Clone Name	rbags9m14
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clon...	488	e-134
2	dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clon...	488	e-134
3	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	482	e-133
4	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	482	e-133
5	emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa...	482	e-133
6	gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, part...	456	e-125
7	gb|AY108123.1| Zea mays PCO067267 mRNA sequence	432	e-118
8	gb|AY105581.1| Zea mays PCO150618 mRNA sequence	353	4e-94
9	gb|AY109618.1| Zea mays CL8996_1 mRNA sequence	351	2e-93
10	ref|NM_119780.2| Arabidopsis thaliana structural constituent of ...	270	5e-69
11	emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, ...	270	5e-69
12	emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, B...	270	5e-69
13	emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BA...	270	5e-69
14	gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co...	270	5e-69
15	gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co...	270	5e-69
16	gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co...	270	5e-69
17	ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural consti...	254	3e-64
18	gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At...	254	3e-64
19	gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma...	254	3e-64
20	emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Co...	254	3e-64
21	emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Co...	254	3e-64
22	emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Co...	254	3e-64
23	gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At...	254	3e-64
24	gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete se...	244	3e-61
25	emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Co...	244	3e-61
26	emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2	240	4e-60
27	emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Co...	240	4e-60
28	emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Co...	238	2e-59
29	emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein ...	236	6e-59
30	gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protei...	230	4e-57
31	emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Co...	226	6e-56
32	emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2	214	2e-52
33	gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein ...	214	2e-52
34	gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence	210	4e-51
35	emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Co...	200	4e-48
36	emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal prote...	182	8e-43
37	gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, c...	153	7e-34
38	emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1	113	6e-22
39	emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1	113	6e-22
40	gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein...	111	3e-21
41	gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mR...	107	4e-20
42	emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1	105	2e-19
43	emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1	105	2e-19
44	emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1	105	2e-19
45	emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1	105	2e-19
46	gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA	103	6e-19
47	gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein...	103	6e-19
48	emb|CR938630.1| Single read from an extremity of a full-length c...	103	6e-19
49	emb|CR938124.1| Single read from an extremity of a full-length c...	103	6e-19
50	gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell...	103	6e-19
51	ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG...	103	6e-19
52	ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG...	103	6e-19
53	gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA	103	6e-19
54	gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA	103	6e-19
55	gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 ...	103	6e-19
56	emb|CR937651.1| Single read from an extremity of a cDNA clone ma...	101	2e-18
57	emb|CR937650.1| Single read from an extremity of a cDNA clone ma...	101	2e-18
58	emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1	101	2e-18
59	emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1	101	2e-18
60	emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1	101	2e-18
61	emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1	101	2e-18
62	emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1	101	2e-18
63	emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1	101	2e-18
64	emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1	101	2e-18
65	emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1	101	2e-18
66	emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1	101	2e-18
67	emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1	101	2e-18
68	emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1	101	2e-18
69	emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1	101	2e-18
70	emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1	101	2e-18
71	ref|NM_114978.1| Arabidopsis thaliana structural constituent of ...	100	1e-17
72	emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B...	100	1e-17
73	gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At...	100	1e-17
74	dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal pr...	100	1e-17
75	gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribo...	96	2e-16
76	emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal pr...	96	2e-16
77	gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) ge...	96	2e-16
78	gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 r...	96	2e-16
79	emb|CR937938.1| Single read from an extremity of a full-length c...	96	2e-16
80	emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1	94	6e-16
81	ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG126...	90	9e-15
82	emb|CR938631.1| Single read from an extremity of a full-length c...	90	9e-15
83	gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene e...	90	9e-15
84	gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, parti...	88	4e-14
85	gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, ...	88	4e-14
86	dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clon...	88	4e-14
87	ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA	86	1e-13
88	emb|CR380956.1| Candida glabrata strain CBS138 chromosome J comp...	86	1e-13
89	gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, pa...	86	1e-13
90	ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal ...	84	6e-13
91	gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA...	84	6e-13
92	gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal pro...	84	6e-13
93	gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal ...	82	2e-12
94	gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal ...	82	2e-12
95	emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal pro...	82	2e-12
96	gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds	80	9e-12
97	emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protei...	80	9e-12
98	gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, m...	80	9e-12
99	ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein ...	80	9e-12
100	gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal ...	78	4e-11
101	emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal...	78	4e-11
102	emb|CR938453.1| Single read from an extremity of a full-length c...	78	4e-11
103	dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase...	78	4e-11
104	emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library	78	4e-11
105	emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library	78	4e-11
106	emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library	78	4e-11
107	emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library	78	4e-11
108	emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library	78	4e-11
109	ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal ...	78	4e-11
110	emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribo...	78	4e-11
111	gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, pa...	76	1e-10
112	emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-...	76	1e-10
113	emb|BX071012.1|CNS09QYG Single read from an extremity of a full-...	76	1e-10
114	emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-...	76	1e-10
115	emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-...	76	1e-10
116	emb|BX068769.1|CNS09P85 Single read from an extremity of a full-...	76	1e-10
117	emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-...	76	1e-10
118	emb|BX067520.1|CNS09O9G Single read from an extremity of a full-...	76	1e-10
119	emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-...	76	1e-10
120	emb|BX066544.1|CNS09NIC Single read from an extremity of a full-...	76	1e-10
121	emb|BX065896.1|CNS09N0C Single read from an extremity of a full-...	76	1e-10
122	emb|BX064864.1|CNS09M7O Single read from an extremity of a full-...	76	1e-10
123	emb|BX064747.1|CNS09M4F Single read from an extremity of a full-...	76	1e-10
124	emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-...	76	1e-10
125	emb|BX063827.1|CNS09LEV Single read from an extremity of a full-...	76	1e-10
126	emb|BX063245.1|CNS09KYP Single read from an extremity of a full-...	76	1e-10
127	emb|BX063171.1|CNS09KWN Single read from an extremity of a full-...	76	1e-10
128	emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-...	76	1e-10
129	emb|BX062038.1|CNS09K16 Single read from an extremity of a full-...	76	1e-10
130	emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-...	76	1e-10
131	emb|BX061503.1|CNS09JMB Single read from an extremity of a full-...	76	1e-10
132	emb|BX061238.1|CNS09JEY Single read from an extremity of a full-...	76	1e-10
133	emb|BX060724.1|CNS09J0O Single read from an extremity of a full-...	76	1e-10
134	emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-...	76	1e-10
135	emb|BX059235.1|CNS09HVB Single read from an extremity of a full-...	76	1e-10
136	emb|BX057044.1|CNS09G6G Single read from an extremity of a full-...	76	1e-10
137	emb|BX056961.1|CNS09G45 Single read from an extremity of a full-...	76	1e-10
138	emb|BX055189.1|CNS09EQX Single read from an extremity of a full-...	76	1e-10
139	emb|BX054843.1|CNS09EHB Single read from an extremity of a full-...	76	1e-10
140	emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-...	76	1e-10
141	emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-...	76	1e-10
142	emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-...	76	1e-10
143	emb|BX054430.1|CNS09E5U Single read from an extremity of a full-...	76	1e-10
144	emb|BX054417.1|CNS09E5H Single read from an extremity of a full-...	76	1e-10
145	emb|BX054379.1|CNS09E4F Single read from an extremity of a full-...	76	1e-10
146	emb|BX053844.1|CNS09DPK Single read from an extremity of a full-...	76	1e-10
147	emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-...	76	1e-10
148	emb|BX052540.1|CNS09CPC Single read from an extremity of a full-...	76	1e-10
149	emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-...	76	1e-10
150	emb|BX051644.1|CNS09C0G Single read from an extremity of a full-...	76	1e-10
151	emb|BX051423.1|CNS09BUB Single read from an extremity of a full-...	76	1e-10
152	emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-...	76	1e-10
153	emb|BX050810.1|CNS09BDA Single read from an extremity of a full-...	76	1e-10
154	emb|BX050569.1|CNS09B6L Single read from an extremity of a full-...	76	1e-10
155	emb|BX049265.1|CNS09A6D Single read from an extremity of a full-...	76	1e-10
156	emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-...	76	1e-10
157	emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-...	76	1e-10
158	emb|BX047425.1|CNS098R9 Single read from an extremity of a full-...	76	1e-10
159	emb|BX047145.1|CNS098JH Single read from an extremity of a full-...	76	1e-10
160	emb|BX045582.1|CNS097C2 Single read from an extremity of a full-...	76	1e-10
161	emb|BX045137.1|CNS096ZP Single read from an extremity of a full-...	76	1e-10
162	emb|BX043850.1|CNS095ZY Single read from an extremity of a full-...	76	1e-10
163	emb|BX043551.1|CNS095RN Single read from an extremity of a full-...	76	1e-10
164	emb|BX041268.1|CNS09408 Single read from an extremity of a full-...	76	1e-10
165	emb|BX041134.1|CNS093WI Single read from an extremity of a full-...	76	1e-10
166	emb|BX041072.1|CNS093US Single read from an extremity of a full-...	76	1e-10
167	emb|BX040787.1|CNS093MV Single read from an extremity of a full-...	76	1e-10
168	emb|BX040786.1|CNS093MU Single read from an extremity of a full-...	76	1e-10
169	emb|BX039654.1|CNS092RE Single read from an extremity of a full-...	76	1e-10
170	emb|BX036687.1|CNS090GZ Single read from an extremity of a full-...	76	1e-10
171	emb|BX037078.1|CNS090RU Single read from an extremity of a full-...	76	1e-10
