Clone Name	rbags9k05
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carbox...	111	2e-22
2	gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carbox...	111	2e-22
3	gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-...	111	2e-22
4	gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate car...	111	2e-22
5	gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carbox...	111	2e-22
6	gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxyl...	111	2e-22
7	gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate car...	111	2e-22
8	gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate c...	111	2e-22
9	gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-b...	111	2e-22
10	gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate c...	111	2e-22
11	gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carbox...	111	2e-22
12	gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate car...	111	2e-22
13	gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxyla...	111	2e-22
14	gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxy...	111	2e-22
15	gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxyl...	111	2e-22
16	gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo...	111	2e-22
17	gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carbo...	111	2e-22
18	gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carbo...	111	2e-22
19	gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate c...	111	2e-22
20	gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate ca...	111	2e-22
21	emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL ge...	111	2e-22
22	emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene fo...	111	2e-22
23	emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL ge...	111	2e-22
24	emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gen...	111	2e-22
25	emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL g...	111	2e-22
26	gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carbo...	111	2e-22
27	emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribul...	111	2e-22
28	emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribul...	111	2e-22
29	emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for rib...	111	2e-22
30	emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribul...	111	2e-22
31	emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for rib...	111	2e-22
32	emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ...	111	2e-22
33	emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for r...	111	2e-22
34	emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for r...	111	2e-22
35	emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ...	111	2e-22
36	emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF...	111	2e-22
37	emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, O...	111	2e-22
38	emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB	111	2e-22
39	gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bispho...	111	2e-22
40	gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose...	111	2e-22
41	gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose...	111	2e-22
42	gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate car...	111	2e-22
43	gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carb...	111	2e-22
44	gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-...	111	2e-22
45	gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisph...	111	2e-22
46	gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carbox...	111	2e-22
47	gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carbox...	111	2e-22
48	gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi...	111	2e-22
49	gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carbox...	111	2e-22
50	gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulo...	111	2e-22
51	gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate car...	111	2e-22
52	gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carbox...	111	2e-22
53	gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate ca...	111	2e-22
54	gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose...	111	2e-22
55	gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,...	111	2e-22
56	gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1...	111	2e-22
57	gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carb...	111	2e-22
58	gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carbo...	111	2e-22
59	gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxy...	111	2e-22
60	gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca...	111	2e-22
61	gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carbo...	111	2e-22
62	gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxy...	111	2e-22
63	gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph...	111	2e-22
64	gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisph...	111	2e-22
65	gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-...	111	2e-22
66	gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b...	111	2e-22
67	gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
68	gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
69	gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
70	gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
71	gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
72	gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
73	gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
74	gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
75	gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
76	gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
