ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9k05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carbox... 111 2e-22
2gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carbox... 111 2e-22
3gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-... 111 2e-22
4gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate car... 111 2e-22
5gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carbox... 111 2e-22
6gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxyl... 111 2e-22
7gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate car... 111 2e-22
8gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate c... 111 2e-22
9gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-b... 111 2e-22
10gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate c... 111 2e-22
11gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carbox... 111 2e-22
12gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate car... 111 2e-22
13gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxyla... 111 2e-22
14gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxy... 111 2e-22
15gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxyl... 111 2e-22
16gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo... 111 2e-22
17gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carbo... 111 2e-22
18gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carbo... 111 2e-22
19gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate c... 111 2e-22
20gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate ca... 111 2e-22
21emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL ge... 111 2e-22
22emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene fo... 111 2e-22
23emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL ge... 111 2e-22
24emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gen... 111 2e-22
25emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL g... 111 2e-22
26gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carbo... 111 2e-22
27emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribul... 111 2e-22
28emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribul... 111 2e-22
29emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for rib... 111 2e-22
30emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribul... 111 2e-22
31emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for rib... 111 2e-22
32emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ... 111 2e-22
33emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for r... 111 2e-22
34emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for r... 111 2e-22
35emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ... 111 2e-22
36emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF... 111 2e-22
37emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, O... 111 2e-22
38emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB 111 2e-22
39gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bispho... 111 2e-22
40gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose... 111 2e-22
41gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose... 111 2e-22
42gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate car... 111 2e-22
43gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carb... 111 2e-22
44gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-... 111 2e-22
45gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisph... 111 2e-22
46gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carbox... 111 2e-22
47gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carbox... 111 2e-22
48gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi... 111 2e-22
49gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carbox... 111 2e-22
50gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulo... 111 2e-22
51gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate car... 111 2e-22
52gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carbox... 111 2e-22
53gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate ca... 111 2e-22
54gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose... 111 2e-22
55gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,... 111 2e-22
56gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1... 111 2e-22
57gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carb... 111 2e-22
58gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carbo... 111 2e-22
59gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxy... 111 2e-22
60gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca... 111 2e-22
61gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carbo... 111 2e-22
62gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxy... 111 2e-22
63gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph... 111 2e-22
64gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisph... 111 2e-22
65gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-... 111 2e-22
66gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b... 111 2e-22
67gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
68gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
69gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
70gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
71gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
72gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
73gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
74gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
75gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
76gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
77gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-vouch... 111 2e-22
78gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H... 111 2e-22
79gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H... 111 2e-22
80gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H... 111 2e-22
81gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H... 111 2e-22
82gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H... 111 2e-22
83gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H... 111 2e-22
84emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ... 111 2e-22
85emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene fo... 111 2e-22
86emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partia... 111 2e-22
87emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene ... 111 2e-22
88emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene ... 111 2e-22
89emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene ... 111 2e-22
90emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for... 111 2e-22
91emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL ... 111 2e-22
92emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for... 111 2e-22
93emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gen... 111 2e-22
94emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene ... 111 2e-22
95emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ri... 111 2e-22
96gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxy... 111 2e-22
97gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5... 111 2e-22
98gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris vouche... 111 2e-22
99gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose... 111 2e-22
100gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher ... 111 2e-22
101gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher ... 111 2e-22
102gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis vouc... 111 2e-22
103gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H880... 111 2e-22
104gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H880... 111 2e-22
105gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H880... 111 2e-22
106gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5... 111 2e-22
107gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carbo... 111 2e-22
108gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate... 111 2e-22
109gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosph... 111 2e-22
110gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate car... 111 2e-22
111gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate... 111 2e-22
112gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxy... 111 2e-22
113gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bispho... 111 2e-22
114gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose... 111 2e-22
115gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose... 111 2e-22
116gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate ca... 111 2e-22
117gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate car... 111 2e-22
118gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carbo... 111 2e-22
119gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate ca... 111 2e-22
120gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi... 111 2e-22
121gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph... 111 2e-22
122gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b... 111 2e-22
123gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca... 111 2e-22
124gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulo... 111 2e-22
125gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphat... 111 2e-22
126gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carbo... 111 2e-22
127gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate ... 111 2e-22
128gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate ca... 111 2e-22
129gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carb... 111 2e-22
130gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carbo... 111 2e-22
131gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate car... 111 2e-22
132gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxy... 111 2e-22
133gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate... 111 2e-22
134gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosph... 111 2e-22
135gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphat... 111 2e-22
136gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate car... 111 2e-22
137gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate car... 111 2e-22
138gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxy... 111 2e-22
139gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxy... 111 2e-22
140gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphospha... 111 2e-22
141dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome 111 2e-22
142gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydroge... 111 2e-22
143emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene fo... 111 2e-22
144emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribu... 111 2e-22
145gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5... 111 2e-22
146dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ri... 111 2e-22
147gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate c... 107 3e-21
148gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica vou... 105 1e-20
149emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribul... 105 1e-20
150gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate ca... 103 5e-20
151gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate c... 103 5e-20
152gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate car... 103 5e-20
153gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate ca... 103 5e-20
154gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate car... 103 5e-20
155emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL... 103 5e-20
156emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene... 103 5e-20
157emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL ge... 103 5e-20
158emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ri... 103 5e-20
159emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL... 103 5e-20
160emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbc... 103 5e-20
161gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate ca... 103 5e-20
162gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphat... 103 5e-20
163gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphospha... 103 5e-20
164emb|AJ746255.1| Aira praecox chloroplast partial rbcL gene for r... 101 2e-19
165gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carbox... 100 7e-19
166gb|AY137446.1| Hordeum patagonicum subsp. mustersii ribulose-1,5... 100 7e-19
167gb|AY632375.1| Zoysia sp. JID-2004 ribulose-1,5-bisphosphate car... 96 1e-17
168gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carbo... 96 1e-17
169gb|AY632373.1| Uniola paniculata ribulose-1,5-bisphosphate carbo... 96 1e-17
170gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carbox... 96 1e-17
171gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carbox... 96 1e-17
172gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxyl... 96 1e-17
173gb|AY632363.1| Distichlis spicata ribulose-1,5-bisphosphate carb... 96 1e-17
174gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosp... 96 1e-17
175ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative... 96 1e-17
176gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carbo... 96 1e-17
177gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate ca... 96 1e-17
178gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate car... 96 1e-17
179gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate ca... 96 1e-17
180gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate car... 96 1e-17
181gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar N... 96 1e-17
182gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA... 96 1e-17
183gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-1... 96 1e-17
184gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carb... 96 1e-17
185emb|AJ784836.1| Muhlenbergia racemosa chloroplast partial rbcL g... 96 1e-17
186emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene fo... 96 1e-17
187emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL g... 96 1e-17
188emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene fo... 96 1e-17
189emb|AJ784829.1| Bouteloua gracilis chloroplast partial rbcL gene... 96 1e-17
190emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gen... 96 1e-17
191emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL ... 96 1e-17
192emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gen... 96 1e-17
193gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1... 96 1e-17
194gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA... 96 1e-17
195gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N... 96 1e-17
196emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for... 96 1e-17
197emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene... 96 1e-17
198emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chlor... 96 1e-17
199emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for... 96 1e-17
200emb|AJ746299.1| Phragmites australis chloroplast partial rbcL ge... 96 1e-17
201emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for r... 96 1e-17
202emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene f... 96 1e-17
203emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene fo... 96 1e-17
204emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL ... 96 1e-17
205emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL... 96 1e-17
206emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for r... 96 1e-17
207emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL g... 96 1e-17
208emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gen... 96 1e-17
209emb|AJ746274.1| Phragmites sp. TH-203 chloroplast partial rbcL g... 96 1e-17
210emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene f... 96 1e-17
211emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for r... 96 1e-17
212emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene... 96 1e-17
213emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL g... 96 1e-17
214emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene fo... 96 1e-17
215emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL g... 96 1e-17
216emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for... 96 1e-17
217gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxyl... 96 1e-17
218gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome... 96 1e-17
219gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast,... 96 1e-17
220gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxyl... 96 1e-17
221gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate ... 96 1e-17
222gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar N... 96 1e-17
223gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bispho... 96 1e-17
224gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carb... 96 1e-17
225gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosph... 96 1e-17
226gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carb... 96 1e-17
227dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
228dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
229dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
230dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
231gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate c... 96 1e-17
232gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate car... 96 1e-17
233gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate... 96 1e-17
234gb|AY622898.1| Piptatherum miliaceum ribulose-1,5-bisphosphate c... 96 1e-17
235gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxy... 96 1e-17
236gb|AY622896.1| Nassella viridula ribulose-1,5-bisphosphate carbo... 96 1e-17
237gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carbo... 96 1e-17
238gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-... 96 1e-17
239dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
240dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
241dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-17
242dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-17
243dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-17
244dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-17
245gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 96 1e-17
246gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 96 1e-17
247emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa... 96 1e-17
248dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete ... 96 1e-17
249dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome 96 1e-17
250gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosph... 96 1e-17
251gb|M91626.1|BAMCPRBCL Bamboo chloroplast ribulosebisphosphate (r... 96 1e-17
252gb|U31381.1|TBU31381 Tristachya biseriata ribulose-1,5-bisphosph... 96 1e-17
253gb|U31442.1|SDU31442 Stipa dregeana var. dregeana ribulose-1,5-b... 96 1e-17
254gb|U31438.1|MMU31438 Merxmuellera macowanii ribulose-1,5-bisphos... 96 1e-17
255gb|U31439.1|MJU31439 Moliniopsis japonica ribulose-1,5-bisphosph... 96 1e-17
256gb|U31105.1|GSU31105 Gynerium sagittatum ribulose-1,5-bisphospha... 96 1e-17
257gb|U31104.1|ECU31104 Eragrostis capensis ribulose-1,5-bisphospha... 96 1e-17
258gb|U31101.1|CLU31101 Chasmanthium latifolium ribulose-1,5-bispho... 96 1e-17
259gb|U31100.1|CGU31100 Centropodia glauca ribulose-1,5-bisphosphat... 96 1e-17
260emb|X04789.1|CHOSRBCL Rice chloroplast DNA for ribulose-1,5-biph... 96 1e-17
261gb|U13231.1|LHU13231 Lithachne humilis chloroplast ribulose-1,5-... 96 1e-17
262gb|L14623.1|PENCARBOXL Pennisetum glaucum ribulosebiphosphate ca... 96 1e-17
263gb|L14622.1|CEHRBCL Cenchrus setigerus chloroplast ribulose 1,5-... 96 1e-17
264dbj|D00207.1|RICCPRBCL Oryza sativa chloroplast gene for ribulos... 96 1e-17
265gb|AY601672.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo... 94 4e-17
266gb|AY632366.1| Micraira subulifolia ribulose-1,5-bisphosphate ca... 92 2e-16
267gb|AY626351.1| Eriachne triseta ribulose 1,5-bisphosphate carbox... 92 2e-16
268gb|AF352580.1| Eriachne triodioides ribulose-1,5-bisphosphate ca... 92 2e-16
269gb|AY618660.1| Arundinaria gigantea ribulose 1,5-bisphosphate ca... 92 2e-16
270gb|U31378.1|SZU31378 Stipagrostis zeyheri subsp. zeyheri ribulos... 92 2e-16
271gb|AY632369.1| Pariana radiciflora ribulose-1,5-bisphosphate car... 88 3e-15
272gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome 88 3e-15
273gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit... 88 3e-15
274gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion... 88 3e-15
275emb|AJ784822.1| Festuca rubra subsp. juncea chloroplast partial ... 88 3e-15
276emb|Z11973.1|CHZMRBCLG Z.mays chloroplast rbcL gene for ribulose... 88 3e-15
277emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome 88 3e-15
278emb|V00171.1|CHZM02 Zea mays chloroplast gene for the large subu... 88 3e-15
279emb|AJ746288.1| Cyperochloa hirsuta chloroplast partial rbcL gen... 88 3e-15
280emb|AJ746283.1| Aristida congesta subsp. barbicollis chloroplast... 88 3e-15
281emb|AJ746280.1| Agrostis stolonifera chloroplast partial rbcL ge... 88 3e-15
282emb|AJ746278.1| Sasa palmata chloroplast partial rbcL gene for r... 88 3e-15
283emb|AJ746277.1| Yushania maling chloroplast partial rbcL gene fo... 88 3e-15
284emb|AJ746273.1| Pseudosasa amabilis chloroplast partial rbcL gen... 88 3e-15
285emb|AJ746272.1| Phyllostachys nigra chloroplast partial rbcL gen... 88 3e-15
286emb|AJ746270.1| Oligostachyum oedogonatum chloroplast partial rb... 88 3e-15
287emb|AJ746267.1| Hibanobambusa tranquillans chloroplast partial r... 88 3e-15
288emb|AJ746266.1| Fargesia dracocephala chloroplast partial rbcL g... 88 3e-15
289emb|AJ746265.1| Drepanostachyum falcatum chloroplast partial rbc... 88 3e-15
290emb|AJ746261.1| Festuca rubra chloroplast partial rbcL gene for ... 88 3e-15
291emb|AJ746259.1| Brachystachyum densiflorum chloroplast partial r... 88 3e-15
292emb|AJ746179.1| Arundinaria tecta chloroplast partial rbcL gene ... 88 3e-15
293emb|AJ746178.1| Arundinaria oedogonata chloroplast partial rbcL ... 88 3e-15
294emb|AJ746177.1| Indocalamus latifolius chloroplast partial rbcL ... 88 3e-15
295emb|AJ746176.1| Chimonobambusa marmorea chloroplast partial rbcL... 88 3e-15
296gb|AY167975.1| Zea mays ribulose-1,5-bisphosphate carboxylase/ox... 88 3e-15
297gb|U88404.1|CHU88404 Cyperochloa hirsuta ribulose-1,5-bisphospha... 88 3e-15
298gb|U31359.1|ACU31359 Aristida congesta subsp. barbicollis ribulo... 88 3e-15
299gb|AY622892.1| Eremitis sp. MRD-2004 ribulose-1,5-bisphosphate c... 88 3e-15
300gb|AY622888.1| Brachyelytrum erectum ribulose-1,5-bisphosphate c... 88 3e-15
301gb|AY928077.1| Zea mays cultivar B73 chloroplast, complete genome 88 3e-15
302dbj|AB088833.1| Phyllostachys bambusoides chloroplast rbcL gene ... 88 3e-15
303gb|L05043.2|ZIZCPRBCL Zizania texana ribulose 1,5-bisphosphate c... 88 3e-15
304emb|AM110249.1| Fargesia sp. Asmussen 105 plastid partial rbcL g... 88 3e-15
305gb|U31379.1|MPU31379 Monachather paradoxus ribulose-1,5-bisphosp... 88 3e-15
306gb|U31436.1|HHU31436 Hyparrhenia hirta ribulose-1,5-bisphosphate... 88 3e-15
307gb|U31103.1|ESU31103 Enneapogon scaber ribulose-1,5-bisphosphate... 88 3e-15
308emb|X79900.1|SILCRBCL S.italica L. chloroplast rbcL gene 88 3e-15