172	emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-...	76	1e-10
173	emb|BX034653.1|CNS08YWH Single read from an extremity of a full-...	76	1e-10
174	emb|BX033967.1|CNS08YDF Single read from an extremity of a full-...	76	1e-10
175	emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-...	76	1e-10
176	emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-...	76	1e-10
177	emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-...	76	1e-10
178	emb|BX032954.1|CNS08XLA Single read from an extremity of a full-...	76	1e-10
179	emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-...	76	1e-10
180	emb|BX032378.1|CNS08X5A Single read from an extremity of a full-...	76	1e-10
181	emb|BX031877.1|CNS08WRD Single read from an extremity of a full-...	76	1e-10
182	emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-...	76	1e-10
183	emb|BX031537.1|CNS08WHX Single read from an extremity of a full-...	76	1e-10
184	emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-...	76	1e-10
185	emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-...	76	1e-10
186	emb|BX030002.1|CNS08VBA Single read from an extremity of a full-...	76	1e-10
187	emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-...	76	1e-10
188	emb|BX029602.1|CNS08V06 Single read from an extremity of a full-...	76	1e-10
189	emb|BX028637.1|CNS08U9D Single read from an extremity of a full-...	76	1e-10
190	emb|BX022357.1|CNS08PEX Single read from an extremity of a full-...	76	1e-10
191	emb|BX026844.1|CNS08SVK Single read from an extremity of a full-...	76	1e-10
192	emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-...	76	1e-10
193	emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-...	76	1e-10
194	emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-...	76	1e-10
195	emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-...	76	1e-10
196	emb|BX025073.1|CNS08RID Single read from an extremity of a full-...	76	1e-10
197	emb|BX025038.1|CNS08RHE Single read from an extremity of a full-...	76	1e-10
198	emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-...	76	1e-10
199	emb|BX024670.1|CNS08R76 Single read from an extremity of a full-...	76	1e-10
200	emb|BX024145.1|CNS08QSL Single read from an extremity of a full-...	76	1e-10
201	emb|BX023815.1|CNS08QJF Single read from an extremity of a full-...	76	1e-10
202	emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-...	76	1e-10
203	emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-...	76	1e-10
204	emb|BX020305.1|CNS08NTX Single read from an extremity of a full-...	76	1e-10
205	emb|BX018974.1|CNS08MSY Single read from an extremity of a full-...	76	1e-10
206	emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-...	76	1e-10
207	emb|BX017981.1|CNS08M1D Single read from an extremity of a full-...	76	1e-10
208	emb|BX018524.1|CNS08MGG Single read from an extremity of a full-...	76	1e-10
209	emb|BX018377.1|CNS08MCD Single read from an extremity of a full-...	76	1e-10
210	emb|BX017737.1|CNS08LUL Single read from an extremity of a full-...	76	1e-10
211	emb|BX017331.1|CNS08LJB Single read from an extremity of a full-...	76	1e-10
212	emb|BX016524.1|CNS08KWW Single read from an extremity of a full-...	76	1e-10
213	emb|BX016411.1|CNS08KTR Single read from an extremity of a full-...	76	1e-10
214	emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-...	76	1e-10
215	emb|BX014218.1|CNS08J4U Single read from an extremity of a full-...	76	1e-10
216	emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-...	76	1e-10
217	emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-...	76	1e-10
218	emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-...	76	1e-10
219	emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-...	76	1e-10
220	emb|BX010378.1|CNS08G66 Single read from an extremity of a full-...	76	1e-10
221	emb|BX009864.1|CNS08FRW Single read from an extremity of a full-...	76	1e-10
222	emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-...	76	1e-10
223	emb|BX008448.1|CNS08EOK Single read from an extremity of a full-...	76	1e-10
224	emb|BX008129.1|CNS08EFP Single read from an extremity of a full-...	76	1e-10
225	emb|BX008128.1|CNS08EFO Single read from an extremity of a full-...	76	1e-10
226	emb|BX007575.1|CNS08E0B Single read from an extremity of a full-...	76	1e-10
227	emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-...	76	1e-10
228	emb|BX005817.1|CNS08CNH Single read from an extremity of a full-...	76	1e-10
229	emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library	76	1e-10
230	gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, co...	76	1e-10
231	ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416 ...	76	1e-10
232	gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal ...	74	6e-10
233	gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal ...	74	6e-10
234	gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, com...	74	6e-10
235	emb|BX046386.1|CNS097YE Single read from an extremity of a full-...	74	6e-10
236	ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g ...	72	2e-09
237	emb|AM049008.1| Biphyllus lunatus mRNA for ribosomal protein L8e...	72	2e-09
238	emb|BX054108.1|CNS09DWW Single read from an extremity of a full-...	72	2e-09
239	emb|BX007182.1|CNS08DPE Single read from an extremity of a full-...	72	2e-09
240	emb|BX005504.1|CNS08CES Single read from an extremity of a full-...	72	2e-09
241	emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	72	2e-09
242	gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon...	70	9e-09
243	gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clo...	70	9e-09
244	ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA	70	9e-09
245	ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA	70	9e-09
246	gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon...	70	9e-09
247	dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	70	9e-09
248	dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	70	9e-09
249	dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	70	9e-09
250	dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	70	9e-09
251	dbj|AK151408.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	70	9e-09
252	dbj|AK167775.1| Mus musculus cDNA, RIKEN full-length enriched li...	70	9e-09
253	dbj|AK168769.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	70	9e-09
254	dbj|AK168332.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	70	9e-09
255	dbj|AK088263.1| Mus musculus 2 days neonate thymus thymic cells ...	70	9e-09
256	emb|AL111256.1|CNS0196O Botrytis cinerea strain T4 cDNA library	70	9e-09
257	gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal pro...	70	9e-09
258	dbj|AB180407.1| Plutella xylostella mRNA for Ribosomal protein L...	70	9e-09
259	dbj|AK108964.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	9e-09
260	dbj|AK108169.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	9e-09
261	gb|U67771.1|MMU67771 Mus musculus ribosomal protein L8 (RPL8) mR...	70	9e-09
262	gb|AF481057.1| Aplysia californica ribosomal protein L8 mRNA, pa...	68	3e-08
263	emb|BX060935.1|CNS09J6J Single read from an extremity of a full-...	68	3e-08
264	emb|BX063741.1|CNS09LCH Single read from an extremity of a full-...	68	3e-08
265	emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-...	68	3e-08
266	emb|BX052582.1|CNS09CQI Single read from an extremity of a full-...	68	3e-08
267	emb|BX052386.1|CNS09CL2 Single read from an extremity of a full-...	68	3e-08
268	emb|BX044908.1|CNS096TC Single read from an extremity of a full-...	68	3e-08
269	emb|BX043909.1|CNS0961L Single read from an extremity of a full-...	68	3e-08
270	emb|BX036920.1|CNS090NG Single read from an extremity of a full-...	68	3e-08
271	emb|BX025869.1|CNS08S4H Single read from an extremity of a full-...	68	3e-08
272	emb|BX022874.1|CNS08PTA Single read from an extremity of a full-...	68	3e-08
273	emb|BX021963.1|CNS08P3Z Single read from an extremity of a full-...	68	3e-08
274	emb|BX012237.1|CNS08HLT Single read from an extremity of a full-...	68	3e-08
275	emb|BX010208.1|CNS08G1G Single read from an extremity of a full-...	68	3e-08
276	emb|BX008408.1|CNS08ENG Single read from an extremity of a full-...	68	3e-08
277	emb|BX007216.1|CNS08DQC Single read from an extremity of a full-...	68	3e-08
278	emb|AJ414568.1| Paracentrotus mRNA for ribosomal protein L8 (suL...	68	3e-08
279	emb|AL115964.1|CNS01CTG Botrytis cinerea strain T4 cDNA library	68	3e-08
280	gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal pro...	68	3e-08
281	gb|AF057288.1|AF057288 Aplysia californica ribosomal protein L8 ...	68	3e-08
282	emb|BX036193.1|CNS09039 Single read from an extremity of a full-...	66	1e-07
283	gb|AF440009.1|AF440009 Talaromyces emersonii 60S ribosomal prote...	66	1e-07
284	ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predi...	64	5e-07
285	emb|BX036225.1|CNS09045 Single read from an extremity of a full-...	64	5e-07
286	emb|BX006811.1|CNS08DF3 Single read from an extremity of a full-...	64	5e-07
287	gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds	64	5e-07
288	dbj|AK175100.1| Ciona intestinalis cDNA, clone:cixxx00151, full ...	64	5e-07
289	dbj|AK175099.1| Ciona intestinalis cDNA, clone:cixxx00150, full ...	64	5e-07
290	dbj|AK174301.1| Ciona intestinalis cDNA, clone:cicl028m21, full ...	64	5e-07
291	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	64	5e-07
292	ref|XM_369754.1| Magnaporthe grisea 70-15 hypothetical protein (...	62	2e-06
293	ref|XM_322498.1| Neurospora crassa OR74A hypothetical protein ( ...	62	2e-06
294	ref|XM_952206.1| Neurospora crassa OR74A hypothetical protein ( ...	62	2e-06
295	emb|BX070723.1|CNS09QQF Single read from an extremity of a full-...	62	2e-06
296	emb|BX042526.1|CNS094Z6 Single read from an extremity of a full-...	62	2e-06
297	emb|BX035977.1|CNS08ZX9 Single read from an extremity of a full-...	62	2e-06
298	emb|BX019953.1|CNS08NK5 Single read from an extremity of a full-...	62	2e-06
299	ref|XM_628385.1| Cryptosporidium parvum Iowa II 60S ribosomal pr...	62	2e-06
300	gb|AY130440.1| Danio rerio ribosomal protein L8-like mRNA, parti...	62	2e-06
301	gb|AY130438.1| Petromyzon marinus ribosomal protein L8 mRNA, par...	62	2e-06
302	gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mR...	62	2e-06
303	gb|AY829774.1| Lonomia obliqua ribosomal protein 17 mRNA, comple...	60	8e-06
304	ref|XM_791845.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	8e-06
305	emb|BX068768.1|CNS09P84 Single read from an extremity of a full-...	60	8e-06
306	emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-...	60	8e-06
307	emb|BX064210.1|CNS09LPI Single read from an extremity of a full-...	60	8e-06
308	emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-...	60	8e-06
309	emb|BX058354.1|CNS09H6U Single read from an extremity of a full-...	60	8e-06
310	emb|BX053072.1|CNS09D44 Single read from an extremity of a full-...	60	8e-06
311	emb|BX052868.1|CNS09CYG Single read from an extremity of a full-...	60	8e-06
312	emb|BX052221.1|CNS09CGH Single read from an extremity of a full-...	60	8e-06
313	emb|BX050253.1|CNS09AXT Single read from an extremity of a full-...	60	8e-06
314	emb|BX050252.1|CNS09AXS Single read from an extremity of a full-...	60	8e-06
315	emb|BX047421.1|CNS098R5 Single read from an extremity of a full-...	60	8e-06
316	emb|BX033148.1|CNS08XQO Single read from an extremity of a full-...	60	8e-06
317	emb|BX025144.1|CNS08RKC Single read from an extremity of a full-...	60	8e-06
318	emb|BX025032.1|CNS08RH8 Single read from an extremity of a full-...	60	8e-06
319	emb|BX022054.1|CNS08P6I Single read from an extremity of a full-...	60	8e-06
320	emb|BX018523.1|CNS08MGF Single read from an extremity of a full-...	60	8e-06
321	emb|BX017330.1|CNS08LJA Single read from an extremity of a full-...	60	8e-06
322	emb|BX016910.1|CNS08L7M Single read from an extremity of a full-...	60	8e-06
323	emb|BX013459.1|CNS08IJR Single read from an extremity of a full-...	60	8e-06
324	emb|BX012210.1|CNS08HL2 Single read from an extremity of a full-...	60	8e-06
325	emb|BX010377.1|CNS08G65 Single read from an extremity of a full-...	60	8e-06
326	ref|XM_790908.1| PREDICTED: Strongylocentrotus purpuratus simila...	60	8e-06
327	ref|XM_568209.1| Cryptococcus neoformans var. neoformans JEC21 h...	58	3e-05
328	ref|NM_075539.2| Caenorhabditis elegans Ribosomal Protein, Large...	58	3e-05
329	emb|Z81453.1|CEB0250 Caenorhabditis elegans Cosmid B0250, comple...	58	3e-05
330	gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chr...	56	1e-04
331	ref|XM_654787.1| Aspergillus nidulans FGSC A4 hypothetical prote...	56	1e-04
332	ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM062...	56	1e-04
333	ref|XM_748904.1| Aspergillus fumigatus Af293 60s ribosomal prote...	56	1e-04
334	ref|XM_661983.1| Cryptosporidium hominis TU502 60S ribosomal pro...	56	1e-04
335	emb|BX057209.1|CNS09GB1 Single read from an extremity of a full-...	56	1e-04
336	emb|BX034140.1|CNS08YI8 Single read from an extremity of a full-...	56	1e-04