77	gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-vouch...	111	2e-22
78	gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H...	111	2e-22
79	gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H...	111	2e-22
80	gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H...	111	2e-22
81	gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H...	111	2e-22
82	gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H...	111	2e-22
83	gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H...	111	2e-22
84	emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ...	111	2e-22
85	emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene fo...	111	2e-22
86	emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partia...	111	2e-22
87	emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene ...	111	2e-22
88	emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene ...	111	2e-22
89	emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene ...	111	2e-22
90	emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for...	111	2e-22
91	emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL ...	111	2e-22
92	emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for...	111	2e-22
93	emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gen...	111	2e-22
94	emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene ...	111	2e-22
95	emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ri...	111	2e-22
96	gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxy...	111	2e-22
97	gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5...	111	2e-22
98	gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris vouche...	111	2e-22
99	gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose...	111	2e-22
100	gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher ...	111	2e-22
101	gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher ...	111	2e-22
102	gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis vouc...	111	2e-22
103	gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H880...	111	2e-22
104	gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H880...	111	2e-22
105	gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H880...	111	2e-22
106	gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5...	111	2e-22
107	gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carbo...	111	2e-22
108	gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate...	111	2e-22
109	gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosph...	111	2e-22
110	gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate car...	111	2e-22
111	gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate...	111	2e-22
112	gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxy...	111	2e-22
113	gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bispho...	111	2e-22
114	gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose...	111	2e-22
115	gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose...	111	2e-22
116	gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate ca...	111	2e-22
117	gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate car...	111	2e-22
118	gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carbo...	111	2e-22
119	gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate ca...	111	2e-22
120	gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bi...	111	2e-22
121	gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisph...	111	2e-22
122	gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-b...	111	2e-22
123	gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate ca...	111	2e-22
124	gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulo...	111	2e-22
125	gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphat...	111	2e-22
126	gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carbo...	111	2e-22
127	gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate ...	111	2e-22
128	gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate ca...	111	2e-22
129	gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carb...	111	2e-22
130	gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carbo...	111	2e-22
131	gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate car...	111	2e-22
132	gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxy...	111	2e-22
133	gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate...	111	2e-22
134	gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosph...	111	2e-22
135	gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphat...	111	2e-22
136	gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate car...	111	2e-22
137	gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate car...	111	2e-22
138	gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxy...	111	2e-22
139	gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxy...	111	2e-22
140	gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphospha...	111	2e-22
141	dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome	111	2e-22
142	gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydroge...	111	2e-22
143	emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene fo...	111	2e-22
144	emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribu...	111	2e-22
145	gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5...	111	2e-22
146	dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ri...	111	2e-22
147	gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate c...	107	3e-21
148	gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica vou...	105	1e-20
149	emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribul...	105	1e-20