309gb|U13230.1|PBU13230 Phyllostachys bambusoides chloroplast ribul... 88 3e-15
310dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond... 88 3e-15
311gb|AY632372.1| Streptochaeta sodiroana ribulose-1,5-bisphosphate... 84 4e-14
312gb|AY691638.1| Pyrrhanthera exigua ribulose-1,5-bisphosphate car... 84 4e-14
313gb|DQ005609.1| Cortaderia selloana ribulose-1,5-bisphosphate car... 84 4e-14
314emb|AJ784830.1| Cortaderia richardii chloroplast partial rbcL ge... 84 4e-14
315emb|AJ746260.1| Cortaderia sp. TH-158 chloroplast partial rbcL g... 84 4e-14
316gb|AY216650.1| Luzula nivea ribulose-1,5-bisphosphate carboxylas... 84 4e-14
317gb|AY034250.1| Wolffia borealis ribulose-1,5-biphosphate carboxy... 84 4e-14
318gb|AY034248.1| Wolffia brasiliensis ribulose-1,5-biphosphate car... 84 4e-14
319gb|AY034227.1| Lemna tenera ribulose-1,5-biphosphate carboxylase... 84 4e-14
320gb|U80704.1|LSU80704 Limnobium spongia ribulose-1,5-bisphosphate... 84 4e-14
321gb|U80701.1|HMU80701 Hydrocharis morsus-ranae ribulose-1,5-bisph... 84 4e-14
322gb|U31441.1|RNU31441 Rytidosperma nudiflorum ribulose-1,5-bispho... 84 4e-14
323gb|U31440.1|PPU31440 Plinthanthesis paradoxa ribulose-1,5-bispho... 84 4e-14
324gb|U31437.1|KPU31437 Karroochloa purpurea ribulose-1,5-bisphosph... 84 4e-14
325gb|U31102.1|DSU31102 Danthonia spicata ribulose-1,5-bisphosphate... 84 4e-14
326emb|AJ419949.1|SSP419949 Streptochaeta spicata chloroplast parti... 84 4e-14
327dbj|AB004894.1| Limnobium laevigatum chloroplast rbcL gene for r... 84 4e-14
328dbj|AB004892.1| Hydrocharis dubia chloroplast rbcL gene for ribu... 84 4e-14
329gb|AY632371.1| Spartina pectinata ribulose-1,5-bisphosphate carb... 80 7e-13
330gb|AF148766.1| Centrolepis strigosa ribulose-1,5-bisphosphate ca... 80 7e-13
331emb|AJ784821.1| Spartina pectinata chloroplast partial rbcL gene... 80 7e-13
332emb|AJ784819.1| Arthraxon sp. mvdb-G3 chloroplast partial rbcL g... 80 7e-13
333gb|AY357724.1| Pharus latifolius ribulose-1,5-bisphosphate carbo... 80 7e-13
334emb|AJ746254.1| Arthrostylidium sp. TH-53B chloroplast partial r... 80 7e-13
335emb|AJ746253.1| Arthraxon sp. TH-111 chloroplast partial rbcL ge... 80 7e-13
336emb|AJ419950.1|PPA419950 Pharus parvifolius chloroplast partial ... 80 7e-13
337emb|AJ286558.1|CST286558 Centrolepis strigosa chloroplast partia... 80 7e-13
338gb|AY622894.1| Lygeum spartum ribulose-1,5-bisphosphate carboxyl... 80 7e-13
339gb|U13227.1|CCU13227 Chusquea circinata chloroplast ribulose-1,5... 80 7e-13
340gb|AY395548.1| Luzula campestris ribulose-1,5-bisphosphate carbo... 76 1e-11
341gb|AY395543.1| Juncus articulatus ribulose-1,5-bisphosphate carb... 76 1e-11
342gb|L10248.2|MNACPRBCL Montrichardia arborescens ribulose 1,5-bis... 76 1e-11
343gb|L10246.2|XAOCPRBCL Xanthosoma sagittifolium ribulose 1,5-bisp... 76 1e-11
344emb|Y12968.1|SDY12968 S.distans rbcL gene 76 1e-11
345emb|Y12947.1|STY12947 S.terrestris rbcL gene 76 1e-11
346emb|AJ746296.1| Nardus stricta chloroplast partial rbcL gene for... 76 1e-11
347emb|AJ419947.1|RMA419947 Rostkovia magellanica chloroplast parti... 76 1e-11
348emb|AJ419946.1|MGR419946 Marsippospermum grandiflorum chloroplas... 76 1e-11
349emb|AJ419945.1|LMU419945 Luzula multiflora chloroplast partial r... 76 1e-11
350emb|AJ419944.1|DAC419944 Distichia acicularis chloroplast partia... 76 1e-11
351gb|AF497112.1| Hapaline sp. HAR 056 ribulose-1,5-bisphosphate ca... 76 1e-11
352gb|AF497110.1| Filarum manserichense ribulose-1,5-bisphosphate c... 76 1e-11
353gb|AY216603.1| Juncus hallii ribulose-1,5-bisphosphate carboxyla... 76 1e-11
354gb|AY216655.1| Luzula canariensis ribulose-1,5-bisphosphate carb... 76 1e-11
355gb|AY216654.1| Luzula purpureosplendens ribulose-1,5-bisphosphat... 76 1e-11
356gb|AY216653.1| Luzula pilosa ribulose-1,5-bisphosphate carboxyla... 76 1e-11
357gb|AY216652.1| Luzula campestris ribulose-1,5-bisphosphate carbo... 76 1e-11
358gb|AY216651.1| Luzula arcuata ribulose-1,5-bisphosphate carboxyl... 76 1e-11
359gb|AY216649.1| Luzula wahlenbergii ribulose-1,5-bisphosphate car... 76 1e-11
360gb|AY216647.1| Luzula sudetica ribulose-1,5-bisphosphate carboxy... 76 1e-11
361gb|AY216646.1| Luzula divulgata ribulose-1,5-bisphosphate carbox... 76 1e-11
362gb|AY216645.1| Luzula spicata ribulose-1,5-bisphosphate carboxyl... 76 1e-11
363gb|AY216644.1| Luzula glabrata ribulose-1,5-bisphosphate carboxy... 76 1e-11
364gb|AY216643.1| Luzula novaecambriae ribulose-1,5-bisphosphate ca... 76 1e-11
365gb|AY216641.1| Luzula meridionalis ribulose-1,5-bisphosphate car... 76 1e-11
366gb|AY216640.1| Luzula gigantea ribulose-1,5-bisphosphate carboxy... 76 1e-11
367gb|AY216636.1| Luzula nodulosa ribulose-1,5-bisphosphate carboxy... 76 1e-11
368gb|AY216635.1| Luzula traversii ribulose-1,5-bisphosphate carbox... 76 1e-11
369gb|AY216634.1| Luzula johnstonii ribulose-1,5-bisphosphate carbo... 76 1e-11
370gb|AY216633.1| Luzula kjellmanniana ribulose-1,5-bisphosphate ca... 76 1e-11
371gb|AY216632.1| Luzula luzulina ribulose-1,5-bisphosphate carboxy... 76 1e-11
372gb|AY216631.1| Juncus oxycarpus ribulose-1,5-bisphosphate carbox... 76 1e-11
373gb|AY216630.1| Juncus subnodulosus ribulose-1,5-bisphosphate car... 76 1e-11
374gb|AY216629.1| Juncus maritimus ribulose-1,5-bisphosphate carbox... 76 1e-11
375gb|AY216628.1| Juncus himalensis ribulose-1,5-bisphosphate carbo... 76 1e-11
376gb|AY216627.1| Juncus repens ribulose-1,5-bisphosphate carboxyla... 76 1e-11
377gb|AY216625.1| Juncus compressus ribulose-1,5-bisphosphate carbo... 76 1e-11
378gb|AY216624.1| Juncus xiphioides ribulose-1,5-bisphosphate carbo... 76 1e-11
379gb|AY216622.1| Juncus bulbosus ribulose-1,5-bisphosphate carboxy... 76 1e-11
380gb|AY216621.1| Juncus oxymeris ribulose-1,5-bisphosphate carboxy... 76 1e-11
381gb|AY216618.1| Juncus trifidus ribulose-1,5-bisphosphate carboxy... 76 1e-11
382gb|AY216617.1| Juncus lomatophyllus ribulose-1,5-bisphosphate ca... 76 1e-11
383gb|AY216616.1| Juncus capensis ribulose-1,5-bisphosphate carboxy... 76 1e-11
384gb|AY216614.1| Juncus articulatus ribulose-1,5-bisphosphate carb... 76 1e-11
385gb|AY216613.1| Juncus gerardii ribulose-1,5-bisphosphate carboxy... 76 1e-11
386gb|AY216612.1| Juncus effusus ribulose-1,5-bisphosphate carboxyl... 76 1e-11
387gb|AY216611.1| Juncus ensifolius ribulose-1,5-bisphosphate carbo... 76 1e-11
388gb|AY216610.1| Juncus stygius ribulose-1,5-bisphosphate carboxyl... 76 1e-11
389gb|AY216609.1| Juncus kraussii ribulose-1,5-bisphosphate carboxy... 76 1e-11
390gb|AY216608.1| Juncus vaginatus ribulose-1,5-bisphosphate carbox... 76 1e-11
391gb|AY216607.1| Juncus dichotomus ribulose-1,5-bisphosphate carbo... 76 1e-11
392gb|AY216606.1| Juncus covillei ribulose-1,5-bisphosphate carboxy... 76 1e-11
393gb|AY216605.1| Juncus triglumis ribulose-1,5-bisphosphate carbox... 76 1e-11
394gb|AY216604.1| Juncus capillaceus ribulose-1,5-bisphosphate carb... 76 1e-11
395gb|AY216602.1| Juncus imbricatus ribulose-1,5-bisphosphate carbo... 76 1e-11
396gb|AY034258.1| Wolffia elongata ribulose-1,5-biphosphate carboxy... 76 1e-11
397gb|AY034257.1| Wolffia globosa ribulose-1,5-biphosphate carboxyl... 76 1e-11
398gb|AY034256.1| Wolffia cylindracea ribulose-1,5-biphosphate carb... 76 1e-11
399gb|AY034255.1| Wolffia columbiana ribulose-1,5-biphosphate carbo... 76 1e-11
400gb|AY034254.1| Wolffia arrhiza ribulose-1,5-biphosphate carboxyl... 76 1e-11
401gb|AY034253.1| Wolffia angusta ribulose-1,5-biphosphate carboxyl... 76 1e-11
402gb|AY034252.1| Wolffia neglecta ribulose-1,5-biphosphate carboxy... 76 1e-11
403gb|AY034247.1| Wolffiella denticulata ribulose-1,5-biphosphate c... 76 1e-11
404gb|AY034246.1| Wolffiella neotropica ribulose-1,5-biphosphate ca... 76 1e-11
