ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9m17
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 46 0.15
2emb|AL691420.13| Human DNA sequence from clone RP11-352C6 on chr... 44 0.57
3dbj|AP006255.1| Homo sapiens genomic DNA, chromosome 9, clone:RP... 44 0.57
4dbj|AP006210.1| Homo sapiens genomic DNA, chromosome 9, clone:RP... 44 0.57
5dbj|AB020872.1| Homo sapiens genomic DNA of 9q32 anti-oncogene o... 44 0.57
6gb|AC159994.7| Mus musculus chromosome 7, clone RP23-368F23, com... 42 2.3
7ref|XM_949746.1| Theileria annulata strain Ankara hypothetical p... 42 2.3
8gb|AC012391.10| Homo sapiens chromosome 10 clone RP11-162A23, co... 42 2.3
9gb|L21974.1|ACSCSRC Avian sarcoma virus proviral c-src gene, com... 40 9.0
10gb|AC165409.3| Mus musculus chromosome 18, clone RP23-90F15, com... 40 9.0
11gb|AC147241.2| Mus musculus BAC clone RP23-417C21 from chromosom... 40 9.0
12ref|XM_386435.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 40 9.0
13gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome ... 40 9.0
14emb|AL136366.24| Human DNA sequence from clone RP11-413C16 on ch... 40 9.0
15gb|AC124733.4| Mus musculus BAC clone RP23-306C18 from 12, compl... 40 9.0
16ref|XM_774763.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 9.0
17gb|AC073095.4| Homo sapiens BAC clone RP11-384A20 from 7, comple... 40 9.0
18gb|AC103933.7| Mus musculus chromosome 18, clone RP23-317G9, com... 40 9.0
19emb|BX255925.17| Human DNA sequence from clone RP13-122B23 on ch... 40 9.0
20emb|AL132868.24|HSA262P20 Human DNA sequence from clone RP11-262... 40 9.0
21emb|X52822.1|MAVSCR M.auratus H-19 proviral sequence (LTR,v-3scr... 40 9.0
22emb|X84074.1|RSVPP62V8 Rous sarcoma virus pp62v-src gene 40 9.0
23emb|X84073.1|RSVSRCHM Rous sarcoma virus srcHM gene 40 9.0
24emb|X68524.1|RSVSEQ Rous Sarcoma Virus (duck adapted) sequence o... 40 9.0
25emb|X51863.1|ASVPR225T Avian Sarcoma Virus PR2257T 40 9.0
26emb|X51861.1|RSVPRSRC Duck adapted Rous sarcoma virus (Pr-RSV-C)... 40 9.0
27emb|X15345.1|RERSVH19 Hamster H-19 proviral DNA (LTR- v-src -LTR) 40 9.0
28emb|V01197.1|RERSV6 Rous sarcoma virus genome, strain Prague C (... 40 9.0
29emb|AL627271.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 9.0
30dbj|AK128153.1| Homo sapiens cDNA FLJ46276 fis, clone TESTI4029676 40 9.0
31dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 40 9.0
32gb|J02342.1|ALRCG Rous sarcoma virus - Prague C, complete genome 40 9.0
33gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome 40 9.0
34gb|AF033808.1|AF033808 Rous sarcoma virus, complete genome 40 9.0
35dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.0
36emb|V00402.1|GGCSRC Gallus gallus gene c-src producing protein p... 40 9.0
37gb|AC118137.3| Homo sapiens BAC clone RP11-427I22 from 4, comple... 40 9.0
38gb|AC105448.5| Homo sapiens BAC clone RP11-1197E19 from 4, compl... 40 9.0
39gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 9.0
40emb|AL772133.30| Zebrafish DNA sequence from clone CH211-121J5 i... 40 9.0
41emb|V01169.1|REASV5 Avian sarcoma virus src gene and part of the... 40 9.0
42emb|X14718.1|RERSVSRC Rous sarcome virus Pra src gene (pp60) 40 9.0
43dbj|AK101317.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.0
44gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 9.0
45gb|L29199.1|ALRDA2 Rous sarcoma virus (Schmidt-Ruppin A) env-src... 40 9.0
46emb|AL161851.4|CNS01RHM Human chromosome 14 DNA sequence BAC R-1... 40 9.0
47gb|AC115692.6| Mus musculus chromosome 18, clone RP23-463G11, co... 40 9.0
48gb|AF052428.1| Rous sarcoma virus strain Schmidt-Ruppin B, compl... 40 9.0
49gb|AC140553.3| Mus musculus BAC clone RP24-71M17 from 1, complet... 40 9.0
50emb|Z68276.1|HSL190B4 Human DNA sequence from clone LA04NC01-190... 40 9.0
51gb|M21526.1|ALRSRCAC Rous sarcoma virus defective mutant PR2257 ... 40 9.0
52gb|M84475.1|ALRPP60A Rous sarcoma virus phosphoprotein p60 (src)... 40 9.0
53gb|M11753.1|ALRGSRCA Rous sarcoma virus src gene, complete cds 40 9.0 
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 60      cgacatacagcacaacacaacag 82
               |||||||||||||||||||||||
Sbjct: 2034021 cgacatacagcacaacacaacag 2034043
to top
>emb|AL691420.13| Human DNA sequence from clone RP11-352C6 on chromosome 9, complete
              sequence
          Length = 175726