337	emb|BX008695.1|CNS08EVF Single read from an extremity of a full-...	56	1e-04
338	emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chrom...	56	1e-04
339	dbj|AB010072.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	56	1e-04
340	gb|BC059744.1| Xenopus tropicalis 60S ribosomal protein L8, mRNA...	54	5e-04
341	ref|XM_387107.1| Gibberella zeae PH-1 chromosome 4 hypothetical ...	54	5e-04
342	gb|BC043823.1| Xenopus laevis ribosomal protein L8, mRNA (cDNA c...	54	5e-04
343	ref|XM_773289.1| Giardia lamblia ATCC 50803 60S ribosomal protei...	54	5e-04
344	emb|BX036686.1|CNS090GY Single read from an extremity of a full-...	54	5e-04
345	gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	54	5e-04
346	ref|NM_001026174.2| Caenorhabditis elegans B0250.3 (B0250.3) mRN...	54	5e-04
347	ref|NM_203594.1| Xenopus tropicalis 60S ribosomal protein L8 (MG...	54	5e-04
348	dbj|AB089491.1| Giardia intestinalis gene for ribosomal protein ...	54	5e-04
349	ref|NM_209322.1| Eremothecium gossypii ADL127Cp (ADL127C), mRNA	54	5e-04
350	emb|CR760793.2| Xenopus tropicalis finished cDNA, clone TTpA008p15	54	5e-04
351	gb|DQ206502.1| Priapulus caudatus isolate TOA23 ribosomal protei...	54	5e-04
352	gb|U00920.1|U00920 Xenopus laevis ribosomal protein L8 mRNA, com...	54	5e-04
353	ref|NM_001034916.2| Rattus norvegicus ribosomal protein L8 (Rpl8...	52	0.002
354	emb|BX071011.1|CNS09QYF Single read from an extremity of a full-...	52	0.002
355	emb|BX070722.1|CNS09QQE Single read from an extremity of a full-...	52	0.002
356	emb|BX066503.1|CNS09NH7 Single read from an extremity of a full-...	52	0.002
357	emb|BX065895.1|CNS09N0B Single read from an extremity of a full-...	52	0.002
358	emb|BX065161.1|CNS09MFX Single read from an extremity of a full-...	52	0.002
359	emb|BX062637.1|CNS09KHT Single read from an extremity of a full-...	52	0.002
360	emb|BX059791.1|CNS09IAR Single read from an extremity of a full-...	52	0.002
361	emb|BX056960.1|CNS09G44 Single read from an extremity of a full-...	52	0.002
362	emb|BX055357.1|CNS09EVL Single read from an extremity of a full-...	52	0.002
363	emb|BX054429.1|CNS09E5T Single read from an extremity of a full-...	52	0.002
364	emb|BX053843.1|CNS09DPJ Single read from an extremity of a full-...	52	0.002
365	emb|BX044907.1|CNS096TB Single read from an extremity of a full-...	52	0.002
366	emb|BX043550.1|CNS095RM Single read from an extremity of a full-...	52	0.002
367	emb|BX033966.1|CNS08YDE Single read from an extremity of a full-...	52	0.002
368	emb|BX030001.1|CNS08VB9 Single read from an extremity of a full-...	52	0.002
369	emb|BX026788.1|CNS08SU0 Single read from an extremity of a full-...	52	0.002
370	emb|BX019695.1|CNS08NCZ Single read from an extremity of a full-...	52	0.002
371	emb|BX020304.1|CNS08NTW Single read from an extremity of a full-...	52	0.002
372	emb|BX018002.1|CNS08M1Y Single read from an extremity of a full-...	52	0.002
373	emb|BX015957.1|CNS08KH5 Single read from an extremity of a full-...	52	0.002
374	emb|BX009833.1|CNS08FR1 Single read from an extremity of a full-...	52	0.002
375	emb|X62145.1|RRRPL8 R.rattus mRNA for ribosomal protein L8	52	0.002
376	emb|AL031229.2|HS15D7 Human DNA sequence from clone RP1-15D7 on ...	50	0.008
377	emb|AL445067.1|TACID5 Thermoplasma acidophilum complete genome; ...	50	0.008
378	gb|AC069218.13| Homo sapiens 3 BAC RP11-393N4 (Roswell Park Canc...	50	0.008
379	emb|AL112347.1|CNS01A0Z Botrytis cinerea strain T4 cDNA library	50	0.008
380	dbj|AB011475.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	50	0.008
381	gb|CP000081.1| Leishmania major chromosome 35, complete sequence	48	0.032
382	gb|AY389974.1| Latimeria chalumnae ribosomal protein L8 mRNA, pa...	48	0.032
383	ref|XM_838156.1| Leishmania major strain Friedlin 60S ribosomal ...	48	0.032
384	ref|XM_838157.1| Leishmania major strain Friedlin 60S ribosomal ...	48	0.032
385	ref|XM_804562.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	48	0.032
386	ref|XM_805929.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	48	0.032
387	ref|XM_811273.1| Trypanosoma cruzi strain CL Brener 60S ribosoma...	48	0.032
388	gb|AY961525.1| Lysiphlebus testaceipes ribosomal protein L8 (RpL...	48	0.032
389	ref|XM_853403.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.13
390	ref|XM_853369.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.13
391	ref|XM_532360.2| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.13
392	ref|XM_761479.1| Theileria parva strain Muguga chromosome 1 60S ...	46	0.13
393	ref|XM_719533.1| Plasmodium yoelii yoelii str. 17XNL 60S ribosom...	46	0.13
394	ref|XM_849369.1| PREDICTED: Canis familiaris similar to 60S ribo...	46	0.13
395	emb|BX012209.1|CNS08HL1 Single read from an extremity of a full-...	46	0.13
396	emb|BX571661.1| Wolinella succinogenes, complete genome; segment...	46	0.13
397	dbj|AB226245.1| Aspergillus oryzae cDNA, contig sequence: AoEST3104	46	0.13
398	gb|AY967668.1| Schmidtea mediterranea clone NBE.7.02A mRNA sequence	46	0.13
399	gb|DQ206602.1| Monosiga brevicollis isolate TOA23 ribosomal prot...	46	0.13
400	gb|AY871293.1| Gekko japonicus GekBS074P mRNA, complete cds	46	0.13
401	gb|AY067189.1| Schmidtea mediterranea clone HB.15.4h unknown mRN...	46	0.13
402	ref|XM_416772.1| PREDICTED: Gallus gallus similar to 60S ribosom...	44	0.49
403	gb|AY452063.1| Rana catesbeiana ribosomal protein L8 mRNA, parti...	44	0.49
404	gb|AC098683.18| Mus musculus strain 129/Sv clone ct7-128f23 map ...	44	0.49
405	gb|AC115293.5| Mus musculus BAC clone RP23-92N2 from chromosome ...	44	0.49
406	emb|BX569793.13| Zebrafish DNA sequence from clone DKEY-183K8 in...	44	0.49
407	gb|AC098684.13| Mus musculus strain 129/Sv clone ct7-391l15 map ...	44	0.49
408	emb|BX017736.1|CNS08LUK Single read from an extremity of a full-...	44	0.49
409	emb|BX088541.17| Zebrafish DNA sequence from clone CH211-244I2 i...	44	0.49
410	emb|BX935284.2| Gallus gallus finished cDNA, clone ChEST961c19	44	0.49
411	emb|BX933795.2| Gallus gallus finished cDNA, clone ChEST911e3	44	0.49
412	emb|CR386367.1| Gallus gallus finished cDNA, clone ChEST931o12	44	0.49
413	emb|AL111994.1|CNS019R6 Botrytis cinerea strain T4 cDNA library	44	0.49
414	gb|AC156029.2| Mus musculus BAC clone RP23-42O8 from chromosome ...	44	0.49
415	emb|BX935079.1| Gallus gallus finished cDNA, clone ChEST72m12	44	0.49
416	gb|BC013104.1| Homo sapiens ribosomal protein L8, transcript var...	42	2.0
417	gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome	42	2.0
418	ref|NM_000973.3| Homo sapiens ribosomal protein L8 (RPL8), trans...	42	2.0
419	ref|NM_033301.1| Homo sapiens ribosomal protein L8 (RPL8), trans...	42	2.0
420	ref|XM_824592.1| Trypanosoma brucei TREU927 60S ribosomal protei...	42	2.0
421	gb|AY116659.1| Trimenia moorei ribosomal protein L2 (rpl2) gene,...	42	2.0
422	gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo...	42	2.0
423	gb|BC000047.2| Homo sapiens ribosomal protein L8, mRNA (cDNA clo...	42	2.0
424	gb|AE004288.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom...	42	2.0
425	gb|BC000077.2| Homo sapiens ribosomal protein L8, transcript var...	42	2.0
426	emb|BX545856.10| Zebrafish DNA sequence from clone DKEY-216E24 i...	42	2.0
427	gb|BC021069.1| Homo sapiens cDNA clone IMAGE:2964491, **** WARNI...	42	2.0
428	gb|BC021039.1| Homo sapiens cDNA clone IMAGE:2964491, **** WARNI...	42	2.0
429	gb|BC090060.1| Homo sapiens cDNA clone IMAGE:6568950, **** WARNI...	42	2.0
430	gb|BC099919.1| Homo sapiens cDNA clone IMAGE:4549190, **** WARNI...	42	2.0
431	gb|BC015588.1| Homo sapiens cDNA clone IMAGE:4643311, **** WARNI...	42	2.0
432	emb|AL356794.10| Human DNA sequence from clone RP11-551A11 on ch...	42	2.0
433	gb|BT009875.1| Synthetic construct Homo sapiens ribosomal protei...	42	2.0
434	emb|Z28407.1|HSRBPL8 H.sapiens mRNA for ribosomal protein L8	42	2.0
435	emb|CR859970.1| Pongo pygmaeus mRNA; cDNA DKFZp468G132 (from clo...	42	2.0
436	emb|CR457046.1| Homo sapiens full open reading frame cDNA clone ...	42	2.0
437	gb|BT007379.1| Homo sapiens ribosomal protein L8 mRNA, complete cds	42	2.0
438	gb|BC012197.1| Homo sapiens ribosomal protein L8, transcript var...	42	2.0
439	emb|CR615771.1| full-length cDNA clone CS0DA007YK24 of Neuroblas...	42	2.0
440	emb|CR626383.1| full-length cDNA clone CS0DC017YA07 of Neuroblas...	42	2.0
441	emb|CR625384.1| full-length cDNA clone CS0DJ005YH06 of T cells (...	42	2.0
442	emb|CR625112.1| full-length cDNA clone CS0DJ013YB05 of T cells (...	42	2.0
443	emb|CR624942.1| full-length cDNA clone CS0DB004YO19 of Neuroblas...	42	2.0
444	emb|CR623747.1| full-length cDNA clone CS0DL002YC07 of B cells (...	42	2.0
445	emb|CR623386.1| full-length cDNA clone CS0DC016YE12 of Neuroblas...	42	2.0
446	emb|CR619989.1| full-length cDNA clone CS0DI087YD17 of Placenta ...	42	2.0
447	emb|CR614795.1| full-length cDNA clone CS0DG007YO04 of B cells (...	42	2.0
448	emb|CR614597.1| full-length cDNA clone CS0DK003YN23 of HeLa cell...	42	2.0
449	emb|CR612339.1| full-length cDNA clone CS0DF019YP10 of Fetal bra...	42	2.0
450	emb|CR611740.1| full-length cDNA clone CS0DJ005YH14 of T cells (...	42	2.0
451	emb|CR610036.1| full-length cDNA clone CS0DL002YC15 of B cells (...	42	2.0
452	emb|CR607220.1| full-length cDNA clone CS0DB007YI18 of Neuroblas...	42	2.0
453	emb|CR606016.1| full-length cDNA clone CS0DJ014YC19 of T cells (...	42	2.0
454	emb|CR605549.1| full-length cDNA clone CS0DI051YJ22 of Placenta ...	42	2.0
455	emb|CR604122.1| full-length cDNA clone CS0DC004YG24 of Neuroblas...	42	2.0
456	emb|CR604065.1| full-length cDNA clone CS0DD005YI10 of Neuroblas...	42	2.0
457	emb|CR603238.1| full-length cDNA clone CL0BA003ZC08 of Placenta ...	42	2.0
458	emb|CR601765.1| full-length cDNA clone CS0DI015YA02 of Placenta ...	42	2.0
459	emb|CR601648.1| full-length cDNA clone CS0DI025YJ10 of Placenta ...	42	2.0
460	emb|CR601133.1| full-length cDNA clone CS0DB005YD21 of Neuroblas...	42	2.0
461	emb|CR599267.1| full-length cDNA clone CS0CAP005YM14 of Thymus o...	42	2.0
462	emb|CR599190.1| full-length cDNA clone CS0DK003YE12 of HeLa cell...	42	2.0
463	emb|CR599063.1| full-length cDNA clone CS0DC008YC19 of Neuroblas...	42	2.0
464	emb|CR596459.1| full-length cDNA clone CS0DK008YJ05 of HeLa cell...	42	2.0
465	emb|CR595877.1| full-length cDNA clone CS0DK006YP04 of HeLa cell...	42	2.0
466	emb|CR595000.1| full-length cDNA clone CS0DL010YC19 of B cells (...	42	2.0
467	emb|CR592009.1| full-length cDNA clone CS0DM014YC11 of Fetal liv...	42	2.0
468	emb|CR590460.1| full-length cDNA clone CS0DC024YH14 of Neuroblas...	42	2.0
469	emb|CR590177.1| full-length cDNA clone CS0DI071YE07 of Placenta ...	42	2.0
470	gb|BC093064.1| Homo sapiens ribosomal protein L8, transcript var...	42	2.0
471	gb|AY892765.1| Synthetic construct Homo sapiens clone FLH024583....	42	2.0
472	gb|AY892421.1| Synthetic construct Homo sapiens clone FLH028535....	42	2.0
473	gb|AY890288.1| Synthetic construct Homo sapiens clone FLH024588....	42	2.0
474	gb|AY890287.1| Synthetic construct Homo sapiens clone FLH024587....	42	2.0
475	gb|AY889944.1| Synthetic construct Homo sapiens clone FLH028539....	42	2.0
476	gb|DQ206527.1| Suberites fuscus isolate TOA23 ribosomal protein ...	42	2.0
477	gb|BC030151.2| Homo sapiens ribosomal protein L8, transcript var...	42	2.0
478	gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequ...	40	7.7
479	ref|XM_507655.1| PREDICTED: Pan troglodytes similar to chromosom...	40	7.7
480	gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com...	40	7.7
481	gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence	40	7.7
482	gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8...	40	7.7
483	gb|AC157554.7| Mus musculus chromosome 15, clone RP24-324P21, co...	40	7.7
484	ref|XM_458992.1| Debaryomyces hansenii CBS767 hypothetical prote...	40	7.7
485	gb|BC046005.1| Danio rerio zgc:56223, mRNA (cDNA clone MGC:56223...	40	7.7
486	ref|XM_457613.1| Debaryomyces hansenii CBS767 hypothetical prote...	40	7.7
487	ref|NM_200213.1| Danio rerio zgc:56223 (zgc:56223), mRNA	40	7.7
488	ref|NM_153256.2| Homo sapiens chromosome 10 open reading frame 4...	40	7.7
489	gb|AY813786.1| Schistosoma japonicum SJCHGC01239 protein mRNA, c...	40	7.7
490	gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com...	40	7.7
491	ref|XM_819275.1| Trypanosoma brucei TREU927 clone RPCI93-28F8 60...	40	7.7
492	gb|BC017269.2| Homo sapiens chromosome 10 open reading frame 47,...	40	7.7
493	gb|AC127677.4| Mus musculus BAC clone RP24-226C2 from chromosome...	40	7.7
494	gb|CP000107.1| Ehrlichia canis str. Jake, complete genome	40	7.7
495	emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on ch...	40	7.7
496	emb|BX022542.1|CNS08PK2 Single read from an extremity of a full-...	40	7.7
497	emb|CR628337.1| Legionella pneumophila str. Lens complete genome	40	7.7
498	emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS...	40	7.7
499	emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS...	40	7.7
500	emb|AL939128.1|SCO939128 Streptomyces coelicolor A3(2) complete ...	40	7.7

