>emb|Z68903.1|SCCPN60 S.cereale cv. Petkus "Halo" encoding cpn60
          Length = 1707

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 12   aaaacttggttcatgctaccaa 33
            |||||||||| |||||||||||
Sbjct: 1564 aaaacttggtccatgctaccaa 1543

>gb|AC022399.15| Homo sapiens chromosome 10 clone RP11-4G18, complete sequence
          Length = 173064

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acttggttcatgctacca 32
             ||||||||||||||||||
Sbjct: 88600 acttggttcatgctacca 88617

>gb|AC105925.5| Homo sapiens BAC clone RP11-753I4 from 4, complete sequence
          Length = 136197

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acttggttcatgctacca 32
             ||||||||||||||||||
Sbjct: 20364 acttggttcatgctacca 20381

>gb|AC080106.6| Homo sapiens chromosome 11, clone RP11-62J13, complete sequence
          Length = 157637

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acttggttcatgctacca 32
             ||||||||||||||||||
Sbjct: 62002 acttggttcatgctacca 62019

>gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete sequence
          Length = 201299

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aaaacttggttcatgcta 29
             ||||||||||||||||||
Sbjct: 63348 aaaacttggttcatgcta 63331

>gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete sequence
          Length = 157176

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     aaaacttggttcatgcta 29
              ||||||||||||||||||
Sbjct: 109491 aaaacttggttcatgcta 109508

>dbj|AP000893.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-659G9, complete
             sequence
          Length = 198024

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    acttggttcatgctacca 32
             ||||||||||||||||||
Sbjct: 88595 acttggttcatgctacca 88612

>dbj|AP001646.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-718B12, complete
              sequence
          Length = 182329

 Score = 36.2 bits (18), Expect = 2.9
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     acttggttcatgctacca 32
              ||||||||||||||||||
Sbjct: 181356 acttggttcatgctacca 181373


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 88,633
Number of Sequences: 3902068
Number of extensions: 88633
Number of successful extensions: 21296
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21286
Number of HSP's gapped (non-prelim): 10
length of query: 33
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 13
effective length of database: 17,155,003,908
effective search space: 223015050804
effective search space used: 223015050804
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)