405gb|AY034245.1| Wolffiella welwitschii ribulose-1,5-biphosphate c... 76 1e-11
406gb|AY034244.1| Wolffiella caudata ribulose-1,5-biphosphate carbo... 76 1e-11
407gb|AY034243.1| Wolffiella gladiata ribulose-1,5-biphosphate carb... 76 1e-11
408gb|AY034242.1| Wolffiella oblonga ribulose-1,5-biphosphate carbo... 76 1e-11
409gb|AY034240.1| Wolffiella hyalina ribulose-1,5-biphosphate carbo... 76 1e-11
410gb|AY034239.1| Wolffiella repanda ribulose-1,5-biphosphate carbo... 76 1e-11
411gb|AY034238.1| Wolffiella rotunda ribulose-1,5-biphosphate carbo... 76 1e-11
412gb|AY034236.1| Lemna disperma ribulose-1,5-biphosphate carboxyla... 76 1e-11
413gb|AY034232.1| Lemna obscura ribulose-1,5-biphosphate carboxylas... 76 1e-11
414gb|AY034231.1| Lemna ecuadoriensis ribulose-1,5-biphosphate carb... 76 1e-11
415gb|AY034230.1| Lemna turionifera ribulose-1,5-biphosphate carbox... 76 1e-11
416gb|AY034229.1| Lemna perpusilla ribulose-1,5-biphosphate carboxy... 76 1e-11
417gb|AY034228.1| Lemna aequinoctialis ribulose-1,5-biphosphate car... 76 1e-11
418gb|AY034225.1| Lemna valdiviana ribulose-1,5-biphosphate carboxy... 76 1e-11
419gb|AY034224.1| Lemna minuta ribulose-1,5-biphosphate carboxylase... 76 1e-11
420gb|AY012494.1| Drymophloeus beguinii ribulose bisphosphate carbo... 76 1e-11
421gb|AY012493.1| Balaka seemannii ribulose bisphosphate carboxylas... 76 1e-11
422gb|M91630.1|LGICPRBCL Lemna minuta ribulose 1,5-bisphosphate car... 76 1e-11
423gb|AY660588.1| Oxychloe andina voucher Brooks 20583 (C1436) ribu... 76 1e-11
424gb|AY660585.1| Oxychloe castellanosii voucher H319/2 ribulose-1,... 76 1e-11
425gb|AF537122.1| Trichomanes cuspidatum ribulose-1,5-bisphosphate ... 76 1e-11
426gb|AY622895.1| Nardus stricta ribulose-1,5-bisphosphate carboxyl... 76 1e-11
427emb|AM110235.1| Ptychosperma macarthurii plastid partial rbcL ge... 76 1e-11
428gb|DQ058339.1| Scleria distans ribulose-1,5-bisphosphate carboxy... 76 1e-11
429gb|AF249647.1| Microstrobos niphophilus ribulose-1,5-bisphosphat... 76 1e-11
430gb|U49226.1|MGU49226 Marsippospermum grandiflorum ribulose-1,5-b... 76 1e-11
431gb|U49228.1|LPU49228 Luzula parviflora ribulose-1,5-bisphosphate... 76 1e-11
432gb|L12681.1|JUCCPRBCLA Juncus effusus chloroplast ribulosebispho... 76 1e-11
433gb|M81812.1|DRYCPRBCL Drymopnlaeus subdisticha chloroplast ribul... 76 1e-11
434emb|AJ007543.1|XMA7543 Xanthosoma mafaffa rbcL gene, partial 76 1e-11
435emb|Y09197.1|TMY09197 T.membranaceum chloroplast rbcL gene, partial 76 1e-11
436emb|Y09192.1|TEY09192 T.ekmanii chloroplast rbcL gene, partial 76 1e-11
437emb|AJ005627.1|ASAJ5627 Anthuriumscherzerianum chloroplast rbcL ... 76 1e-11
438emb|Z77281.1|SCZ77281 S.capensis chloroplast rbcL gene 76 1e-11
439gb|AY614389.1| Bromelia plumieri MB-119 atpB-rbcL intergenic spa... 76 1e-11
440gb|AY614385.1| Lindmania guianensis MB-112 atpB-rbcL intergenic ... 76 1e-11
441emb|AJ286563.1|XCA286563 Xyris capensis chloroplast partial rbcL... 74 4e-11
442gb|AY034241.1| Wolffiella lingulata ribulose-1,5-biphosphate car... 74 4e-11
443gb|AY034226.1| Lemna yungensis ribulose-1,5-biphosphate carboxyl... 74 4e-11
444gb|AF206834.1| Xyris sp. Chase 154 ribulose 1,5-bisphosphate car... 74 4e-11
445gb|U49224.1|RMU49224 Rostkovia magellanica ribulose-1,5-bisphosp... 74 4e-11
446gb|U49227.1|DMU49227 Distichia muscoides ribulose-1,5-bisphospha... 74 4e-11
447gb|AY320253.1| Vesicularia reticulata ribulose-1,5-bisphosphate ... 72 2e-10
448gb|AC133248.4| Oryza sativa (japonica cultivar-group) chromosome... 72 2e-10
449gb|AY312938.1| Timmia megapolitana ribulose 1,5-bisphosphate car... 72 2e-10
450gb|AC134256.4| Oryza sativa (japonica cultivar-group), complete ... 72 2e-10
451gb|AY368371.1| Thecostele alata ribulose-1,5-bisphosphate carbox... 72 2e-10
452gb|AY368370.1| Scuticaria hadwenii ribulose-1,5-bisphosphate car... 72 2e-10
453gb|AY368360.1| Hexadesmia sp. Chase O-336 ribulose-1,5-bisphosph... 72 2e-10
454gb|AY368356.1| Cymbidium eburneum ribulose-1,5-bisphosphate carb... 72 2e-10
455gb|AY368341.1| Gennaria diphylla ribulose-1,5-bisphosphate carbo... 72 2e-10
456gb|AF148773.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate... 72 2e-10
457gb|AF264167.1| Eulophia petersii ribulose-1,5-bisphosphate carbo... 72 2e-10
458gb|AF491014.1| Timmia austriaca 162 ribulose-1,5-bisphosphate ca... 72 2e-10
459emb|AJ286559.1|EMO286559 Ecdeiocolea monostachya chloroplast par... 72 2e-10
460emb|AJ275185.1|TAU275185 Timmia austriaca chloroplast partial rb... 72 2e-10
461emb|AJ275166.1|TSI275166 Timmia sibirica chloroplast partial rbc... 72 2e-10
462gb|AF344490.1|AF344490 Lasiocarpus sp. KMC-2001 ribulose-1,5-bis... 72 2e-10
463dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-10
464gb|AF226815.1|AF226815 Campylopus eberhardtii ribulose-1,5-bisph... 72 2e-10
465gb|AF074235.1|AF074235 Trichotosia ferox ribulose-1,5-bisphospha... 72 2e-10
466gb|AF074230.1|AF074230 Stanhopea ecornuta ribulose-1,5-bisphosph... 72 2e-10
467gb|AF074222.1|AF074222 Polystachya pubescens ribulose-1,5-bispho... 72 2e-10
468gb|AF074211.1|AF074211 Phalaenopsis equestris ribulose-1,5-bisph... 72 2e-10
469gb|AF074197.1|AF074197 Neofinetia falcata ribulose-1,5-bisphosph... 72 2e-10
470gb|AF074192.1|AF074192 Meiracyllium trinasutum ribulose-1,5-bisp... 72 2e-10
471gb|AF074176.1|AF074176 Grammatophyllum speciosum ribulose-1,5-bi... 72 2e-10
472gb|AF074170.1|AF074170 Eulophia nuda ribulose-1,5-bisphosphate c... 72 2e-10
473gb|AF074157.1|AF074157 Encyclia sp. KMC1998 ribulose-1,5-bisphos... 72 2e-10
474gb|AF074148.1|AF074148 Diceratostele gabonensis ribulose-1,5-bis... 72 2e-10
475gb|AF074147.1|AF074147 Diaphananthe rutila ribulose-1,5-bisphosp... 72 2e-10
476gb|AF074122.1|AF074122 Cattleya dowiana ribulose-1,5-bisphosphat... 72 2e-10
477gb|AF074106.1|AF074106 Angraecum sesquipedale ribulose-1,5-bisph... 72 2e-10
478gb|AF074104.1|AF074104 Aeranthes ramosa ribulose-1,5-bisphosphat... 72 2e-10
479gb|AF233578.1|AF233578 Lepidopilum surinamense ribulose 1,5-bisp... 72 2e-10
480gb|AF158175.1|AF158175 Pterobryon densum ribulose 1,5-bisphospha... 72 2e-10
481gb|AF478242.1| Timmia megapolitana ribulose 1,5-bisphosphate car... 72 2e-10
482gb|AF478202.1| Oedipodium griffithianum ribulose 1,5-bisphosphat... 72 2e-10
483gb|AF074130.1| Cleisostoma rolfeanum ribulose-1,5-bisphosphate c... 72 2e-10
484gb|AF074103.1| Aerangis calligera ribulose-1,5-bisphosphate carb... 72 2e-10
485gb|AY123235.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate... 72 2e-10
486gb|AY123233.1| Aphelia cyperoides ribulose-1,5-bisphosphate carb... 72 2e-10
487emb|AJ542427.1|EBO542427 Eurystyles borealis plastid partial rbc... 72 2e-10
488gb|AF518075.1| Sophronitis mirandae specimen-voucher MWC1208 rib... 72 2e-10
489gb|AF518073.1| Sophronitis harpophylla specimen-voucher MWC1249 ... 72 2e-10
490gb|AF518072.1| Sophronitis coccinea specimen-voucher C237 ribulo... 72 2e-10
491gb|AF518071.1| Cattleya violacea specimen-voucher MWC1261 ribulo... 72 2e-10
492gb|AF518070.1| Laelia speciosa specimen-voucher MWC6088 ribulose... 72 2e-10
493gb|AF518069.1| Broughtonia sanguinea specimen-voucher MWC1191 ri... 72 2e-10
494gb|AF518067.1| Scaphyglottis modesta specimen-voucher MWC1243 ri... 72 2e-10
495gb|AF518066.1| Hexadesmia crurigera specimen-voucher MWC336 ribu... 72 2e-10
496gb|AF518064.1| Scaphyglottis punctulata specimen-voucher MWC299 ... 72 2e-10
497gb|AF518063.1| Prosthechea abbreviata specimen-voucher MWC5942 r... 72 2e-10
498gb|AF518062.1| Encyclia oncidioides specimen-voucher MWC5938 rib... 72 2e-10
499gb|AF518061.1| Dinema polybulbon specimen-voucher MWC1233 ribulo... 72 2e-10
500gb|AF518060.1| Epidendrum campestre specimen-voucher C242 ribulo... 72 2e-10

>gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) mRNA, complete cds; chloroplast
          Length = 1510

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1212 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1153

              
Query: 61   gt 62
            ||
Sbjct: 1152 gt 1151



to top

>gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1333

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1135 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1076

              
Query: 61   gt 62
            ||
Sbjct: 1075 gt 1074



to top

>gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1323

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1122 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1063

              
Query: 61   gt 62
            ||
Sbjct: 1062 gt 1061



to top

>gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1287

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1104 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1045

              
Query: 61   gt 62
            ||
Sbjct: 1044 gt 1043



to top

>gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1332

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1125 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1066

              
Query: 61   gt 62
            ||
Sbjct: 1065 gt 1064



to top

>gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1296

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1120 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1061

              
Query: 61   gt 62
            ||
Sbjct: 1060 gt 1059



to top

>gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1299

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1123 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1064

              
Query: 61   gt 62
            ||
Sbjct: 1063 gt 1062



to top

>gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1105 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1046

              
Query: 61   gt 62
            ||
Sbjct: 1045 gt 1044



to top

>gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1350

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1259

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1100 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1041

              
Query: 61   gt 62
            ||
Sbjct: 1040 gt 1039



to top

>gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1408

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1151 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1092

              
Query: 61   gt 62
            ||
Sbjct: 1091 gt 1090



to top

>emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1363

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1159 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1100

              
Query: 61   gt 62
            ||
Sbjct: 1099 gt 1098



to top

>emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1349

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1145 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1086

              
Query: 61   gt 62
            ||
Sbjct: 1085 gt 1084



to top

>emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1360

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1146 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1087

              
Query: 61   gt 62
            ||
Sbjct: 1086 gt 1085



to top

>gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcl) mRNA, complete cds; chloroplast gene
            for chloroplast product
          Length = 1519

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1220 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1161

              
Query: 61   gt 62
            ||
Sbjct: 1160 gt 1159



to top

>emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
           large subunit of ribulose 1,5 bisphosphate
           carboxylase/oxygenase and apoprotein I
          Length = 3830

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 998 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 939

             
Query: 61  gt 62
           ||
Sbjct: 938 gt 937



to top

>emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
           large subunit of ribulose 1,5 bisphosphate
           carboxylase/oxygenase and apoprotein I
          Length = 4811

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 998 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 939

             
Query: 61  gt 62
           ||
Sbjct: 938 gt 937



to top

>emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
           large subunit of ribulose 1,5 bisphosphate
           carboxylase/oxygenase and apoprotein I
          Length = 4075

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 998 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 939

             
Query: 61  gt 62
           ||
Sbjct: 938 gt 937



to top

>emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB
          Length = 2174

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 2056 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1997

              
Query: 61   gt 62
            ||
Sbjct: 1996 gt 1995



to top

>gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast gene for chloroplast product
          Length = 1477

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1137 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1078

              
Query: 61   gt 62
            ||
Sbjct: 1077 gt 1076



to top

>gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1610

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1606

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1621

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1628

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-voucher H28
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-voucher H161
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-voucher H837
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-voucher H832
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-voucher H828
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-voucher H826
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-voucher H824
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-voucher H823
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-voucher H820
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-voucher H81
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-voucher H64
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H620
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H607
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H544
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H522
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H87
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H41
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1287

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1104 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1045