150	gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate ca...	103	5e-20
151	gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate c...	103	5e-20
152	gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate car...	103	5e-20
153	gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate ca...	103	5e-20
154	gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate car...	103	5e-20
155	emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL...	103	5e-20
156	emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene...	103	5e-20
157	emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL ge...	103	5e-20
158	emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ri...	103	5e-20
159	emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL...	103	5e-20
160	emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbc...	103	5e-20
161	gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate ca...	103	5e-20
162	gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphat...	103	5e-20
163	gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphospha...	103	5e-20
164	emb|AJ746255.1| Aira praecox chloroplast partial rbcL gene for r...	101	2e-19
165	gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carbox...	100	7e-19
166	gb|AY137446.1| Hordeum patagonicum subsp. mustersii ribulose-1,5...	100	7e-19
167	gb|AY632375.1| Zoysia sp. JID-2004 ribulose-1,5-bisphosphate car...	96	1e-17
168	gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carbo...	96	1e-17
169	gb|AY632373.1| Uniola paniculata ribulose-1,5-bisphosphate carbo...	96	1e-17
170	gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carbox...	96	1e-17
171	gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carbox...	96	1e-17
172	gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxyl...	96	1e-17
173	gb|AY632363.1| Distichlis spicata ribulose-1,5-bisphosphate carb...	96	1e-17
174	gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosp...	96	1e-17
175	ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative...	96	1e-17
176	gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carbo...	96	1e-17
177	gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate ca...	96	1e-17
178	gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate car...	96	1e-17
179	gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate ca...	96	1e-17
180	gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate car...	96	1e-17
181	gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar N...	96	1e-17
182	gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA...	96	1e-17
183	gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-1...	96	1e-17
184	gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carb...	96	1e-17
185	emb|AJ784836.1| Muhlenbergia racemosa chloroplast partial rbcL g...	96	1e-17
186	emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene fo...	96	1e-17
187	emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL g...	96	1e-17
188	emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene fo...	96	1e-17
189	emb|AJ784829.1| Bouteloua gracilis chloroplast partial rbcL gene...	96	1e-17
190	emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gen...	96	1e-17
191	emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL ...	96	1e-17
192	emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gen...	96	1e-17
193	gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1...	96	1e-17
194	gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA...	96	1e-17
195	gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N...	96	1e-17
196	emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for...	96	1e-17
197	emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene...	96	1e-17
198	emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chlor...	96	1e-17
199	emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for...	96	1e-17
200	emb|AJ746299.1| Phragmites australis chloroplast partial rbcL ge...	96	1e-17
201	emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for r...	96	1e-17
202	emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene f...	96	1e-17
203	emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene fo...	96	1e-17
204	emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL ...	96	1e-17
205	emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL...	96	1e-17
206	emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for r...	96	1e-17
207	emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL g...	96	1e-17
208	emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gen...	96	1e-17
209	emb|AJ746274.1| Phragmites sp. TH-203 chloroplast partial rbcL g...	96	1e-17
210	emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene f...	96	1e-17
211	emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for r...	96	1e-17
212	emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene...	96	1e-17
213	emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL g...	96	1e-17
214	emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene fo...	96	1e-17
215	emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL g...	96	1e-17
216	emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for...	96	1e-17
217	gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxyl...	96	1e-17
218	gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome...	96	1e-17
219	gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast,...	96	1e-17
220	gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxyl...	96	1e-17
221	gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate ...	96	1e-17