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 106    ttacaaaggagaaaataaaagg 127
              ||||||||||||||||||||||
Sbjct: 116725 ttacaaaggagaaaataaaagg 116746
to top
>dbj|AP006255.1| Homo sapiens genomic DNA, chromosome 9, clone:RP11-361G14, complete
              sequence
          Length = 189176

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 106    ttacaaaggagaaaataaaagg 127
              ||||||||||||||||||||||
Sbjct: 145367 ttacaaaggagaaaataaaagg 145388
to top
>dbj|AP006210.1| Homo sapiens genomic DNA, chromosome 9, clone:RP11-449F3, complete
             sequence
          Length = 165755

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 106   ttacaaaggagaaaataaaagg 127
             ||||||||||||||||||||||
Sbjct: 18793 ttacaaaggagaaaataaaagg 18814
to top
>dbj|AB020872.1| Homo sapiens genomic DNA of 9q32 anti-oncogene of flat epitherium
             cancer , segment 4/10
          Length = 100000

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 106   ttacaaaggagaaaataaaagg 127
             ||||||||||||||||||||||
Sbjct: 66492 ttacaaaggagaaaataaaagg 66513
to top
>gb|AC159994.7| Mus musculus chromosome 7, clone RP23-368F23, complete sequence
          Length = 181238

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 387   ctgggtacgtcagactgcagctttt 411
             |||||| ||||||||||||||||||
Sbjct: 66143 ctgggtgcgtcagactgcagctttt 66167
to top
>ref|XM_949746.1| Theileria annulata strain Ankara hypothetical protein (TA05330)
           partial mRNA
          Length = 1578

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 247 tcggattttttgtcgacctca 267
           |||||||||||||||||||||
Sbjct: 263 tcggattttttgtcgacctca 243
to top
>gb|AC012391.10| Homo sapiens chromosome 10 clone RP11-162A23, complete sequence
          Length = 181948

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 387   ctgggtacgtcagactgcagctttt 411
             |||||| ||||||||||||||||||
Sbjct: 59461 ctgggtgcgtcagactgcagctttt 59485
to top
>gb|L21974.1|ACSCSRC Avian sarcoma virus proviral c-src gene, complete cds, and env gene,
            untranslated region
          Length = 5188

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1658 cggcatgagaagctggttca 1677
to top
>gb|AC165409.3| Mus musculus chromosome 18, clone RP23-90F15, complete sequence
          Length = 198735

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   tagagacgaggaaatcatcg 376
             ||||||||||||||||||||
Sbjct: 55051 tagagacgaggaaatcatcg 55070
to top
>gb|AC147241.2| Mus musculus BAC clone RP23-417C21 from chromosome 12, complete sequence
          Length = 199956

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 504    ctcagagccttctgctttcc 523
              ||||||||||||||||||||
Sbjct: 110452 ctcagagccttctgctttcc 110471
to top
>ref|XM_386435.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06259.1)
            partial mRNA
          Length = 2193

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 234  ctgtcccaaatcgtcggatttttt 257
            ||||||||||||||||| ||||||
Sbjct: 1380 ctgtcccaaatcgtcggttttttt 1357
to top
>gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome 1, complete sequence
          Length = 197978

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   tacaaaggagaaaataaaag 126
             ||||||||||||||||||||
Sbjct: 41577 tacaaaggagaaaataaaag 41596
to top
>emb|AL136366.24| Human DNA sequence from clone RP11-413C16 on chromosome 9p22.3-23
             Contains the 5' end of the NFIB gene for nuclear factor
             I/B (NFIB2, NRFIB3, NFI-RED), the 5' end of a novel gene
             and 2 CpG islands, complete sequence
          Length = 120282

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   caaggtctcctacataagca 164
             ||||||||||||||||||||
Sbjct: 62028 caaggtctcctacataagca 62047
to top
>gb|AC124733.4| Mus musculus BAC clone RP23-306C18 from 12, complete sequence
          Length = 206837