---

>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full
           insert sequence
          Length = 1037

 Score =  488 bits (246), Expect = e-134
 Identities = 368/405 (90%), Gaps = 4/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223
           |||||||||||||||||||| ||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 854 actctaagtggccttgtcggtcttggcagcggtagcggcggcctggcctctgagacgacc 795

                                                                       
Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283
           ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 794 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 735

                                                                       
Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343
           ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 734 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 675

                                                                       
Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403
           ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 674 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 615

                                                                       
Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
            |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 614 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 555

                                                                       
Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcctttgagggtg 523
           |||||||||||| ||||| |||||||| ||||||||||| ||||||||||  ||   |||
Sbjct: 554 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcc--tggatgtg 497

                                                        
Query: 524 cccgttgtcgggggttgtggctgatgacgatggcgtagtcaccgg 568
            ||||| || |||||||||||||||||||||||||||||| ||||
Sbjct: 496 -ccgttatc-ggggttgtggctgatgacgatggcgtagtcgccgg 454



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 71  accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118
           |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 958 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 911

---

>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full
           insert sequence
          Length = 1072

 Score =  488 bits (246), Expect = e-134
 Identities = 368/405 (90%), Gaps = 4/405 (0%)
 Strand = Plus / Minus

                                                                       
Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223
           |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 855 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 796

                                                                       
Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283
           ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 795 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 736

                                                                       
Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343
           ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 735 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 676

                                                                       
Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403
           |||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 675 ggccacaccacgcaccctaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 616

                                                                       
Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
            |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 615 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 556

                                                                       
Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcctttgagggtg 523
           |||||||||||| ||||| |||||||| ||||||||||| ||||||||||  ||   |||
Sbjct: 555 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcc--tggatgtg 498

                                                        
Query: 524 cccgttgtcgggggttgtggctgatgacgatggcgtagtcaccgg 568
            ||||| || |||||||||||||||||||||||||||||| ||||
Sbjct: 497 -ccgttatc-ggggttgtggctgatgacgatggcgtagtcgccgg 455



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 71  accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118
           |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 959 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 912

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  482 bits (243), Expect = e-133
 Identities = 324/351 (92%)
 Strand = Plus / Minus

                                                                            
Query: 164      actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223
                |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 23385250 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23385191

                                                                            
Query: 224      agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283
                ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 23385190 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23385131

                                                                            
Query: 284      ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343
                ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 23385130 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23385071

                                                                            
Query: 344      ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403
                ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 23385070 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23385011

                                                                            
Query: 404      accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
                 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 23385010 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 23384951

                                                                   
Query: 464      acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514
                |||||||||||| ||||| |||||||| ||||||||||| |||||||||||
Sbjct: 23384950 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcct 23384900



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                   
Query: 534      ggggttgtggctgatgacgatggcgtagtcaccgg 568
                |||||||||||||||||||||||||||||| ||||
Sbjct: 23384126 ggggttgtggctgatgacgatggcgtagtcgccgg 23384092



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 71       accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118
                |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 23385354 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23385307

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  482 bits (243), Expect = e-133
 Identities = 324/351 (92%)
 Strand = Plus / Minus

                                                                            
Query: 164      actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223
                |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 23313441 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23313382

                                                                            
Query: 224      agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283
                ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 23313381 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23313322

                                                                            
Query: 284      ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343
                ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 23313321 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23313262

                                                                            
Query: 344      ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403
                ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 23313261 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23313202

                                                                            
Query: 404      accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
                 |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 23313201 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 23313142

                                                                   
Query: 464      acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514
                |||||||||||| ||||| |||||||| ||||||||||| |||||||||||
Sbjct: 23313141 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcct 23313091



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                                   
Query: 534      ggggttgtggctgatgacgatggcgtagtcaccgg 568
                |||||||||||||||||||||||||||||| ||||
Sbjct: 23312317 ggggttgtggctgatgacgatggcgtagtcgccgg 23312283



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 71       accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118
                |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 23313545 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23313498

---

>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 162261

 Score =  482 bits (243), Expect = e-133
 Identities = 324/351 (92%)
 Strand = Plus / Plus

                                                                          
Query: 164    actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223
              |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 116909 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 116968

                                                                          
Query: 224    agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283
              ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 116969 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 117028

                                                                          
Query: 284    ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343
              ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 117029 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 117088

                                                                          
Query: 344    ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403
              ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 117089 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 117148

                                                                          
Query: 404    accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
               |||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 117149 tccagccttgagcatcggcttctcagtcctgccaccaccagcaacctgaccgatcatggc 117208

                                                                 
Query: 464    acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514
              |||||||||||| ||||| |||||||| ||||||||||| |||||||||||
Sbjct: 117209 acggcagctgctggggacaatcttcttggcaccagaggggagcttgatcct 117259



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                                 
Query: 534    ggggttgtggctgatgacgatggcgtagtcaccgg 568
              |||||||||||||||||||||||||||||| ||||
Sbjct: 118033 ggggttgtggctgatgacgatggcgtagtcgccgg 118067



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 71     accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 118
              |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 116805 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 116852

---

>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds
          Length = 270

 Score =  456 bits (230), Expect = e-125
 Identities = 260/270 (96%)
 Strand = Plus / Minus

                                                                       
Query: 167 ctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagt 226
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 270 ctaagtggccttgtcggccttggcagcagaggcggcagcctggcctctgagacgaccagt 211

                                                                       
Query: 227 cctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtgga 286
           |||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 210 cctcctagcagcgatgagaccaaccttctggccaggtggtgcatcacggcggacagtgga 151

                                                                       
Query: 287 agcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggc 346
           ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 150 agcgtgaccaatatgctggtggttacctcctccgtggggatgctccacagggttcatggc 91

                                                                       
Query: 347 cacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttacc 406
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 90  cacaccacgcaccttaggccacgagttcctcttcacacggtacttgtggtaggcgttacc 31

                                         
Query: 407 agccttcagcattggcttctcagtcctgcc 436
           |||||| |||||||||||||||||||||||
Sbjct: 30  agccttgagcattggcttctcagtcctgcc 1

---

>gb|AY108123.1| Zea mays PCO067267 mRNA sequence
          Length = 1062

 Score =  432 bits (218), Expect = e-118
 Identities = 311/342 (90%)
 Strand = Plus / Minus

                                                                       
Query: 173 ggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcct 232
           ||||||||| ||||| |||||||  || ||||| ||||| |||||||||||||| |||||
Sbjct: 876 ggccttgtcagccttggcagcagtagcagcagcttggcccctaagacgaccagttctcct 817

                                                                       
Query: 233 ggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatg 292
            || ||||| ||||||||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 816 tgcggcaataagaccaaccttctggccaggaggagcatcacggcggacagtggaggcatg 757

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 756 accaatgtgctggtggttacctcctccatgaggatgctcaacagggttcatggccacacc 697

                                                                       
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412
           ||||||||||||||||  ||||||||| || ||||||||||||||||| || ||||||||
Sbjct: 696 acgcaccttaggccagctgttcctcttgacgcggtacttgtggtaggcattgccagcctt 637

                                                                       
Query: 413 cagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagct 472
           ||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 636 cagcattggcttctcagtcctgccaccaccagcgacctgcccaatcatggcacggcagct 577

                                                     
Query: 473 gcttgggacgatcttcttagcaccagagggtagcttgatcct 514
            |||||||| |||||||||||||||||||| |||||||||||
Sbjct: 576 acttgggacaatcttcttagcaccagaggggagcttgatcct 535

---

>gb|AY105581.1| Zea mays PCO150618 mRNA sequence
          Length = 1102

 Score =  353 bits (178), Expect = 4e-94
 Identities = 310/354 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 ataactctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacg 220
           ||||||||| ||||||||||| ||||| |  || | ||| ||||| || || || || | 
Sbjct: 863 ataactctaggtggccttgtcagccttggaggctgtggcagcagcttgacccctgagcct 804

                                                                       
Query: 221 accagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaac 280
            ||||||||||| || ||||||||||||||||||||||| || || || || ||||| ||
Sbjct: 803 tccagtcctcctagcggcaatgagaccaaccttctggccagggggagcgtctcggcggac 744

                                                                       
Query: 281 agtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggtt 340
           ||| || || ||||| || || ||||||||||||||||||||||||||||| ||||||||
Sbjct: 743 agtagaggcgtgaccgatgtgttggtggttacctcctccgtggggatgctccacagggtt 684

                                                                       
Query: 341 catggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||||||||||||||||||||| ||||||  ||||||||||||||||||||||||||| ||
Sbjct: 683 catggccacaccacgcaccttgggccagctgttcctcttcacacggtacttgtggtacgc 624

                                                                       
Query: 401 gttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460
           |||||||||||| ||||| ||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 623 gttaccagccttgagcatcggcttctcagtcctgcctccaccagcaacctgcccaatcat 564

                                                                 
Query: 461 agcacggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514
           ||||||||||||||| ||||| |||||||| || |||||||| ||||| |||||
Sbjct: 563 agcacggcagctgctggggacaatcttcttggcgccagagggcagcttaatcct 510

---

>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence
          Length = 1322

 Score =  351 bits (177), Expect = 2e-93
 Identities = 348/400 (87%), Gaps = 5/400 (1%)
 Strand = Plus / Minus

                                                                       
Query: 164 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 223
           |||||| ||||||||||| ||||| |  || | ||| |||||||||||||| || |  ||
Sbjct: 864 actctaggtggccttgtcagccttggaggctgtggcagcagcctggcctctgagccttcc 805

                                                                       
Query: 224 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 283
           ||||||||| || ||||| ||||| |||||||||||       ||||| ||||| |||||
Sbjct: 804 agtcctcctagccgcaataagaccgaccttctggccannnnnagcatcgcggcggacagt 745

                                                                       
Query: 284 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 343
            || |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 744 agaggcatgaccgatatgctggtggttacctcctccgtggggatgctccacggggttcat 685

                                                                       
Query: 344 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 403
           |||||||||||| ||||| ||||||  |||||||||||||||||||||| ||||||||||
Sbjct: 684 ggccacaccacggaccttgggccagctgttcctcttcacacggtacttggggtaggcgtt 625

                                                                       
Query: 404 accagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
            |||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| ||
Sbjct: 624 gccagccttcagcatcggcttctcagtcctgccaccaccggcaacctgcccaatcatggc 565

                                                                       
Query: 464 acggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcctttgagggtg 523
           |||||||||||| ||||| || |||||||| ||||| ||||||||||||| | || ||||
Sbjct: 564 acggcagctgctggggacaattttcttagc-ccagatggtagcttgatcc-tcga-ggtg 508