222	gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar N...	96	1e-17
223	gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bispho...	96	1e-17
224	gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carb...	96	1e-17
225	gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosph...	96	1e-17
226	gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carb...	96	1e-17
227	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
228	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
229	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
230	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
231	gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate c...	96	1e-17
232	gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate car...	96	1e-17
233	gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate...	96	1e-17
234	gb|AY622898.1| Piptatherum miliaceum ribulose-1,5-bisphosphate c...	96	1e-17
235	gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxy...	96	1e-17
236	gb|AY622896.1| Nassella viridula ribulose-1,5-bisphosphate carbo...	96	1e-17
237	gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carbo...	96	1e-17
238	gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-...	96	1e-17
239	dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
240	dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
241	dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic D...	96	1e-17
242	dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-17
243	dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-17
244	dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-17
245	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	96	1e-17
246	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	96	1e-17
247	emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa...	96	1e-17
248	dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete ...	96	1e-17
249	dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome	96	1e-17
250	gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosph...	96	1e-17
251	gb|M91626.1|BAMCPRBCL Bamboo chloroplast ribulosebisphosphate (r...	96	1e-17
252	gb|U31381.1|TBU31381 Tristachya biseriata ribulose-1,5-bisphosph...	96	1e-17
253	gb|U31442.1|SDU31442 Stipa dregeana var. dregeana ribulose-1,5-b...	96	1e-17
254	gb|U31438.1|MMU31438 Merxmuellera macowanii ribulose-1,5-bisphos...	96	1e-17
255	gb|U31439.1|MJU31439 Moliniopsis japonica ribulose-1,5-bisphosph...	96	1e-17
256	gb|U31105.1|GSU31105 Gynerium sagittatum ribulose-1,5-bisphospha...	96	1e-17
257	gb|U31104.1|ECU31104 Eragrostis capensis ribulose-1,5-bisphospha...	96	1e-17
258	gb|U31101.1|CLU31101 Chasmanthium latifolium ribulose-1,5-bispho...	96	1e-17
259	gb|U31100.1|CGU31100 Centropodia glauca ribulose-1,5-bisphosphat...	96	1e-17
260	emb|X04789.1|CHOSRBCL Rice chloroplast DNA for ribulose-1,5-biph...	96	1e-17
261	gb|U13231.1|LHU13231 Lithachne humilis chloroplast ribulose-1,5-...	96	1e-17
262	gb|L14623.1|PENCARBOXL Pennisetum glaucum ribulosebiphosphate ca...	96	1e-17
263	gb|L14622.1|CEHRBCL Cenchrus setigerus chloroplast ribulose 1,5-...	96	1e-17
264	dbj|D00207.1|RICCPRBCL Oryza sativa chloroplast gene for ribulos...	96	1e-17
265	gb|AY601672.1| Hordeum secalinum ribulose-1,5-bisphosphate carbo...	94	4e-17
266	gb|AY632366.1| Micraira subulifolia ribulose-1,5-bisphosphate ca...	92	2e-16
267	gb|AY626351.1| Eriachne triseta ribulose 1,5-bisphosphate carbox...	92	2e-16
268	gb|AF352580.1| Eriachne triodioides ribulose-1,5-bisphosphate ca...	92	2e-16
269	gb|AY618660.1| Arundinaria gigantea ribulose 1,5-bisphosphate ca...	92	2e-16
270	gb|U31378.1|SZU31378 Stipagrostis zeyheri subsp. zeyheri ribulos...	92	2e-16
271	gb|AY632369.1| Pariana radiciflora ribulose-1,5-bisphosphate car...	88	3e-15
272	gb|AY506529.1| Zea mays strain NB mitochondrion, complete genome	88	3e-15
273	gb|DQ490952.1| Zea mays subsp. mays genotype male-fertile NA mit...	88	3e-15
274	gb|DQ490951.1| Zea mays subsp. mays genotype CMS-S mitochondrion...	88	3e-15
275	emb|AJ784822.1| Festuca rubra subsp. juncea chloroplast partial ...	88	3e-15
276	emb|Z11973.1|CHZMRBCLG Z.mays chloroplast rbcL gene for ribulose...	88	3e-15
277	emb|X86563.2|ZMA86563 Zea mays complete chloroplast genome	88	3e-15
278	emb|V00171.1|CHZM02 Zea mays chloroplast gene for the large subu...	88	3e-15
279	emb|AJ746288.1| Cyperochloa hirsuta chloroplast partial rbcL gen...	88	3e-15
280	emb|AJ746283.1| Aristida congesta subsp. barbicollis chloroplast...	88	3e-15
281	emb|AJ746280.1| Agrostis stolonifera chloroplast partial rbcL ge...	88	3e-15
282	emb|AJ746278.1| Sasa palmata chloroplast partial rbcL gene for r...	88	3e-15
283	emb|AJ746277.1| Yushania maling chloroplast partial rbcL gene fo...	88	3e-15
284	emb|AJ746273.1| Pseudosasa amabilis chloroplast partial rbcL gen...	88	3e-15
285	emb|AJ746272.1| Phyllostachys nigra chloroplast partial rbcL gen...	88	3e-15
286	emb|AJ746270.1| Oligostachyum oedogonatum chloroplast partial rb...	88	3e-15
287	emb|AJ746267.1| Hibanobambusa tranquillans chloroplast partial r...	88	3e-15
288	emb|AJ746266.1| Fargesia dracocephala chloroplast partial rbcL g...	88	3e-15
289	emb|AJ746265.1| Drepanostachyum falcatum chloroplast partial rbc...	88	3e-15
290	emb|AJ746261.1| Festuca rubra chloroplast partial rbcL gene for ...	88	3e-15
291	emb|AJ746259.1| Brachystachyum densiflorum chloroplast partial r...	88	3e-15
292	emb|AJ746179.1| Arundinaria tecta chloroplast partial rbcL gene ...	88	3e-15
293	emb|AJ746178.1| Arundinaria oedogonata chloroplast partial rbcL ...	88	3e-15
294	emb|AJ746177.1| Indocalamus latifolius chloroplast partial rbcL ...	88	3e-15