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 504    ctcagagccttctgctttcc 523
              ||||||||||||||||||||
Sbjct: 175301 ctcagagccttctgctttcc 175282
to top
>ref|XM_774763.1| Giardia lamblia ATCC 50803 hypothetical protein
            (GLP_170_138692_134292) partial mRNA
          Length = 4401

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 536  gcttcacatctgccgatcca 555
            ||||||||||||||||||||
Sbjct: 2350 gcttcacatctgccgatcca 2369
to top
>gb|AC073095.4| Homo sapiens BAC clone RP11-384A20 from 7, complete sequence
          Length = 70276

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   aaaggagaaaataaaaggcaccta 133
             |||||||||||||| |||||||||
Sbjct: 30075 aaaggagaaaataagaggcaccta 30052
to top
>gb|AC103933.7| Mus musculus chromosome 18, clone RP23-317G9, complete sequence
          Length = 198626

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 357   tagagacgaggaaatcatcg 376
             ||||||||||||||||||||
Sbjct: 18062 tagagacgaggaaatcatcg 18081
to top
>emb|BX255925.17| Human DNA sequence from clone RP13-122B23 on chromosome 9, complete
             sequence
          Length = 100719

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 499   cctggctcagagccttctgc 518
             ||||||||||||||||||||
Sbjct: 23191 cctggctcagagccttctgc 23172
to top
>emb|AL132868.24|HSA262P20 Human DNA sequence from clone RP11-262P20 on chromosome 4, complete
              sequence
          Length = 193444

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 618    aacttccactggttgaagag 637
              ||||||||||||||||||||
Sbjct: 143104 aacttccactggttgaagag 143085
to top
>emb|X52822.1|MAVSCR M.auratus H-19 proviral sequence (LTR,v-3scr1,LTR)
          Length = 3775

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 2193 cggcatgagaagctggttca 2212
to top
>emb|X84074.1|RSVPP62V8 Rous sarcoma virus pp62v-src gene
          Length = 1638

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1012 cggcatgagaagctggttca 1031
to top
>emb|X84073.1|RSVSRCHM Rous sarcoma virus srcHM gene
          Length = 1641

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1012 cggcatgagaagctggttca 1031
to top
>emb|X68524.1|RSVSEQ Rous Sarcoma Virus (duck adapted) sequence of gag, pol, env and src
            genes
          Length = 9312

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 8080 cggcatgagaagctggttca 8099
to top
>emb|X51863.1|ASVPR225T Avian Sarcoma Virus PR2257T
          Length = 4503

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1658 cggcatgagaagctggttca 1677
to top
>emb|X51861.1|RSVPRSRC Duck adapted Rous sarcoma virus (Pr-RSV-C) src gene and 3'-LTR
          Length = 2545

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1233 cggcatgagaagctggttca 1252
to top
>emb|X15345.1|RERSVH19 Hamster H-19 proviral DNA (LTR- v-src -LTR)
          Length = 3123

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1782 cggcatgagaagctggttca 1801
to top
>emb|V01197.1|RERSV6 Rous sarcoma virus genome, strain Prague C (Pr-C)
          Length = 9312

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 8080 cggcatgagaagctggttca 8099
to top
>emb|AL627271.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 7/20
          Length = 233050

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 295    aaggccattacggcgtcgcg 314
              ||||||||||||||||||||
Sbjct: 158683 aaggccattacggcgtcgcg 158702
to top
>dbj|AK128153.1| Homo sapiens cDNA FLJ46276 fis, clone TESTI4029676
          Length = 2907

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 499 cctggctcagagccttctgc 518
           ||||||||||||||||||||
Sbjct: 3   cctggctcagagccttctgc 22
to top
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    acaaaggagaaaataaaagg 127
              ||||||||||||||||||||
Sbjct: 492123 acaaaggagaaaataaaagg 492104
to top
>gb|J02342.1|ALRCG Rous sarcoma virus - Prague C, complete genome
          Length = 9625

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 8313 cggcatgagaagctggttca 8332
to top
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome
          Length = 3544738

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 176    atatatgatccgaaagggttcgac 199
              |||||||||||| |||||||||||
Sbjct: 749694 atatatgatccggaagggttcgac 749671
to top
>gb|AF033808.1|AF033808 Rous sarcoma virus, complete genome
          Length = 9392

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 8080 cggcatgagaagctggttca 8099
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                    
Query: 431      ctccattctgagcaccctctaacttggtttccggcccatcagacacatggtt 482
                ||||||| |||| | |||||||||||||||  ||  ||||||| ||||||||
Sbjct: 18859615 ctccattttgagtatcctctaacttggtttttggttcatcagaaacatggtt 18859666
to top
>emb|V00402.1|GGCSRC Gallus gallus gene c-src producing protein pp60-c-src. This gene is
            homologous to the rous sarcoma virus gene v-src
          Length = 1759