              
Query: 61   gt 62
            ||
Sbjct: 1044 gt 1043



to top

>emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1332

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1125 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1066

              
Query: 61   gt 62
            ||
Sbjct: 1065 gt 1064



to top

>emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partial rbcL gene for
            ribulose bisphosphate carboxylase large chain
          Length = 1296

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1120 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1061

              
Query: 61   gt 62
            ||
Sbjct: 1060 gt 1059



to top

>emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1299

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1123 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1064

              
Query: 61   gt 62
            ||
Sbjct: 1063 gt 1062



to top

>emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1105 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1046

              
Query: 61   gt 62
            ||
Sbjct: 1045 gt 1044



to top

>emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1329

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1125 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1066

              
Query: 61   gt 62
            ||
Sbjct: 1065 gt 1064



to top

>emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1301

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1130 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1071

              
Query: 61   gt 62
            ||
Sbjct: 1070 gt 1069



to top

>emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1323

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1122 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1063

              
Query: 61   gt 62
            ||
Sbjct: 1062 gt 1061



to top

>emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1370

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris voucher H6701
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1611

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1594

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher H4378
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher H4375
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis voucher H4348
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209



to top

>gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213



to top

>gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213



to top

>gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213



to top

>gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213



to top

>gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3054

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1128 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1069

              
Query: 61   gt 62
            ||
Sbjct: 1068 gt 1067



to top

>gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3179

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; and rbcL-psaI
            intergenic spacer, partial sequence; chloroplast
          Length = 2360

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3138

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3155

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2309

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1137 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1078

              
Query: 61   gt 62
            ||
Sbjct: 1077 gt 1076



to top

>gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            psaI gene, partial sequence; chloroplast
          Length = 3071

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2752

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3106

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2136

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3158

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3110

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3095

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3108

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3102

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2371

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2372

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3166

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2366

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2374

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3190

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3192

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3171

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2268

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1130 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1071

              
Query: 61   gt 62
            ||
Sbjct: 1070 gt 1069



to top

>gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2373

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2365

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3183

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2360

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3234

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3215

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148



to top

>gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome
          Length = 134545

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 56070 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 56011

               
Query: 61    gt 62
             ||
Sbjct: 56010 gt 56009



to top

>gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydrogenase (rbcL) gene, complete
            cds
          Length = 1623

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1259 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1200

              
Query: 61   gt 62
            ||
Sbjct: 1199 gt 1198



to top

>emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1224

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds
          Length = 1484

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (H-type), complete
            cds
          Length = 1755

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1256 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1197

              
Query: 61   gt 62
            ||
Sbjct: 1196 gt 1195



to top

>gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  107 bits (54), Expect = 3e-21
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082



to top

>gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica voucher H6703
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1471

 Score =  105 bits (53), Expect = 1e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||
Sbjct: 1130 catatgccaaacatgaataccacctgaagctaccggtataacanctggcatggataccca 1071

              
Query: 61   gt 62
            ||
Sbjct: 1070 gt 1069



to top

>emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1434

 Score =  105 bits (53), Expect = 1e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgncaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1143

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1117 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1058

              
Query: 61   gt 62
            ||
Sbjct: 1057 gt 1056



to top

>gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1277

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1108 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1049

              
Query: 61   gt 62
            ||
Sbjct: 1048 gt 1047



to top

>gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcagggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1408

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1346

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1142 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1083

              
Query: 61   gt 62
            ||
Sbjct: 1082 gt 1081



to top

>emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1358

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082



to top

>emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1357

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1148 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1089

              
Query: 61   gt 62
            ||
Sbjct: 1088 gt 1087



to top

>emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1332

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1397

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1151 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1092

              
Query: 61   gt 62
            ||
Sbjct: 1091 gt 1090



to top

>emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1362

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit gene, partial cds;
            chloroplast
          Length = 1330

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>emb|AJ746255.1| Aira praecox chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1126

 Score =  101 bits (51), Expect = 2e-19
 Identities = 55/57 (96%)
 Strand = Plus / Minus

                                                                     
Query: 6    gccaaacatgaataccacctgaagctaccgntataacacctgncatggatacccagt 62
            |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 1126 gccaaacatgaataccacctgaagctaccggtataacacctggcatggatacccagt 1070



to top

>gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 99.6 bits (50), Expect = 7e-19
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1039



to top

>gb|AY137446.1| Hordeum patagonicum subsp. mustersii ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score = 99.6 bits (50), Expect = 7e-19
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| |||||||  || ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacanntggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210



to top

>gb|AY632375.1| Zoysia sp. JID-2004 ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1176

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1175

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaatacctcctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY632373.1| Uniola paniculata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1039

              
Query: 61   gt 62
            ||
Sbjct: 1038 gt 1037



to top

>gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1201

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1039

              
Query: 61   gt 62
            ||
Sbjct: 1038 gt 1037



to top

>gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggataccca 1039

              
Query: 61   gt 62
            ||
Sbjct: 1038 gt 1037



to top

>gb|AY632363.1| Distichlis spicata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1176

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; plastid
          Length = 1171

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative rbcL; RuBisCO large
            subunit from chromosome 10 chloroplast insertion
            (OSJNBb0075K12.39), mRNA
          Length = 1434

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088



to top

>gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare chloroplast,
             complete genome
          Length = 134551

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55263 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55204

               
Query: 61    gt 62
             ||
Sbjct: 55203 gt 55202



to top

>gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA64S chloroplast,
             complete genome
          Length = 134551

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55263 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55204

               
Query: 61    gt 62
             ||
Sbjct: 55203 gt 55202



to top

>gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-11 chloroplast,
             complete genome
          Length = 134496

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55211 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55152

               
Query: 61    gt 62
             ||
Sbjct: 55151 gt 55150



to top

>gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1349

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ784836.1| Muhlenbergia racemosa chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1361

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082



to top

>emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1328

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1145 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1086

              
Query: 61   gt 62
            ||
Sbjct: 1085 gt 1084



to top

>emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1359

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1146 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1087

              
Query: 61   gt 62
            ||
Sbjct: 1086 gt 1085



to top

>emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1353

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1159 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1100

              
Query: 61   gt 62
            ||
Sbjct: 1099 gt 1098



to top

>emb|AJ784829.1| Bouteloua gracilis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1275

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1080 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1021

              
Query: 61   gt 62
            ||
Sbjct: 1020 gt 1019



to top

>emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1356

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082



to top

>emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1142 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1083

              
Query: 61   gt 62
            ||
Sbjct: 1082 gt 1081



to top

>emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1338

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082



to top

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 125552 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 125493

                
Query: 61     gt 62
              ||
Sbjct: 125492 gt 125491



 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 30492 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 30433

               
Query: 61    gt 62
             ||
Sbjct: 30432 gt 30431



to top

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 124579 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 124520