295	emb|AJ746176.1| Chimonobambusa marmorea chloroplast partial rbcL...	88	3e-15
296	gb|AY167975.1| Zea mays ribulose-1,5-bisphosphate carboxylase/ox...	88	3e-15
297	gb|U88404.1|CHU88404 Cyperochloa hirsuta ribulose-1,5-bisphospha...	88	3e-15
298	gb|U31359.1|ACU31359 Aristida congesta subsp. barbicollis ribulo...	88	3e-15
299	gb|AY622892.1| Eremitis sp. MRD-2004 ribulose-1,5-bisphosphate c...	88	3e-15
300	gb|AY622888.1| Brachyelytrum erectum ribulose-1,5-bisphosphate c...	88	3e-15
301	gb|AY928077.1| Zea mays cultivar B73 chloroplast, complete genome	88	3e-15
302	dbj|AB088833.1| Phyllostachys bambusoides chloroplast rbcL gene ...	88	3e-15
303	gb|L05043.2|ZIZCPRBCL Zizania texana ribulose 1,5-bisphosphate c...	88	3e-15
304	emb|AM110249.1| Fargesia sp. Asmussen 105 plastid partial rbcL g...	88	3e-15
305	gb|U31379.1|MPU31379 Monachather paradoxus ribulose-1,5-bisphosp...	88	3e-15
306	gb|U31436.1|HHU31436 Hyparrhenia hirta ribulose-1,5-bisphosphate...	88	3e-15
307	gb|U31103.1|ESU31103 Enneapogon scaber ribulose-1,5-bisphosphate...	88	3e-15
308	emb|X79900.1|SILCRBCL S.italica L. chloroplast rbcL gene	88	3e-15
309	gb|U13230.1|PBU13230 Phyllostachys bambusoides chloroplast ribul...	88	3e-15
310	dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond...	88	3e-15
311	gb|AY632372.1| Streptochaeta sodiroana ribulose-1,5-bisphosphate...	84	4e-14
312	gb|AY691638.1| Pyrrhanthera exigua ribulose-1,5-bisphosphate car...	84	4e-14
313	gb|DQ005609.1| Cortaderia selloana ribulose-1,5-bisphosphate car...	84	4e-14
314	emb|AJ784830.1| Cortaderia richardii chloroplast partial rbcL ge...	84	4e-14
315	emb|AJ746260.1| Cortaderia sp. TH-158 chloroplast partial rbcL g...	84	4e-14
316	gb|AY216650.1| Luzula nivea ribulose-1,5-bisphosphate carboxylas...	84	4e-14
317	gb|AY034250.1| Wolffia borealis ribulose-1,5-biphosphate carboxy...	84	4e-14
318	gb|AY034248.1| Wolffia brasiliensis ribulose-1,5-biphosphate car...	84	4e-14
319	gb|AY034227.1| Lemna tenera ribulose-1,5-biphosphate carboxylase...	84	4e-14
320	gb|U80704.1|LSU80704 Limnobium spongia ribulose-1,5-bisphosphate...	84	4e-14
321	gb|U80701.1|HMU80701 Hydrocharis morsus-ranae ribulose-1,5-bisph...	84	4e-14
322	gb|U31441.1|RNU31441 Rytidosperma nudiflorum ribulose-1,5-bispho...	84	4e-14
323	gb|U31440.1|PPU31440 Plinthanthesis paradoxa ribulose-1,5-bispho...	84	4e-14
324	gb|U31437.1|KPU31437 Karroochloa purpurea ribulose-1,5-bisphosph...	84	4e-14
325	gb|U31102.1|DSU31102 Danthonia spicata ribulose-1,5-bisphosphate...	84	4e-14
326	emb|AJ419949.1|SSP419949 Streptochaeta spicata chloroplast parti...	84	4e-14
327	dbj|AB004894.1| Limnobium laevigatum chloroplast rbcL gene for r...	84	4e-14
328	dbj|AB004892.1| Hydrocharis dubia chloroplast rbcL gene for ribu...	84	4e-14
329	gb|AY632371.1| Spartina pectinata ribulose-1,5-bisphosphate carb...	80	7e-13
330	gb|AF148766.1| Centrolepis strigosa ribulose-1,5-bisphosphate ca...	80	7e-13
331	emb|AJ784821.1| Spartina pectinata chloroplast partial rbcL gene...	80	7e-13
332	emb|AJ784819.1| Arthraxon sp. mvdb-G3 chloroplast partial rbcL g...	80	7e-13
333	gb|AY357724.1| Pharus latifolius ribulose-1,5-bisphosphate carbo...	80	7e-13
334	emb|AJ746254.1| Arthrostylidium sp. TH-53B chloroplast partial r...	80	7e-13
335	emb|AJ746253.1| Arthraxon sp. TH-111 chloroplast partial rbcL ge...	80	7e-13
336	emb|AJ419950.1|PPA419950 Pharus parvifolius chloroplast partial ...	80	7e-13
337	emb|AJ286558.1|CST286558 Centrolepis strigosa chloroplast partia...	80	7e-13
338	gb|AY622894.1| Lygeum spartum ribulose-1,5-bisphosphate carboxyl...	80	7e-13
339	gb|U13227.1|CCU13227 Chusquea circinata chloroplast ribulose-1,5...	80	7e-13
340	gb|AY395548.1| Luzula campestris ribulose-1,5-bisphosphate carbo...	76	1e-11
341	gb|AY395543.1| Juncus articulatus ribulose-1,5-bisphosphate carb...	76	1e-11
342	gb|L10248.2|MNACPRBCL Montrichardia arborescens ribulose 1,5-bis...	76	1e-11
343	gb|L10246.2|XAOCPRBCL Xanthosoma sagittifolium ribulose 1,5-bisp...	76	1e-11
344	emb|Y12968.1|SDY12968 S.distans rbcL gene	76	1e-11
345	emb|Y12947.1|STY12947 S.terrestris rbcL gene	76	1e-11
346	emb|AJ746296.1| Nardus stricta chloroplast partial rbcL gene for...	76	1e-11
347	emb|AJ419947.1|RMA419947 Rostkovia magellanica chloroplast parti...	76	1e-11
348	emb|AJ419946.1|MGR419946 Marsippospermum grandiflorum chloroplas...	76	1e-11
349	emb|AJ419945.1|LMU419945 Luzula multiflora chloroplast partial r...	76	1e-11
350	emb|AJ419944.1|DAC419944 Distichia acicularis chloroplast partia...	76	1e-11
351	gb|AF497112.1| Hapaline sp. HAR 056 ribulose-1,5-bisphosphate ca...	76	1e-11
352	gb|AF497110.1| Filarum manserichense ribulose-1,5-bisphosphate c...	76	1e-11
353	gb|AY216603.1| Juncus hallii ribulose-1,5-bisphosphate carboxyla...	76	1e-11
354	gb|AY216655.1| Luzula canariensis ribulose-1,5-bisphosphate carb...	76	1e-11
355	gb|AY216654.1| Luzula purpureosplendens ribulose-1,5-bisphosphat...	76	1e-11
356	gb|AY216653.1| Luzula pilosa ribulose-1,5-bisphosphate carboxyla...	76	1e-11
357	gb|AY216652.1| Luzula campestris ribulose-1,5-bisphosphate carbo...	76	1e-11
358	gb|AY216651.1| Luzula arcuata ribulose-1,5-bisphosphate carboxyl...	76	1e-11
359	gb|AY216649.1| Luzula wahlenbergii ribulose-1,5-bisphosphate car...	76	1e-11
360	gb|AY216647.1| Luzula sudetica ribulose-1,5-bisphosphate carboxy...	76	1e-11
361	gb|AY216646.1| Luzula divulgata ribulose-1,5-bisphosphate carbox...	76	1e-11
362	gb|AY216645.1| Luzula spicata ribulose-1,5-bisphosphate carboxyl...	76	1e-11
363	gb|AY216644.1| Luzula glabrata ribulose-1,5-bisphosphate carboxy...	76	1e-11