                                                   
Query: 524 cccgttgtcgggggttgtggctgatgacgatggcgtagtc 563
            ||||||||  |||||||||||||| ||||||||||||||
Sbjct: 507 -ccgttgtc-agggttgtggctgatcacgatggcgtagtc 470

---

>ref|NM_119780.2| Arabidopsis thaliana structural constituent of ribosome AT4G36130
           mRNA, complete cds
          Length = 1048

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                                                       
Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561

                               
Query: 441 ccagcaacctgaccaatcat 460
           || ||||| |||||||||||
Sbjct: 560 cctgcaacttgaccaatcat 541

---

>emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 84
          Length = 195452

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                          
Query: 201    gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
              ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 170391 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 170332

                                                                          
Query: 261    ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
              |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 170331 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 170272

                                                                          
Query: 321    tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
              || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 170271 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 170212

                                                                          
Query: 381    acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
              ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 170211 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 170152

                                  
Query: 441    ccagcaacctgaccaatcat 460
              || ||||| |||||||||||
Sbjct: 170151 cctgcaacttgaccaatcat 170132

---

>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII
            project)
          Length = 94695

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                        
Query: 201  gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
            ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 3218 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 3159

                                                                        
Query: 261  ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
            |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 3158 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 3099

                                                                        
Query: 321  tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
            || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 3098 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 3039

                                                                        
Query: 381  acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
            ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 3038 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 2979

                                
Query: 441  ccagcaacctgaccaatcat 460
            || ||||| |||||||||||
Sbjct: 2978 cctgcaacttgaccaatcat 2959

---

>emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BAC clone T19K4 (ESSAII project)
          Length = 106007

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                          
Query: 201    gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
              ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 105120 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 105061

                                                                          
Query: 261    ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
              |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 105060 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 105001

                                                                          
Query: 321    tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
              || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 105000 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 104941

                                                                          
Query: 381    acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
              ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 104940 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 104881

                                  
Query: 441    ccagcaacctgaccaatcat 460
              || ||||| |||||||||||
Sbjct: 104880 cctgcaacttgaccaatcat 104861

---

>gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 1029

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                                                       
Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561

                               
Query: 441 ccagcaacctgaccaatcat 460
           || ||||| |||||||||||
Sbjct: 560 cctgcaacttgaccaatcat 541

---

>gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 972

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                                                       
Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 561

                               
Query: 441 ccagcaacctgaccaatcat 460
           || ||||| |||||||||||
Sbjct: 560 cctgcaacttgaccaatcat 541

---

>gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 777

 Score =  270 bits (136), Expect = 5e-69
 Identities = 229/260 (88%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 752 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 693

                                                                       
Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 692 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 633

                                                                       
Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 632 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 573

                                                                       
Query: 381 acacggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccacca 440
           ||||||||||||||||| |||||||||||||| ||||| |||||||| || || ||||||
Sbjct: 572 acacggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccacca 513

                               
Query: 441 ccagcaacctgaccaatcat 460
           || ||||| |||||||||||
Sbjct: 512 cctgcaacttgaccaatcat 493

---

>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome
           AT2G18020 (EMB2296) mRNA, complete cds
          Length = 968

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 578

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 577 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 518

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 517 atcttctt 510

---

>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 944

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 578

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 577 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 518

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 517 atcttctt 510

---

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Plus

                                                                         
Query: 183   gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
             ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 37736 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 37795

                                                                         
Query: 243   agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
             |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 37796 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 37855

                                                                         
Query: 303   tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
             || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 37856 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 37915

                                                                         
Query: 363   ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
             ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 37916 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 37975

                                                                         
Query: 423   ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
             |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 37976 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 38035

                     
Query: 483   atcttctt 490
             ||||||||
Sbjct: 38036 atcttctt 38043

---

>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 556

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 555 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 496

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 495 atcttctt 488

---

>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 881

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 781 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 722

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 721 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 662

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 661 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 602

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 601 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 542

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 541 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 482

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 481 atcttctt 474

---

>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 556

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 555 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 496

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 495 atcttctt 488

---

>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 858

 Score =  254 bits (128), Expect = 3e-64
 Identities = 263/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 770 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 711

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 710 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 651

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 650 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 591

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 590 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 531

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 530 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 471

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 470 atcttctt 463

---

>gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete sequence
          Length = 112635

 Score =  244 bits (123), Expect = 3e-61
 Identities = 255/299 (85%)
 Strand = Plus / Plus

                                                                          
Query: 216    agacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacgg 275
              ||||||||||||||| ||||||||||||||||||||||||| || || || |||||||| 
Sbjct: 107018 agacgaccagtcctcttggcagcaatgagaccaaccttctgtccaggaggagcatcacgt 107077

                                                                          
Query: 276    cgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaaca 335
              |  |||||    |||||||||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 107078 ctgacagtactcgcatgaccaatatgttggtgattacctcctccgtggggatgctcaact 107137

                                                                          
Query: 336    gggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtgg 395
              || ||||| || |||||||| |||||||||||| |||| |||||||| | | ||||||||
Sbjct: 107138 ggattcatagcaacaccacgaaccttaggccagcagtttctcttcactctgaacttgtgg 107197

                                                                          
Query: 396    taggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacca 455
              || || ||||||||||||| |||||||||||| || || |||||||||||||| || |||
Sbjct: 107198 taagcattaccagccttcaacattggcttctcggttcttccaccaccagcaacttgccca 107257

                                                                         
Query: 456    atcatagcacggcagctgcttgggacgatcttcttagcaccagagggtagcttgatcct 514
              ||||| || | |||    ||||| || |||||||| |||||||| || |||||||||||
Sbjct: 107258 atcatggccctgcaatcacttggaacaatcttctttgcaccagatggaagcttgatcct 107316

---

>emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 965

 Score =  244 bits (123), Expect = 3e-61
 Identities = 228/262 (87%), Gaps = 2/262 (0%)
 Strand = Plus / Minus

                                                                       
Query: 201 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 260
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||||| |  || 
Sbjct: 787 gcagcttgacctctgagacgaccagtcctccttgcagcgataagaccaaccttttttcct 728

                                                                       
Query: 261 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 320
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 727 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 668

                                                                       
Query: 321 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 380
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 667 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 608

                                                                       
Query: 381 acac--ggtacttgtggtaggcgttaccagccttcagcattggcttctcagtcctgccac 438
           ||||  ||||||||||||| |||||||||||||| ||||| |||||||| || || ||||
Sbjct: 607 acaccgggtacttgtggtatgcgttaccagccttgagcatcggcttctctgttcttccac 548

                                 
Query: 439 caccagcaacctgaccaatcat 460
           |||| ||||| |||||||||||
Sbjct: 547 cacctgcaacttgaccaatcat 526

---

>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2
          Length = 1002

 Score =  240 bits (121), Expect = 4e-60
 Identities = 241/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 834 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 775

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    |  |||||||| |||
Sbjct: 774 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggagtgaccaatgtgc 715

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 714 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 655

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 654 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 595

                                                    
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagc 463
           |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 594 ttctcagttcttccacctccagcaacttgtccaatcatagc 554

---

>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS61ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score =  240 bits (121), Expect = 4e-60
 Identities = 263/309 (85%), Gaps = 1/309 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 788 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 729

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 728 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 669

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 668 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 609

                                                                       
Query: 363 ggccaggagttcctcttcacacgg-tacttgtggtaggcgttaccagccttcagcattgg 421
           ||||| |||||||||||||||||| ||||||||||| ||||| || ||||| ||||| ||
Sbjct: 608 ggccatgagttcctcttcacacggatacttgtggtacgcgtttcctgccttgagcatcgg 549

                                                                       
Query: 422 cttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggac 481
           ||||||||| || ||||| |||||||| || ||||||||||| | ||| |  ||||||||
Sbjct: 548 cttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggac 489

                    
Query: 482 gatcttctt 490
            ||||||||
Sbjct: 488 aatcttctt 480

---

>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 901

 Score =  238 bits (120), Expect = 2e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 766 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 707

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || | |||||| | |
Sbjct: 706 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgttaccaatgttc 647

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 362
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 646 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 587

                                                                       
Query: 363 ggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggc 422
           ||||| ||||||||||||||||||||||||||||| ||||| || ||||| ||||| |||
Sbjct: 586 ggccatgagttcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcggc 527

                                                                       
Query: 423 ttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggacg 482
           |||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||| 
Sbjct: 526 ttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggaca 467

                   
Query: 483 atcttctt 490
           ||||||||
Sbjct: 466 atcttctt 459

---

>emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein L2 (rpL2 gene)
          Length = 1000

 Score =  236 bits (119), Expect = 6e-59
 Identities = 245/287 (85%)
 Strand = Plus / Minus

                                                                       
Query: 174 gccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctg 233
           ||||| || ||||| |||||||  || ||||| || ||||||||||||||||||||||| 
Sbjct: 823 gccttatcagccttggcagcagttgcagcagcttgtcctctaagacgaccagtcctccta 764

                                                                       
Query: 234 gcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatga 293
           ||||||||||||||||||||||| || || || ||||||||||  |||||    || |||
Sbjct: 763 gcagcaatgagaccaaccttctgtccaggaggagcatcacggctgacagtacttgcgtga 704

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           |||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 703 ccaatatgctggtgattacctcctccgtggggatgctcaacagggttcatagcaacacca 644

                                                                       
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 413
           || ||||| |||||| | ||||||||||| | | |||||||||| || || |||||||| 
Sbjct: 643 cgaaccttgggccagcaattcctcttcactctgaacttgtggtaagcatttccagccttg 584

                                                          
Query: 414 agcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460
           || |  ||||||||||| || || ||||| ||||| |||||||||||
Sbjct: 583 agaagaggcttctcagttctccctccacctgcaacttgaccaatcat 537

---

>gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protein L2 mRNA, partial
           cds
          Length = 644

 Score =  230 bits (116), Expect = 4e-57
 Identities = 218/252 (86%)
 Strand = Plus / Minus

                                                                       
Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274
           |||||||||||||||||| |||||||| ||||| ||||| || || ||||||||||||||
Sbjct: 480 aagacgaccagtcctccttgcagcaataagaccgaccttttgaccaggtggtgcatcacg 421

                                                                       
Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334
            || |||||   ||||||||||||||| || |||||||| || || || |||||||| ||
Sbjct: 420 acggacagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 361

                                                                       
Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394
           |||||||||||| |||||||| ||||| |||||| |||||||||| || |||||||||||
Sbjct: 360 agggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgtg 301

                                                                       
Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454
           ||| |||||||| ||||| |||||||| |||||||| |  || || |||||||| |||||
Sbjct: 300 gtatgcgttaccggccttaagcattggtttctcagtacgtcctcctccagcaacttgacc 241

                       
Query: 455 aatcatagcacg 466
           ||||||||||||
Sbjct: 240 aatcatagcacg 229

---

>emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 916

 Score =  226 bits (114), Expect = 6e-56
 Identities = 263/310 (84%), Gaps = 2/310 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 242
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 801 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 742

                                                                       
Query: 243 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 302
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 741 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 682

                                                                       
Query: 303 tggtggttacctcctccgtggggatgctc-aacagggttcatggccacaccacgcacctt 361
           || |||||||||||||| || ||||||||  || || ||||| ||||||||||| |||||
Sbjct: 681 tgatggttacctcctccatgaggatgctcgcactggattcatagccacaccacgaacctt 622

                                                                       
Query: 362 aggccaggagttcctcttcacac-ggtacttgtggtaggcgttaccagccttcagcattg 420
           |||||| |||||||||||||||| ||||||||||||| ||||| || ||||| ||||| |
Sbjct: 621 aggccatgagttcctcttcacacgggtacttgtggtacgcgtttcctgccttgagcatcg 562

                                                                       
Query: 421 gcttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttggga 480
           |||||||||| || ||||| |||||||| || ||||||||||| | ||| |  |||||||
Sbjct: 561 gcttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttggga 502

                     
Query: 481 cgatcttctt 490
           | ||||||||
Sbjct: 501 caatcttctt 492

---

>emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2
          Length = 816

 Score =  214 bits (108), Expect = 2e-52
 Identities = 216/252 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274
           |||||||||||||||||| |||||||| ||||||||||| || || || |||||||||||
Sbjct: 743 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 684