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1063 cggcatgagaagctggttca 1082
to top
>gb|AC118137.3| Homo sapiens BAC clone RP11-427I22 from 4, complete sequence
          Length = 43619

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 139  gcatcacaaggtctcctacataag 162
            |||||||| |||||||||||||||
Sbjct: 5514 gcatcacagggtctcctacataag 5537
to top
>gb|AC105448.5| Homo sapiens BAC clone RP11-1197E19 from 4, complete sequence
          Length = 135594

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 618    aacttccactggttgaagag 637
              ||||||||||||||||||||
Sbjct: 117791 aacttccactggttgaagag 117810
to top
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 295     aaggccattacggcgtcgcg 314
               ||||||||||||||||||||
Sbjct: 1617270 aaggccattacggcgtcgcg 1617289
to top
>emb|AL772133.30| Zebrafish DNA sequence from clone CH211-121J5 in linkage group 9,
             complete sequence
          Length = 180967

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    atacagcacaacacaacagt 83
             ||||||||||||||||||||
Sbjct: 33231 atacagcacaacacaacagt 33250
to top
>emb|V01169.1|REASV5 Avian sarcoma virus src gene and part of the env gene
          Length = 3107

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 2074 cggcatgagaagctggttca 2093
to top
>emb|X14718.1|RERSVSRC Rous sarcome virus Pra src gene (pp60)
          Length = 1653

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1027 cggcatgagaagctggttca 1046
to top
>dbj|AK101317.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034D09, full
            insert sequence
          Length = 1751

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 431  ctccattctgagcaccctctaacttggtttccggcccatcagacacatggtt 482
            ||||||| |||| | |||||||||||||||  ||  ||||||| ||||||||
Sbjct: 1346 ctccattttgagtatcctctaacttggtttttggttcatcagaaacatggtt 1295
to top
>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 295     aaggccattacggcgtcgcg 314
               ||||||||||||||||||||
Sbjct: 1249448 aaggccattacggcgtcgcg 1249429
to top
>gb|L29199.1|ALRDA2 Rous sarcoma virus (Schmidt-Ruppin A) env-src-3'LTR
          Length = 3256

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 2074 cggcatgagaagctggttca 2093
to top
>emb|AL161851.4|CNS01RHM Human chromosome 14 DNA sequence BAC R-1078I14 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 187732

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 617   taacttccactggttgaaga 636
             ||||||||||||||||||||
Sbjct: 63366 taacttccactggttgaaga 63347
to top
>gb|AC115692.6| Mus musculus chromosome 18, clone RP23-463G11, complete sequence
          Length = 227631

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 357   tagagacgaggaaatcatcg 376
             ||||||||||||||||||||
Sbjct: 31545 tagagacgaggaaatcatcg 31526
to top
>gb|AF052428.1| Rous sarcoma virus strain Schmidt-Ruppin B, complete genome
          Length = 9396

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 8278 cggcatgagaagctggttca 8297
to top
>gb|AC140553.3| Mus musculus BAC clone RP24-71M17 from 1, complete sequence
          Length = 217538

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    tacaaaggagaaaataaaag 126
              ||||||||||||||||||||
Sbjct: 162503 tacaaaggagaaaataaaag 162522
to top
>emb|Z68276.1|HSL190B4 Human DNA sequence from clone LA04NC01-190B4 on chromosome 4,
            complete sequence
          Length = 29748

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 618  aacttccactggttgaagag 637
            ||||||||||||||||||||
Sbjct: 7917 aacttccactggttgaagag 7898
to top
>gb|M21526.1|ALRSRCAC Rous sarcoma virus defective mutant PR2257 src gene encoding p66-src
            protein, complete cds
          Length = 4413

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1658 cggcatgagaagctggttca 1677
to top
>gb|M84475.1|ALRPP60A Rous sarcoma virus phosphoprotein p60 (src) gene, complete cds and
            reverse transcriptase (pol) gene, 3' end
          Length = 2241

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 1231 cggcatgagaagctggttca 1250
to top
>gb|M11753.1|ALRGSRCA Rous sarcoma virus src gene, complete cds
          Length = 1629

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 566  cggcatgagaagctggttca 585
            ||||||||||||||||||||
Sbjct: 982  cggcatgagaagctggttca 1001


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,064,421
Number of Sequences: 3902068
Number of extensions: 5064421
Number of successful extensions: 91987
Number of sequences better than 10.0: 54
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 91805
Number of HSP's gapped (non-prelim): 183
length of query: 657
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 634
effective length of database: 17,143,297,704
effective search space: 10868850744336
effective search space used: 10868850744336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top