364	gb|AY216643.1| Luzula novaecambriae ribulose-1,5-bisphosphate ca...	76	1e-11
365	gb|AY216641.1| Luzula meridionalis ribulose-1,5-bisphosphate car...	76	1e-11
366	gb|AY216640.1| Luzula gigantea ribulose-1,5-bisphosphate carboxy...	76	1e-11
367	gb|AY216636.1| Luzula nodulosa ribulose-1,5-bisphosphate carboxy...	76	1e-11
368	gb|AY216635.1| Luzula traversii ribulose-1,5-bisphosphate carbox...	76	1e-11
369	gb|AY216634.1| Luzula johnstonii ribulose-1,5-bisphosphate carbo...	76	1e-11
370	gb|AY216633.1| Luzula kjellmanniana ribulose-1,5-bisphosphate ca...	76	1e-11
371	gb|AY216632.1| Luzula luzulina ribulose-1,5-bisphosphate carboxy...	76	1e-11
372	gb|AY216631.1| Juncus oxycarpus ribulose-1,5-bisphosphate carbox...	76	1e-11
373	gb|AY216630.1| Juncus subnodulosus ribulose-1,5-bisphosphate car...	76	1e-11
374	gb|AY216629.1| Juncus maritimus ribulose-1,5-bisphosphate carbox...	76	1e-11
375	gb|AY216628.1| Juncus himalensis ribulose-1,5-bisphosphate carbo...	76	1e-11
376	gb|AY216627.1| Juncus repens ribulose-1,5-bisphosphate carboxyla...	76	1e-11
377	gb|AY216625.1| Juncus compressus ribulose-1,5-bisphosphate carbo...	76	1e-11
378	gb|AY216624.1| Juncus xiphioides ribulose-1,5-bisphosphate carbo...	76	1e-11
379	gb|AY216622.1| Juncus bulbosus ribulose-1,5-bisphosphate carboxy...	76	1e-11
380	gb|AY216621.1| Juncus oxymeris ribulose-1,5-bisphosphate carboxy...	76	1e-11
381	gb|AY216618.1| Juncus trifidus ribulose-1,5-bisphosphate carboxy...	76	1e-11
382	gb|AY216617.1| Juncus lomatophyllus ribulose-1,5-bisphosphate ca...	76	1e-11
383	gb|AY216616.1| Juncus capensis ribulose-1,5-bisphosphate carboxy...	76	1e-11
384	gb|AY216614.1| Juncus articulatus ribulose-1,5-bisphosphate carb...	76	1e-11
385	gb|AY216613.1| Juncus gerardii ribulose-1,5-bisphosphate carboxy...	76	1e-11
386	gb|AY216612.1| Juncus effusus ribulose-1,5-bisphosphate carboxyl...	76	1e-11
387	gb|AY216611.1| Juncus ensifolius ribulose-1,5-bisphosphate carbo...	76	1e-11
388	gb|AY216610.1| Juncus stygius ribulose-1,5-bisphosphate carboxyl...	76	1e-11
389	gb|AY216609.1| Juncus kraussii ribulose-1,5-bisphosphate carboxy...	76	1e-11
390	gb|AY216608.1| Juncus vaginatus ribulose-1,5-bisphosphate carbox...	76	1e-11
391	gb|AY216607.1| Juncus dichotomus ribulose-1,5-bisphosphate carbo...	76	1e-11
392	gb|AY216606.1| Juncus covillei ribulose-1,5-bisphosphate carboxy...	76	1e-11
393	gb|AY216605.1| Juncus triglumis ribulose-1,5-bisphosphate carbox...	76	1e-11
394	gb|AY216604.1| Juncus capillaceus ribulose-1,5-bisphosphate carb...	76	1e-11
395	gb|AY216602.1| Juncus imbricatus ribulose-1,5-bisphosphate carbo...	76	1e-11
396	gb|AY034258.1| Wolffia elongata ribulose-1,5-biphosphate carboxy...	76	1e-11
397	gb|AY034257.1| Wolffia globosa ribulose-1,5-biphosphate carboxyl...	76	1e-11
398	gb|AY034256.1| Wolffia cylindracea ribulose-1,5-biphosphate carb...	76	1e-11
399	gb|AY034255.1| Wolffia columbiana ribulose-1,5-biphosphate carbo...	76	1e-11
400	gb|AY034254.1| Wolffia arrhiza ribulose-1,5-biphosphate carboxyl...	76	1e-11
401	gb|AY034253.1| Wolffia angusta ribulose-1,5-biphosphate carboxyl...	76	1e-11
402	gb|AY034252.1| Wolffia neglecta ribulose-1,5-biphosphate carboxy...	76	1e-11
403	gb|AY034247.1| Wolffiella denticulata ribulose-1,5-biphosphate c...	76	1e-11
404	gb|AY034246.1| Wolffiella neotropica ribulose-1,5-biphosphate ca...	76	1e-11
405	gb|AY034245.1| Wolffiella welwitschii ribulose-1,5-biphosphate c...	76	1e-11
406	gb|AY034244.1| Wolffiella caudata ribulose-1,5-biphosphate carbo...	76	1e-11
407	gb|AY034243.1| Wolffiella gladiata ribulose-1,5-biphosphate carb...	76	1e-11
408	gb|AY034242.1| Wolffiella oblonga ribulose-1,5-biphosphate carbo...	76	1e-11
409	gb|AY034240.1| Wolffiella hyalina ribulose-1,5-biphosphate carbo...	76	1e-11
410	gb|AY034239.1| Wolffiella repanda ribulose-1,5-biphosphate carbo...	76	1e-11
411	gb|AY034238.1| Wolffiella rotunda ribulose-1,5-biphosphate carbo...	76	1e-11
412	gb|AY034236.1| Lemna disperma ribulose-1,5-biphosphate carboxyla...	76	1e-11
413	gb|AY034232.1| Lemna obscura ribulose-1,5-biphosphate carboxylas...	76	1e-11
414	gb|AY034231.1| Lemna ecuadoriensis ribulose-1,5-biphosphate carb...	76	1e-11
415	gb|AY034230.1| Lemna turionifera ribulose-1,5-biphosphate carbox...	76	1e-11
416	gb|AY034229.1| Lemna perpusilla ribulose-1,5-biphosphate carboxy...	76	1e-11
417	gb|AY034228.1| Lemna aequinoctialis ribulose-1,5-biphosphate car...	76	1e-11
418	gb|AY034225.1| Lemna valdiviana ribulose-1,5-biphosphate carboxy...	76	1e-11
419	gb|AY034224.1| Lemna minuta ribulose-1,5-biphosphate carboxylase...	76	1e-11
420	gb|AY012494.1| Drymophloeus beguinii ribulose bisphosphate carbo...	76	1e-11
421	gb|AY012493.1| Balaka seemannii ribulose bisphosphate carboxylas...	76	1e-11
422	gb|M91630.1|LGICPRBCL Lemna minuta ribulose 1,5-bisphosphate car...	76	1e-11
423	gb|AY660588.1| Oxychloe andina voucher Brooks 20583 (C1436) ribu...	76	1e-11
424	gb|AY660585.1| Oxychloe castellanosii voucher H319/2 ribulose-1,...	76	1e-11
425	gb|AF537122.1| Trichomanes cuspidatum ribulose-1,5-bisphosphate ...	76	1e-11
426	gb|AY622895.1| Nardus stricta ribulose-1,5-bisphosphate carboxyl...	76	1e-11
427	emb|AM110235.1| Ptychosperma macarthurii plastid partial rbcL ge...	76	1e-11
428	gb|DQ058339.1| Scleria distans ribulose-1,5-bisphosphate carboxy...	76	1e-11
429	gb|AF249647.1| Microstrobos niphophilus ribulose-1,5-bisphosphat...	76	1e-11
430	gb|U49226.1|MGU49226 Marsippospermum grandiflorum ribulose-1,5-b...	76	1e-11
431	gb|U49228.1|LPU49228 Luzula parviflora ribulose-1,5-bisphosphate...	76	1e-11