                                                                       
Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334
            || || ||    ||||||||||| || || |||||||| || || ||||||||||| ||
Sbjct: 683 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 624

                                                                       
Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394
            || ||||| || |||||||| |||||||||||| |||||||||||||||||||||| ||
Sbjct: 623 tggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 564

                                                                       
Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454
           ||| || |||||||| || |||||||| |||||||| |  || |||||||||||||||||
Sbjct: 563 gtaagcattaccagctttaagcattggtttctcagtacgccctccaccagcaacctgacc 504

                       
Query: 455 aatcatagcacg 466
           ||||||||||||
Sbjct: 503 aatcatagcacg 492

---

>gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein L2-like mRNA,
           complete cds
          Length = 899

 Score =  214 bits (108), Expect = 2e-52
 Identities = 216/252 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274
           |||||||||||||||||| |||||||| ||||||||||| || || || |||||||||||
Sbjct: 789 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 730

                                                                       
Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334
            || || ||    ||||||||||| || || |||||||| || || ||||||||||| ||
Sbjct: 729 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 670

                                                                       
Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394
            || ||||| || |||||||| |||||||||||| |||||||||||||||||||||| ||
Sbjct: 669 gggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 610

                                                                       
Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454
           ||| || |||||||| || |||||||| |||||||| |  || |||||||||||||||||
Sbjct: 609 gtaagcattaccagctttaagcattggtttctcagtacgtcctccaccagcaacctgacc 550

                       
Query: 455 aatcatagcacg 466
           ||||||||||||
Sbjct: 549 aatcatagcacg 538

---

>gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence
          Length = 983

 Score =  210 bits (106), Expect = 4e-51
 Identities = 211/246 (85%)
 Strand = Plus / Minus

                                                                       
Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274
           |||||||||||||||||| || ||||| ||||||||| | || || ||||||||||||||
Sbjct: 756 aagacgaccagtcctccttgctgcaataagaccaaccctttgcccaggtggtgcatcacg 697

                                                                       
Query: 275 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 334
            || |||||    |||||||||||||| || |||||||| || || || |||||||| ||
Sbjct: 696 acgcacagtactggcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 637

                                                                       
Query: 335 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 394
           ||| ||||| || |||||||| |||||||||||| |||||||||| || ||||| |||||
Sbjct: 636 aggattcatagcaacaccacgaaccttaggccagcagttcctcttaacgcggtatttgtg 577

                                                                       
Query: 395 gtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgacc 454
           ||| ||||||||||| || |||||||| |||||||| || || |||||||||||||||||
Sbjct: 576 gtatgcgttaccagctttaagcattggtttctcagttcttcctccaccagcaacctgacc 517

                 
Query: 455 aatcat 460
           ||||||
Sbjct: 516 aatcat 511

---

>emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZH09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 878

 Score =  200 bits (101), Expect = 4e-48
 Identities = 258/309 (83%), Gaps = 1/309 (0%)
 Strand = Plus / Minus

                                                                       
Query: 183 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaa-t 241
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| ||||||| |
Sbjct: 789 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaaat 730

                                                                       
Query: 242 gagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatg 301
            |||||||||||||| || || ||||||| ||| | || |||    || |||||||| | 
Sbjct: 729 aagaccaaccttctgtccaggaggtgcatgacgcctaagagtactggcgtgaccaatgta 670

                                                                       
Query: 302 ctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctt 361
           ||| |||||||||||||| || |||||||| || || ||||| |||||| |||| |||||
Sbjct: 669 ctgatggttacctcctccatgaggatgctccactggattcatagccacaacacgaacctt 610

                                                                       
Query: 362 aggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattgg 421
           |||||| |||| |||||||||||||||||||||||| ||||| || ||||| ||||| ||
Sbjct: 609 aggccatgagtgcctcttcacacggtacttgtggtacgcgtttcctgccttgagcatcgg 550

                                                                       
Query: 422 cttctcagtcctgccaccaccagcaacctgaccaatcatagcacggcagctgcttgggac 481
           ||||||||| || ||||| |||||||| || ||||||||||| | ||| |  ||||||||
Sbjct: 549 cttctcagttcttccacctccagcaacttgtccaatcatagccctgcatccacttgggac 490

                    
Query: 482 gatcttctt 490
            ||||||||
Sbjct: 489 aatcttctt 481

---

>emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal protein L2
          Length = 917

 Score =  182 bits (92), Expect = 8e-43
 Identities = 211/248 (85%), Gaps = 2/248 (0%)
 Strand = Plus / Minus

                                                                       
Query: 215 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 274
           ||||||||||||||||||  | ||||| ||||| ||||| || || ||||||||||| ||
Sbjct: 745 aagacgaccagtcctccttcctgcaataagaccgaccttttgaccaggtggtgcatcgcg 686

                                                                       
Query: 275 -gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaa 333
            |||| ||||   ||||||||||||||| || |||||||| || || || |||||||| |
Sbjct: 685 agcga-cagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctcca 627

                                                                       
Query: 334 cagggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgt 393
           ||||||||||||| |||||||| ||||| |||||| |||||||||| || ||||||||||
Sbjct: 626 cagggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgt 567

                                                                       
Query: 394 ggtaggcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgac 453
           |||| |||||||| ||||| |||||||| |||||||| |  || || |||||||| ||||
Sbjct: 566 ggtatgcgttaccggccttaagcattggtttctcagtacgtcctcctccagcaacttgac 507

                   
Query: 454 caatcata 461
           ||||||||
Sbjct: 506 caatcata 499

---

>gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, complete cds
          Length = 871

 Score =  153 bits (77), Expect = 7e-34
 Identities = 161/189 (85%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||||||||| | ||||||||| || |||||||| || || || |||||||| ||||||
Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctctacaggg 656

                                                                       
Query: 339 ttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtag 398
           |||||||||||||||||||||||||||||| ||||||||||||| |  ||||| ||||||
Sbjct: 655 ttcatggccacaccacgcaccttaggccagcagttcctcttcaccctatacttatggtag 596

                                                                       
Query: 399 gcgttaccagccttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatc 458
           ||   |||||||||||| || ||||| ||| | |  ||||||||||||||   |||||||
Sbjct: 595 gcacgaccagccttcaggataggcttgtcaatacgtccaccaccagcaacaataccaatc 536

                    
Query: 459 atagcacgg 467
           || ||||||
Sbjct: 535 atggcacgg 527

---

>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1
          Length = 878

 Score =  113 bits (57), Expect = 6e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 705 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 646

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||||||||| |||||| ||||
Sbjct: 645 acgcaccttgggccagcagtt 625

---

>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1
          Length = 823

 Score =  113 bits (57), Expect = 6e-22
 Identities = 75/81 (92%)
 Strand = Plus / Plus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 233

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||||||||| |||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254

---

>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete
            cds
          Length = 1718

 Score =  111 bits (56), Expect = 3e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                        
Query: 293  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
            |||||| ||||| |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1438 accaatgtgctgatggttaccaccaccgtggggatgctccacggggttcatggccacacc 1379

                                                            
Query: 353  acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
            ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 1378 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 1331

---

>gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mRNA, complete cds
          Length = 877

 Score =  107 bits (54), Expect = 4e-20
 Identities = 123/146 (84%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||||||||| | ||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctcaacaggg 656

                                                                       
Query: 339 ttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtag 398
           |||||||||||||||||||| |  |||||| |||| | ||| ||   |||||||||||| 
Sbjct: 655 ttcatggccacaccacgcacatatggccagcagtttcgcttgactttgtacttgtggtat 596

                                     
Query: 399 gcgttaccagccttcagcattggctt 424
           |||  |||||||||||| || |||||
Sbjct: 595 gcgcgaccagccttcaggatgggctt 570

---

>emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1
          Length = 867

 Score =  105 bits (53), Expect = 2e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 694 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 635

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||||||||| |||||| ||||
Sbjct: 634 acgcaccttgggccagcagtt 614

---

>emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1
          Length = 744

 Score =  105 bits (53), Expect = 2e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||||||||| |||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254

---

>emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1
          Length = 868

 Score =  105 bits (53), Expect = 2e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 696 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 637

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||||||||| |||||| ||||
Sbjct: 636 acgcaccttgggccagcagtt 616

---

>emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1
          Length = 826

 Score =  105 bits (53), Expect = 2e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||||||||| |||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254

---

>gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA
          Length = 2439

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                        
Query: 293  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
            |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 2151 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 2092

                                                            
Query: 353  acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
            ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 2091 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 2044

---

>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA,
           complete cds
          Length = 786

 Score =  103 bits (52), Expect = 6e-19
 Identities = 109/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 656 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 597

                                                                       
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416
           ||||| |||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 596 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 537

                   
Query: 417 attggctt 424
           || |||||
Sbjct: 536 ataggctt 529

---

>emb|CR938630.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA1YD12BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 701

 Score =  103 bits (52), Expect = 6e-19
 Identities = 109/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 320 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 379

                                                                       
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416
           ||||| |||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 380 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 439

                   
Query: 417 attggctt 424
           || |||||
Sbjct: 440 ataggctt 447

---

>emb|CR938124.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 817

 Score =  103 bits (52), Expect = 6e-19
 Identities = 109/128 (85%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 737 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 678

                                                                       
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416
           ||||| |||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 677 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 618

                   
Query: 417 attggctt 424
           || |||||
Sbjct: 617 ataggctt 610

---

>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 192681

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                          
Query: 293    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
              |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 127344 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 127285

                                                              
Query: 353    acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
              ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 127284 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 127237

---

>ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG1263-RB, transcript
           variant B (RpL8), mRNA
          Length = 1264

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 872 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 813

                                                           
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 812 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 765

---

>ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG1263-RA, transcript
           variant A (RpL8), mRNA
          Length = 1118

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 726 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 667

                                                           
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 666 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 619

---

>gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA
          Length = 1019

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 724 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 665

                                                           
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 664 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 617

---

>gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA
          Length = 1776

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 527 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 468

                                                           
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 467 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 420

---

>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete
              sequence
          Length = 301691

 Score =  103 bits (52), Expect = 6e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                          
Query: 293    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
              |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 123716 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 123657

                                                              
Query: 353    acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
              ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 123656 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 123609

---

>emb|CR937651.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YJ18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 765

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 739 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 680

                                                                      
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcag 415
           ||||| |||||| |||| | ||||||   |||||||||||||||   ||||||||||||
Sbjct: 679 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcag 621

---

>emb|CR937650.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB1YJ18BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 616

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 319 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 378

                                                                      
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcag 415
           ||||| |||||| |||| | ||||||   |||||||||||||||   ||||||||||||
Sbjct: 379 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcag 437

---

>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1
          Length = 884

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616

---

>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1
          Length = 883

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 724 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 665

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 664 ttcatagccacaccacgcaccttgggccagcagtt 630

---

>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1
          Length = 814

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1
          Length = 834

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 706 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 647

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 646 ttcatagccacaccacgcaccttgggccagcagtt 612

---

>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1
          Length = 838

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1
          Length = 834

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 174 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 233

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 234 ttcatagccacaccacgcaccttgggccagcagtt 268

---

>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1
          Length = 854

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616

---

>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1
          Length = 759

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | ||||||||| || |||||||||||||| || ||||||||||| |||
Sbjct: 707 acagttgaagctttaccaatatgatgatggttacctcctccatgaggatgctcaacgggg 648

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 647 ttcatagccacaccacgcaccttgggccagcagtt 613

---

>emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1
          Length = 475

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||| ||||||||||||| |||||||||||
Sbjct: 221 ttcatagcctcaccacgcaccttgggccaggagtt 255

---

>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1
          Length = 869

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614

---

>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1
          Length = 844

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1
          Length = 868

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614

---

>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1
          Length = 822

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255

---

>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome AT3G51190
           mRNA, complete cds
          Length = 783

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                       
Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350
           |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606

                                                                       
Query: 351 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 410
           ||||| ||   ||||||  ||||||||||| |   |||||||||||| || || ||||||
Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 546

                                                             
Query: 411 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460
           || || | ||||||||| || || || ||||| ||||| || ||||||||
Sbjct: 545 ttgagaaatggcttctctgttcttcctccacctgcaacttgcccaatcat 496

---

>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12
          Length = 129516