                
Query: 61     gt 62
              ||
Sbjct: 124519 gt 124518



 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 29998 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 29939

               
Query: 61    gt 62
             ||
Sbjct: 29938 gt 29937



to top

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 124579 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 124520

                
Query: 61     gt 62
              ||
Sbjct: 124519 gt 124518



 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 29998 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 29939

               
Query: 61    gt 62
             ||
Sbjct: 29938 gt 29937



to top

>emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for the rubisco large subunit
            (EC 4.1.1.39)
          Length = 1990

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1578 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1519

              
Query: 61   gt 62
            ||
Sbjct: 1518 gt 1517



to top

>emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene for the rubisco large
            subunit (EC 4.1.1.39)
          Length = 2010

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1598 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1539

              
Query: 61   gt 62
            ||
Sbjct: 1538 gt 1537



to top

>emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chloroplast genome
          Length = 134525

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55255 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55196

               
Query: 61    gt 62
             ||
Sbjct: 55195 gt 55194



to top

>emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1289

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1076 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015



to top

>emb|AJ746299.1| Phragmites australis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1341

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1295

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||
Sbjct: 1119 catatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggataccca 1060

              
Query: 61   gt 62
            ||
Sbjct: 1059 gt 1058



to top

>emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1239

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1026 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 967

              
Query: 61   gt 62
            ||
Sbjct: 966  gt 965



to top

>emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1408

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080



to top

>emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|AJ746274.1| Phragmites sp. TH-203 chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1409

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1144 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1085

              
Query: 61   gt 62
            ||
Sbjct: 1084 gt 1083



to top

>emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1385

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1146 catatgccaaacatgaataccgcctgaagccaccggtataacacctggcatggataccca 1087

              
Query: 61   gt 62
            ||
Sbjct: 1086 gt 1085



to top

>emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1388

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1121 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1062

              
Query: 61   gt 62
            ||
Sbjct: 1061 gt 1060



to top

>emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| || |||||||||| ||||||||||| ||||||||||||
Sbjct: 1076 catatgccaaacatgaatacccccagaagctaccggtataacacctggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015



to top

>emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||
Sbjct: 1076 catatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015



to top

>emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100



to top

>emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1339

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1144 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1085

              
Query: 61   gt 62
            ||
Sbjct: 1084 gt 1083



to top

>gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0075K12, complete sequence
          Length = 125936

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 53465 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 53406

               
Query: 61    gt 62
             ||
Sbjct: 53405 gt 53404



to top

>gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast, complete genome
          Length = 141182

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 120242 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 120183

                
Query: 61     gt 62
              ||
Sbjct: 120182 gt 120181



to top

>gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxylase (rbcL) gene,
            partial cds; chloroplast gene for chloroplast product
          Length = 1289

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1076 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015



to top

>gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate carboxylase (rbcL)
            gene, partial cds; chloroplast gene for chloroplast
            product
          Length = 1239

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1026 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 967

              
Query: 61   gt 62
            ||
Sbjct: 966  gt 965



to top

>gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar Nipponbare from
              chromosome 10, complete sequence
          Length = 134933

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 128398 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 128339

                
Query: 61     gt 62
              ||
Sbjct: 128338 gt 128337



to top

>gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carboxylase large subunit
            (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast gene
            for chloroplast product
          Length = 1320

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1398

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                           
Query: 1       catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
               ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 5614303 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 5614244

                 
Query: 61      gt 62
               ||
Sbjct: 5614243 gt 5614242



 Score = 40.1 bits (20), Expect = 0.58
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 1        catatgccaaacatgaatac 20
                ||||||||||||||||||||
Sbjct: 26145112 catatgccaaacatgaatac 26145093



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 10347073 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 10347014

                  
Query: 61       gt 62
                ||
Sbjct: 10347013 gt 10347012



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 23203832 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 23203891

                  
Query: 61       gt 62
                ||
Sbjct: 23203892 gt 23203893



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 33527409 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 33527468

                  
Query: 61       gt 62
                ||
Sbjct: 33527469 gt 33527470



to top

>gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1304

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1285

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1112 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1053

              
Query: 61   gt 62
            ||
Sbjct: 1052 gt 1051



to top

>gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1305

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY622898.1| Piptatherum miliaceum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||| ||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccaccagaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY622896.1| Nassella viridula ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||| ||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccaccagaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds
          Length = 1320

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070



to top

>dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0557A01
          Length = 147201

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 72606 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 72665

               
Query: 61    gt 62
             ||
Sbjct: 72666 gt 72667



to top

>dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0417D05
          Length = 165752

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 154480 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 154539

                
Query: 61     gt 62
              ||
Sbjct: 154540 gt 154541



to top

>dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0642B07
          Length = 139297

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 38594 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 38653

               
Query: 61    gt 62
             ||
Sbjct: 38654 gt 38655



to top

>dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-A05, full
            insert sequence
          Length = 2485

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1216 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1157

              
Query: 61   gt 62
            ||
Sbjct: 1156 gt 1155



to top

>dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G09, full
           insert sequence
          Length = 838

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 221 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 162

             
Query: 61  gt 62
           ||
Sbjct: 161 gt 160



to top

>dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-B12, full
           insert sequence
          Length = 1243

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 959 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 900

             
Query: 61  gt 62
           ||
Sbjct: 899 gt 898



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 10353112 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 10353053

                  
Query: 61       gt 62
                ||
Sbjct: 10353052 gt 10353051



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                           
Query: 1       catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
               ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 5614292 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 5614233

                 
Query: 61      gt 62
               ||
Sbjct: 5614232 gt 5614231



 Score = 40.1 bits (20), Expect = 0.58
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 1        catatgccaaacatgaatac 20
                ||||||||||||||||||||
Sbjct: 26073288 catatgccaaacatgaatac 26073269



to top

>emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa0021D06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 139684

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 38582 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 38641

               
Query: 61    gt 62
             ||
Sbjct: 38642 gt 38643



to top

>dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete genome
          Length = 141182

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 58615 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 58556

               
Query: 61    gt 62
             ||
Sbjct: 58555 gt 58554



to top

>dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome
          Length = 134494

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55190 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55131

               
Query: 61    gt 62
             ||
Sbjct: 55130 gt 55129



to top

>gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 263,766
Number of Sequences: 3902068
Number of extensions: 263766
Number of successful extensions: 27564
Number of sequences better than 10.0: 12079
Number of HSP's better than 10.0 without gapping: 12052
Number of HSP's successfully gapped in prelim test: 31
Number of HSP's that attempted gapping in prelim test: 15413
Number of HSP's gapped (non-prelim): 12154
length of query: 62
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 41
effective length of database: 17,151,101,840
effective search space: 703195175440
effective search space used: 703195175440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top