432	gb|L12681.1|JUCCPRBCLA Juncus effusus chloroplast ribulosebispho...	76	1e-11
433	gb|M81812.1|DRYCPRBCL Drymopnlaeus subdisticha chloroplast ribul...	76	1e-11
434	emb|AJ007543.1|XMA7543 Xanthosoma mafaffa rbcL gene, partial	76	1e-11
435	emb|Y09197.1|TMY09197 T.membranaceum chloroplast rbcL gene, partial	76	1e-11
436	emb|Y09192.1|TEY09192 T.ekmanii chloroplast rbcL gene, partial	76	1e-11
437	emb|AJ005627.1|ASAJ5627 Anthuriumscherzerianum chloroplast rbcL ...	76	1e-11
438	emb|Z77281.1|SCZ77281 S.capensis chloroplast rbcL gene	76	1e-11
439	gb|AY614389.1| Bromelia plumieri MB-119 atpB-rbcL intergenic spa...	76	1e-11
440	gb|AY614385.1| Lindmania guianensis MB-112 atpB-rbcL intergenic ...	76	1e-11
441	emb|AJ286563.1|XCA286563 Xyris capensis chloroplast partial rbcL...	74	4e-11
442	gb|AY034241.1| Wolffiella lingulata ribulose-1,5-biphosphate car...	74	4e-11
443	gb|AY034226.1| Lemna yungensis ribulose-1,5-biphosphate carboxyl...	74	4e-11
444	gb|AF206834.1| Xyris sp. Chase 154 ribulose 1,5-bisphosphate car...	74	4e-11
445	gb|U49224.1|RMU49224 Rostkovia magellanica ribulose-1,5-bisphosp...	74	4e-11
446	gb|U49227.1|DMU49227 Distichia muscoides ribulose-1,5-bisphospha...	74	4e-11
447	gb|AY320253.1| Vesicularia reticulata ribulose-1,5-bisphosphate ...	72	2e-10
448	gb|AC133248.4| Oryza sativa (japonica cultivar-group) chromosome...	72	2e-10
449	gb|AY312938.1| Timmia megapolitana ribulose 1,5-bisphosphate car...	72	2e-10
450	gb|AC134256.4| Oryza sativa (japonica cultivar-group), complete ...	72	2e-10
451	gb|AY368371.1| Thecostele alata ribulose-1,5-bisphosphate carbox...	72	2e-10
452	gb|AY368370.1| Scuticaria hadwenii ribulose-1,5-bisphosphate car...	72	2e-10
453	gb|AY368360.1| Hexadesmia sp. Chase O-336 ribulose-1,5-bisphosph...	72	2e-10
454	gb|AY368356.1| Cymbidium eburneum ribulose-1,5-bisphosphate carb...	72	2e-10
455	gb|AY368341.1| Gennaria diphylla ribulose-1,5-bisphosphate carbo...	72	2e-10
456	gb|AF148773.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate...	72	2e-10
457	gb|AF264167.1| Eulophia petersii ribulose-1,5-bisphosphate carbo...	72	2e-10
458	gb|AF491014.1| Timmia austriaca 162 ribulose-1,5-bisphosphate ca...	72	2e-10
459	emb|AJ286559.1|EMO286559 Ecdeiocolea monostachya chloroplast par...	72	2e-10
460	emb|AJ275185.1|TAU275185 Timmia austriaca chloroplast partial rb...	72	2e-10
461	emb|AJ275166.1|TSI275166 Timmia sibirica chloroplast partial rbc...	72	2e-10
462	gb|AF344490.1|AF344490 Lasiocarpus sp. KMC-2001 ribulose-1,5-bis...	72	2e-10
463	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	72	2e-10
464	gb|AF226815.1|AF226815 Campylopus eberhardtii ribulose-1,5-bisph...	72	2e-10
465	gb|AF074235.1|AF074235 Trichotosia ferox ribulose-1,5-bisphospha...	72	2e-10
466	gb|AF074230.1|AF074230 Stanhopea ecornuta ribulose-1,5-bisphosph...	72	2e-10
467	gb|AF074222.1|AF074222 Polystachya pubescens ribulose-1,5-bispho...	72	2e-10
468	gb|AF074211.1|AF074211 Phalaenopsis equestris ribulose-1,5-bisph...	72	2e-10
469	gb|AF074197.1|AF074197 Neofinetia falcata ribulose-1,5-bisphosph...	72	2e-10
470	gb|AF074192.1|AF074192 Meiracyllium trinasutum ribulose-1,5-bisp...	72	2e-10
471	gb|AF074176.1|AF074176 Grammatophyllum speciosum ribulose-1,5-bi...	72	2e-10
472	gb|AF074170.1|AF074170 Eulophia nuda ribulose-1,5-bisphosphate c...	72	2e-10
473	gb|AF074157.1|AF074157 Encyclia sp. KMC1998 ribulose-1,5-bisphos...	72	2e-10
474	gb|AF074148.1|AF074148 Diceratostele gabonensis ribulose-1,5-bis...	72	2e-10
475	gb|AF074147.1|AF074147 Diaphananthe rutila ribulose-1,5-bisphosp...	72	2e-10
476	gb|AF074122.1|AF074122 Cattleya dowiana ribulose-1,5-bisphosphat...	72	2e-10
477	gb|AF074106.1|AF074106 Angraecum sesquipedale ribulose-1,5-bisph...	72	2e-10
478	gb|AF074104.1|AF074104 Aeranthes ramosa ribulose-1,5-bisphosphat...	72	2e-10
479	gb|AF233578.1|AF233578 Lepidopilum surinamense ribulose 1,5-bisp...	72	2e-10
480	gb|AF158175.1|AF158175 Pterobryon densum ribulose 1,5-bisphospha...	72	2e-10
481	gb|AF478242.1| Timmia megapolitana ribulose 1,5-bisphosphate car...	72	2e-10
482	gb|AF478202.1| Oedipodium griffithianum ribulose 1,5-bisphosphat...	72	2e-10
483	gb|AF074130.1| Cleisostoma rolfeanum ribulose-1,5-bisphosphate c...	72	2e-10
484	gb|AF074103.1| Aerangis calligera ribulose-1,5-bisphosphate carb...	72	2e-10
485	gb|AY123235.1| Ecdeiocolea monostachya ribulose-1,5-bisphosphate...	72	2e-10
486	gb|AY123233.1| Aphelia cyperoides ribulose-1,5-bisphosphate carb...	72	2e-10
487	emb|AJ542427.1|EBO542427 Eurystyles borealis plastid partial rbc...	72	2e-10
488	gb|AF518075.1| Sophronitis mirandae specimen-voucher MWC1208 rib...	72	2e-10
489	gb|AF518073.1| Sophronitis harpophylla specimen-voucher MWC1249 ...	72	2e-10
490	gb|AF518072.1| Sophronitis coccinea specimen-voucher C237 ribulo...	72	2e-10
491	gb|AF518071.1| Cattleya violacea specimen-voucher MWC1261 ribulo...	72	2e-10
492	gb|AF518070.1| Laelia speciosa specimen-voucher MWC6088 ribulose...	72	2e-10
493	gb|AF518069.1| Broughtonia sanguinea specimen-voucher MWC1191 ri...	72	2e-10
494	gb|AF518067.1| Scaphyglottis modesta specimen-voucher MWC1243 ri...	72	2e-10
495	gb|AF518066.1| Hexadesmia crurigera specimen-voucher MWC336 ribu...	72	2e-10
496	gb|AF518064.1| Scaphyglottis punctulata specimen-voucher MWC299 ...	72	2e-10
497	gb|AF518063.1| Prosthechea abbreviata specimen-voucher MWC5942 r...	72	2e-10
498	gb|AF518062.1| Encyclia oncidioides specimen-voucher MWC5938 rib...	72	2e-10
499	gb|AF518061.1| Dinema polybulbon specimen-voucher MWC1233 ribulo...	72	2e-10
500	gb|AF518060.1| Epidendrum campestre specimen-voucher C242 ribulo...	72	2e-10