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Plus

                                                                         
Query: 291   tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350
             |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 76049 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 76108

                                                                         
Query: 351   ccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 410
             ||||| ||   ||||||  ||||||||||| |   |||||||||||| || || ||||||
Sbjct: 76109 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 76168

                                                               
Query: 411   ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460
             || || | ||||||||| || || || ||||| ||||| || ||||||||
Sbjct: 76169 ttgagaaatggcttctctgttcttcctccacctgcaacttgcccaatcat 76218

---

>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA,
           complete cds
          Length = 783

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                       
Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350
           |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606

                                                                       
Query: 351 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcc 410
           ||||| ||   ||||||  ||||||||||| |   |||||||||||| || || ||||||
Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggtatgcatttccagcc 546

                                                             
Query: 411 ttcagcattggcttctcagtcctgccaccaccagcaacctgaccaatcat 460
           || || | ||||||||| || || || ||||| ||||| || ||||||||
Sbjct: 545 ttgagaagtggcttctctgttcttcctccacctgcaacttgcccaatcat 496

---

>dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal protein L2,
           NaCl+paraquat inducible, complete cds, clone:M30
          Length = 987

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 131/158 (82%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| || |||||||| ||||| || ||||||||||||||||||
Sbjct: 672 ccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccacacca 613

                                                                       
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 413
           |||||||| ||||||  ||| | |||  |   |||||||||||| | |   |||||||||
Sbjct: 612 cgcaccttcggccagctgttacgcttggccttgtacttgtggtacgagcggccagccttc 553

                                                 
Query: 414 agcattggcttctcagtcctgccaccaccagcaacctg 451
           ||||| ||||||||||| | ||| || ||||| |||||
Sbjct: 552 agcatcggcttctcagtacggccgccgccagcgacctg 515

---

>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8
           mRNA sequence
          Length = 1079

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 748 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 689

                                                       
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 688 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 645

---

>emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 755

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 aacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagg 337
           |||||| ||||| | ||| ||||| || |||||||| |||||||| |||||||| |||||
Sbjct: 675 aacagtagaagctttaccgatatgttgatggttaccacctccgtgaggatgctctacagg 616

                                               
Query: 338 gttcatggccacaccacgcaccttaggccaggagtt 373
           ||||||||| |||||||| |||||||||||| ||||
Sbjct: 615 gttcatggcaacaccacgtaccttaggccagcagtt 580

---

>gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) gene, complete cds
          Length = 8311

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| || |||||||||||||| |||||||||||||| |||||
Sbjct: 298 accaatatgttgatggttaccaccaccgtggggatgctccacagggttcatggcaacacc 239

                           
Query: 353 acgcaccttaggccag 368
           ||||||||| ||||||
Sbjct: 238 acgcaccttgggccag 223

---

>gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 ribosomal protein L
           mRNA, complete cds
          Length = 866

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 129/156 (82%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||||||||| |||||||| || || || ||||| ||||| |||||||| ||||||||
Sbjct: 694 accaatatgctgatggttaccaccaccatgaggatgttcaactgggttcatagccacacc 635

                                                                       
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412
           ||| || ||||||||| |||||||||| ||   |||||||  ||| ||   |||||||||
Sbjct: 634 acgaactttaggccagcagttcctcttgaccttgtacttgaagtaagcacgaccagcctt 575

                                               
Query: 413 cagcattggcttctcagtcctgccaccaccagcaac 448
           |||||| ||||| ||  |||| ||||| ||||||||
Sbjct: 574 cagcatgggcttgtctatccttccacctccagcaac 539

---

>emb|CR937938.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 816

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           |||||||| |||||||| || ||||||||||||||||| |||||||| || || ||||| 
Sbjct: 740 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacgccacgt 681

                                                                       
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416
           ||||| |||||| |||| | ||||||   |||||||||||||||   |||||||||||| 
Sbjct: 680 acctttggccagcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcagg 621

                   
Query: 417 attggctt 424
           || |||||
Sbjct: 620 ataggctt 613

---

>emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1
          Length = 778

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 173 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 232

                                              
Query: 339 ttcatggccacaccacgcaccttaggccaggagtt 373
           |||||  |||||||||||||||| |||||| ||||
Sbjct: 233 ttcataaccacaccacgcaccttgggccagcagtt 267

---

>ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG1263-PA, isoform A
           (LOC656352), mRNA
          Length = 886

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| |||||||| ||||| || ||||||||||||||||| ||||||||||| |||||
Sbjct: 685 accaatgtgctggtgattaccaccaccgtggggatgctcaactgggttcatggcaacacc 626

                                
Query: 353 acgcaccttaggccaggagtt 373
           ||| || ||||||||| ||||
Sbjct: 625 acgtactttaggccagcagtt 605

---

>emb|CR938631.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YD12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 724

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 308 gttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggcca 367
           |||||| || ||||||||||||||||| |||||||| || |||||||| ||||| |||||
Sbjct: 724 gttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgtacctttggcca 665

                                                                    
Query: 368 ggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcattggctt 424
           | |||| | ||||||   |||||||||||||||   |||||||||||| || |||||
Sbjct: 664 gcagttacgcttcaccttgtacttgtggtaggcacgaccagccttcaggataggctt 608

---

>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds
          Length = 2231

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 105/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 300  tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
            ||||| |||||||| || || |||||||||||||| |||||||| ||||||||||| |||
Sbjct: 1937 tgctgatggttaccaccaccatggggatgctcaacggggttcatagccacaccacgtacc 1878

                                                                        
Query: 360  ttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 419
            || |||||| |||| | ||||||   ||||||| |||||||   ||| |||||||| |||
Sbjct: 1877 tttggccagcagttacgcttcaccttgtacttgcggtaggcacgaccggccttcaggatt 1818

                 
Query: 420  ggctt 424
            |||||
Sbjct: 1817 ggctt 1813

---

>gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, partial cds
          Length = 331

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           ||||||||||| ||||| || || |||||||||||||| |||||||| || |||||||||
Sbjct: 168 atatgctggtgattaccaccaccatggggatgctcaacggggttcatagcaacaccacgc 109

                                                                       
Query: 357 accttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagc 416
           || || |||||| |||| | ||||||   |||||||||||| ||   ||||||| |||| 
Sbjct: 108 actttcggccagcagttacgcttcaccttgtacttgtggtatgcacgaccagccctcaga 49

                   
Query: 417 attggctt 424
           ||||||||
Sbjct: 48  attggctt 41

---

>gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, complete cds
          Length = 915

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| ||||||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 702 accaatatgttggtggttaccacctccgtgaggatgctcaacggggttcatagccacacc 643

                                                           
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           ||| || |  |||||| |||| | ||| ||   |||||||||||||||
Sbjct: 642 acgaacgtatggccagcagttacgcttaaccttgtacttgtggtaggc 595

---

>dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-F06, full
           insert sequence
          Length = 864

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 291 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 350
           |||||||| |||||||||||||| || |||||||| ||||| || |||||||||||||||
Sbjct: 682 tgaccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccaca 623

                   
Query: 351 ccacgcac 358
           ||||||||
Sbjct: 622 ccacgcac 615

---

>ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA
          Length = 765

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601

                                                                       
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412
           |||   ||| ||||| ||||| |||||||    |||||||||| | ||   |||||||||
Sbjct: 600 acgggtctttggccaagagtttctcttcaacttgtacttgtggaaagcacgaccagcctt 541

                                              
Query: 413 cagcattggcttctcagtcctgccaccaccagcaa 447
           || || |||||| ||||| || |||||||||||||
Sbjct: 540 caacaatggcttgtcagttctaccaccaccagcaa 506

---

>emb|CR380956.1| Candida glabrata strain CBS138 chromosome J complete sequence
          Length = 1192501

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Plus

                                                                          
Query: 293    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
              ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 227764 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 227823

                                                                          
Query: 353    acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412
              |||   ||| ||||| ||||| |||||||    |||||||||| | ||   |||||||||
Sbjct: 227824 acgggtctttggccaagagtttctcttcaacttgtacttgtggaaagcacgaccagcctt 227883

                                                 
Query: 413    cagcattggcttctcagtcctgccaccaccagcaa 447
              || || |||||| ||||| || |||||||||||||
Sbjct: 227884 caacaatggcttgtcagttctaccaccaccagcaa 227918

---

>gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, partial cds
          Length = 672

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           |||||||||||||||||||| || |||  ||||||||||||||||| |||||||||||||
Sbjct: 625 ccaatatgctggtggttaccaccaccgaagggatgctcaacagggtccatggccacacca 566

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           || ||    ||||| |||||||||||  |   |||||||||||||||
Sbjct: 565 cggacacgtggccatgagttcctcttggccttgtacttgtggtaggc 519

---

>ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L8
           (LOC506251), mRNA
          Length = 833

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 120/146 (82%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 682 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 623

                                                                       
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 419
              |||||| ||||||||||  |    |||||||||||||| |  ||||||||||| || 
Sbjct: 622 agtggccagcagttcctctttgccttatacttgtggtaggcatggccagccttcagaatg 563

                                     
Query: 420 ggcttctcagtcctgccaccaccagc 445
           ||||| ||| | | |||||| |||||
Sbjct: 562 ggcttgtcaatgcagccacctccagc 537

---

>gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA, partial cds
          Length = 709

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||||||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 621 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 562

                                     
Query: 354 cgcaccttaggccaggagttcctctt 379
           || ||   ||||||| ||||||||||
Sbjct: 561 cggacacgaggccagcagttcctctt 536

---

>gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal protein L8 (rpL8) mRNA,
           complete cds
          Length = 937

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||||||||||
Sbjct: 712 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccacgcacc 653

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 652 ttcggccagcagttacgcttcaccttgtacttgtggta 615

---

>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 903

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 725 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 666

                                                    
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 665 cgtggccagcagttcctcttggccttgtacttgtggtaggc 625

---

>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 854

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 677 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 618

                                                    
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 617 cgtggccagcagttcctcttggccttgtacttgtggtaggc 577

---

>emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 711

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 297 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 356
           ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 656 atatgttgatggttaccaccaccgtggggatgctcaacggggttcatagccacaccgcgc 597

                            
Query: 357 accttaggccaggagtt 373
           ||||| |||||| ||||
Sbjct: 596 acctttggccagcagtt 580

---

>gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds
          Length = 688

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 127/156 (81%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||||||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 686 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 627

                                                                       
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttc 413
           || ||    |||||| ||||||||||  |   |||||||||||||||   ||||||||| 
Sbjct: 626 cggacacgtggccagcagttcctcttggccttgtacttgtggtaggcacgaccagccttt 567

                                               
Query: 414 agcattggcttctcagtcctgccaccaccagcaacc 449
           || || ||||| ||| | |  ||||| |||||||||
Sbjct: 566 aggatgggcttgtcaatacgaccacctccagcaacc 531

---

>emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protein L8e (rpL8e gene)
          Length = 774

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           |||||||| ||||| || ||||| ||||| || || ||||||||||| ||||||||||||
Sbjct: 653 tgctggtgattaccaccaccgtgaggatgytcsactgggttcatggcgacaccacgcacc 594

                         
Query: 360 ttaggccaggagtt 373
           ||||||||| ||||
Sbjct: 593 ttaggccagcagtt 580

---

>gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, mRNA (cDNA clone
           MGC:127227 IMAGE:7945641), complete cds
          Length = 932

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629

                               
Query: 360 ttaggccaggagttcctctt 379
              |||||| ||||||||||
Sbjct: 628 cgtggccagcagttcctctt 609

---

>ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein L8 (MGC127227), mRNA
          Length = 932

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629

                               
Query: 360 ttaggccaggagttcctctt 379
              |||||| ||||||||||
Sbjct: 628 cgtggccagcagttcctctt 609

---

>gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 878

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccac 354
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||
Sbjct: 702 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccac 648

---

>emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 774

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 307 ggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggcc 366
           ||||||| || ||||| ||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 646 ggttaccaccaccgtgaggatgctcaacggggttcatggcaacaccacgcacctttggcc 587

                  
Query: 367 aggagtt 373
           || ||||
Sbjct: 586 agcagtt 580

---

>emb|CR938453.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YN07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 735

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 318 ccgtggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctc 377
           ||||||||||||||||| |||||||| || |||||||| ||||| |||||| |||| | |
Sbjct: 728 ccgtggggatgctcaacggggttcatagcaacaccacgtacctttggccagcagttacgc 669

