800277553520
effective search space used: 10800277553520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top