                                  
Query: 378 ttcacacggtacttgtggtaggc 400
           |||||   |||||||||||||||
Sbjct: 668 ttcaccttgtacttgtggtaggc 646

---

>dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase A regulatory
            subunit, complete cds
          Length = 2300

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                        
Query: 293  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
            ||||||||||||||| ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 1999 accaatatgctggtgattaccaccaccgtggggatggtccacagggttcattgccacacc 1940

               
Query: 353  acg 355
            |||
Sbjct: 1939 acg 1937

---

>emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 652 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 593

              
Query: 353 acg 355
           |||
Sbjct: 592 acg 590

---

>emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 214 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 155

              
Query: 353 acg 355
           |||
Sbjct: 154 acg 152

---

>emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 416 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 357

              
Query: 353 acg 355
           |||
Sbjct: 356 acg 354

---

>emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library
          Length = 360

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 163 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 104

              
Query: 353 acg 355
           |||
Sbjct: 103 acg 101

---

>emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 587 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 528

              
Query: 353 acg 355
           |||
Sbjct: 527 acg 525

---

>ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal protein L8
           (LOC410188), mRNA
          Length = 843

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || || ||||| || ||||| ||||| |||||||||||||| || |||||
Sbjct: 691 accaatatgttgatgattaccaccaccgtgtggatgttcaacagggttcatagcaacacc 632

                                      
Query: 353 acgcaccttaggccaggagttcctctt 379
           ||| |||||||||||  ||||||||||
Sbjct: 631 acgaaccttaggccaacagttcctctt 605

---

>emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribosomal protein L8 (rpll gene)
          Length = 305

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||||||||| ||||||||||||||||| |||||||| || ||
Sbjct: 188 accaatatgttgatggttacctcctccatggggatgctcaacaggattcatggctactcc 129

                                      
Query: 353 acgcaccttaggccaggagttcctctt 379
            |  || || |||||| ||||||||||
Sbjct: 128 tctgactttgggccagcagttcctctt 102

---

>gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, partial cds
          Length = 513

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 119/146 (81%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           |||||||||||||| |||||   ||||||||| ||||| ||||||||||||||||| || 
Sbjct: 335 tgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccacgtaca 276

                                                                       
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagccttcagcatt 419
              |||||| ||||||||||  |   |||||||||||||||  | ||||||||||  || 
Sbjct: 275 cgtggccagcagttcctctttgccttgtacttgtggtaggctctgccagccttcaagata 216

                                     
Query: 420 ggcttctcagtcctgccaccaccagc 445
           || || ||| | ||||||||||||||
Sbjct: 215 ggtttatcaattctgccaccaccagc 190

---

>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454

---

>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427

---

>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447

---

>emb|BX065896.1|CNS09N0C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagtagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagtagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 281 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 340

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 341 ttcggccagcagttgcgcttcaccttgtacttgtggta 378

---

>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 308 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 367

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 368 ttcggccagcagttgcgcttcaccttgtacttgtggta 405

---

>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447

---

>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443

---

>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 715 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 656

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 655 ttcggccagcagttgcgcttcaccttgtacttgtggta 618

---

>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 274 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 333

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 334 ttcggccagcagttgcgcttcaccttgtacttgtggta 371

---

>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 248 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 307

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 308 ttcggccagcagttgcgcttcaccttgtacttgtggta 345

---

>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 744 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 685

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 684 ttcggccagcagttgcgcttcaccttgtacttgtggta 647

---

>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459

---

>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454

---

>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455

---

>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462

---

>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 334 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 393

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 394 ttcggccagcagttgcgcttcaccttgtacttgtggta 431

---

>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463

---

>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461

---

>emb|BX045582.1|CNS097C2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX045137.1|CNS096ZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX043850.1|CNS095ZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatagccacaccgcgcacc 392

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430

---

>emb|BX043551.1|CNS095RN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX041268.1|CNS09408 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462

---

>emb|BX041134.1|CNS093WI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX041072.1|CNS093US Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX040787.1|CNS093MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461

---

>emb|BX040786.1|CNS093MU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 716 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 657

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 656 ttcggccagcagttgcgcttcaccttgtacttgtggta 619

---

>emb|BX039654.1|CNS092RE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 392

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430

---

>emb|BX036687.1|CNS090GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX037078.1|CNS090RU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 726 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 667

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 666 ttcggccagcagttgcgcttcaccttgtacttgtggta 629

---

>emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX034653.1|CNS08YWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX033967.1|CNS08YDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455

---

>emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435

---

>emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX032954.1|CNS08XLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450

---

>emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX032378.1|CNS08X5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX031877.1|CNS08WRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX031537.1|CNS08WHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX030002.1|CNS08VBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX029602.1|CNS08V06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446

---

>emb|BX028637.1|CNS08U9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX022357.1|CNS08PEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX026844.1|CNS08SVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450

---

>emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX025073.1|CNS08RID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX025038.1|CNS08RHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437

---

>emb|BX024670.1|CNS08R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX024145.1|CNS08QSL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 329 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 388

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 389 ttcggccagcagttgcgcttcaccttgtacttgtggta 426

---

>emb|BX023815.1|CNS08QJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463

---

>emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 376 tgctgatggttaccaccaccgtgcggatgctcgacggggttcattgccacaccgcgcacc 435

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 436 ttcggccagcagttgcgcttcaccttgtacttgtggta 473

---

>emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX020305.1|CNS08NTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX018974.1|CNS08MSY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX017981.1|CNS08M1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX018524.1|CNS08MGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX018377.1|CNS08MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|BX017737.1|CNS08LUL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461

---

>emb|BX017331.1|CNS08LJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434

---

>emb|BX016524.1|CNS08KWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 627 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 568

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 567 ttcggccagcagttgcgcttcaccttgtacttgtggta 530

---

>emb|BX016411.1|CNS08KTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 368 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 427

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 428 ttcggccagcagttgcgcttcaccttgtacttgtggta 465

---

>emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438

---

>emb|BX014218.1|CNS08J4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453

---

>emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433

---

>emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 719 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 660

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 659 ttcggccagcagttgcgcttcaccttgtacttgtggta 622

---

>emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442

---

>emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450

---

>emb|BX010378.1|CNS08G66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439

---

>emb|BX009864.1|CNS08FRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441

---

>emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|BX008448.1|CNS08EOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462

---

>emb|BX008129.1|CNS08EFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427

---

>emb|BX008128.1|CNS08EFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 701 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 642

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 641 ttcggccagcagttgcgcttcaccttgtacttgtggta 604

---

>emb|BX007575.1|CNS08E0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445

---

>emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 483

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 189 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 248

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 249 ttcggccagcagttgcgcttcaccttgtacttgtggta 286

---

>emb|BX005817.1|CNS08CNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449

---

>emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           |||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||||
Sbjct: 462 ccaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacca 403

             
Query: 354 cg 355
           ||
Sbjct: 402 cg 401

---

>gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, complete cds
          Length = 821

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| ||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 675 ccaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 616

                                     
Query: 354 cgcaccttaggccaggagttcctctt 379
           || ||   ||||||| ||||||||||
Sbjct: 615 cggacacgaggccagcagttcctctt 590

---

>ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416
           (ENSANGG00000007927), mRNA
          Length = 1093

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 751 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 692

                                                 
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggta 397
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 691 ttcggccagcagttgcgcttcaccttgtacttgtggta 654

---

>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 881

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||  |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 644

                                                    
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 643 cgtggccagcagttcctcttggccttgtacttgtggtaggc 603

---

>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 882

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||||||||  |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 644

                                                    
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggtaggc 400
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 643 cgtggccagcagttcctcttggccttgtacttgtggtaggc 603

---

>gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, complete cds
          Length = 862

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 338
           ||||||||||| | ||| ||||| || |||||||| || ||||| |||||||| ||||||
Sbjct: 713 acagtggaagccttacctatatgttgatggttaccaccaccgtgaggatgctctacaggg 654

                            
Query: 339 ttcatggccacaccacg 355
           |||||||| ||||||||
Sbjct: 653 ttcatggcaacaccacg 637

---

>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                       
Query: 300 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 359
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                
Query: 360 ttaggccaggagttcctcttcacacggtacttgtggt 396
           || |||||| |||| | ||||||   |||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggt 432

---

>ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g predicted mRNA
          Length = 765

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 108/132 (81%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601

                                                                       
Query: 353 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412
           |||   ||| ||||| ||||| ||||| || | |||||||||| | ||   |||||||||
Sbjct: 600 acgagtctttggccaagagtttctcttgactctgtacttgtggaaagcacgaccagcctt 541

                       
Query: 413 cagcattggctt 424
           || || ||||||
Sbjct: 540 caacaatggctt 529

---

>emb|AM049008.1| Biphyllus lunatus mRNA for ribosomal protein L8e (rpL8e gene)
          Length = 774

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| || || |||||||| |||||||| |||||||| || |||||||| || |||||
Sbjct: 660 accaatgtgttgatggttaccacctccgtgaggatgctccacggggttcatagcaacacc 601

                           
Query: 353 acgcaccttaggccag 368
           ||| ||||||||||||
Sbjct: 600 acgaaccttaggccag 585

---

>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 466

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 306 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 365
           |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| |||
Sbjct: 360 tggttaccgccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 419

                                           
Query: 366 caggagttcctcttcacacggtacttgtggta 397
           ||| |||| | ||||||   ||||||||||||
Sbjct: 420 cagcagttgcgcttcaccttgtacttgtggta 451

---

>emb|BX007182.1|CNS08DPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 306 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 365
           |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| |||
Sbjct: 228 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 287

                                           
Query: 366 caggagttcctcttcacacggtacttgtggta 397
           ||| |||| | ||||||   ||||||||||||
Sbjct: 288 cagcagttgcgcttcaccttgtacttgtggta 319

---

>emb|BX005504.1|CNS08CES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 306 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 365
           |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| |||
Sbjct: 366 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 425

                                           
Query: 366 caggagttcctcttcacacggtacttgtggta 397
           ||| |||| | ||||||   ||||||||||||
Sbjct: 426 cagcagttgcgcttcaccttgtacttgtggta 457

---

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 108/132 (81%)
 Strand = Plus / Plus

                                                                           
Query: 293     accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
               ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 1350556 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 1350615

                                                                           
Query: 353     acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagcctt 412
               |||   ||| ||||| ||||| ||||| || | |||||||||| | ||   |||||||||
Sbjct: 1350616 acgagtctttggccaagagtttctcttgactctgtacttgtggaaagcacgaccagcctt 1350675

                           
Query: 413     cagcattggctt 424
               || || ||||||
Sbjct: 1350676 caacaatggctt 1350687

---

>gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:73105
           IMAGE:4786513), complete cds
          Length = 841

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616

              
Query: 353 acg 355
           |||
Sbjct: 615 acg 613

---

>gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clone MGC:57885
           IMAGE:5684024), complete cds
          Length = 861

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 676 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 617

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 616 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 570

---

>ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA
          Length = 842

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 680 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 621

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 620 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 574

---

>ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA
          Length = 841

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616

              
Query: 353 acg 355
           |||
Sbjct: 615 acg 613

---

>gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:77641
           IMAGE:6996953), complete cds
          Length = 892

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 293 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 352
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 672 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 613

              
Query: 353 acg 355
           |||
Sbjct: 612 acg 610

---

>dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510006J21 product:ribosomal protein L8,
           full insert sequence
          Length = 848

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 700 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 641

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 640 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 594

---

>dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0007H22 product:ribosomal protein L8,
           full insert sequence
          Length = 844

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589

---

>dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730056L04 product:ribosomal protein L8,
           full insert sequence
          Length = 843

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589

---

>dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830046M18 product:ribosomal
           protein L8, full insert sequence
          Length = 848

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 294 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 353
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 701 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 642

                                                          
Query: 354 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 400
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 641 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 595


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,166,277
Number of Sequences: 3902068
Number of extensions: 4166277
Number of successful extensions: 81678
Number of sequences better than 10.0: 510
Number of HSP's better than 10.0 without gapping: 501
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 80527
Number of HSP's gapped (non-prelim): 1113
length of query: 569
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 546
effective length of database: 17,143,297,704
effective search space: 9360240546384
effective search space used: 9360240546384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---