---

>gb|AY772669.1| Elymus sibiricus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) mRNA, complete cds; chloroplast
          Length = 1510

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1212 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1153

              
Query: 61   gt 62
            ||
Sbjct: 1152 gt 1151

---

>gb|AY691646.1| Trisetum youngii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691645.1| Koeleria aff. novozelandica AK28214 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691643.1| Puccinellia stricta ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691642.1| Elymus solanderi ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691641.1| Simplicia laxa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691640.1| Stenostachys laevis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691639.1| Stenostachys gracilis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1333

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1135 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1076

              
Query: 61   gt 62
            ||
Sbjct: 1075 gt 1074

---

>gb|AY691636.1| Australopyrum calcis subsp. calcis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691635.1| Deschampsia cespitosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691632.1| Bromus arenarius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY395565.1| Trisetum flavescens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1323

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1122 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1063

              
Query: 61   gt 62
            ||
Sbjct: 1062 gt 1061

---

>gb|AY395555.1| Poa trivialis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1287

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1104 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1045

              
Query: 61   gt 62
            ||
Sbjct: 1044 gt 1043

---

>gb|AY395554.1| Phleum pratense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1332

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1125 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1066

              
Query: 61   gt 62
            ||
Sbjct: 1065 gt 1064

---

>gb|AY395547.1| Lolium perenne ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1296

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1120 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1061

              
Query: 61   gt 62
            ||
Sbjct: 1060 gt 1059

---

>gb|AY395541.1| Hordeum secalinum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1299

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1123 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1064

              
Query: 61   gt 62
            ||
Sbjct: 1063 gt 1062

---

>gb|AY395539.1| Glyceria fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1105 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1046

              
Query: 61   gt 62
            ||
Sbjct: 1045 gt 1044

---

>gb|AY395531.1| Bromus hordeaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1350

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>gb|AY395529.1| Arrhenatherum elatius ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1259

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1100 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1041

              
Query: 61   gt 62
            ||
Sbjct: 1040 gt 1039

---

>gb|AY395528.1| Alopecurus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit-like protein (rbcL) gene, partial sequence;
            chloroplast
          Length = 1408

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ784837.1| Alopecurus pratensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ784832.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1345

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1151 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1092

              
Query: 61   gt 62
            ||
Sbjct: 1091 gt 1090

---

>emb|AJ784827.1| Phalaris arundinacea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1363

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1159 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1100

              
Query: 61   gt 62
            ||
Sbjct: 1099 gt 1098

---

>emb|AJ784825.1| Koeleria pyramidata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1349

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1145 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1086

              
Query: 61   gt 62
            ||
Sbjct: 1085 gt 1084

---

>emb|AJ784823.1| Arrhenatherum elatius chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1360

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1146 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1087

              
Query: 61   gt 62
            ||
Sbjct: 1086 gt 1085

---

>gb|AY328025.1| Triticum aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcl) mRNA, complete cds; chloroplast gene
            for chloroplast product
          Length = 1519

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1220 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1161

              
Query: 61   gt 62
            ||
Sbjct: 1160 gt 1159

---

>emb|Z49846.1|PSPCHRBPC P.spicata chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49845.1|PSCHRBPCX P.sanctum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49843.1|LCCHRBPCX L.chinensis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49841.1|HJCHRBPCX H.jubatum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49840.1|EECHRBPCX E.erianthum chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49839.1|ETCHRBPCX E.trachycaulus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49838.1|EPCHRBPCX E.patagonicus chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49837.1|EGCHRBPCX E.glaucescens chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|X62119.1|CHASHSRA A.squarrosa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
           large subunit of ribulose 1,5 bisphosphate
           carboxylase/oxygenase and apoprotein I
          Length = 3830

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 998 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 939

             
Query: 61  gt 62
           ||
Sbjct: 938 gt 937

---

>emb|X62118.1|CHACHSRG A.crassa chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
           large subunit of ribulose 1,5 bisphosphate
           carboxylase/oxygenase and apoprotein I
          Length = 4811

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 998 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 939

             
Query: 61  gt 62
           ||
Sbjct: 938 gt 937

---

>emb|X62117.1|CHTAHSRA T.aestivum chloroplast genes rbcL, psaI, ORF 185 and ORF 230 for
           large subunit of ribulose 1,5 bisphosphate
           carboxylase/oxygenase and apoprotein I
          Length = 4075

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 998 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 939

             
Query: 61  gt 62
           ||
Sbjct: 938 gt 937

---

>emb|X00630.1|CHHV02 Barley chloroplast genes rbcL and atpB
          Length = 2174

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 2056 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1997

              
Query: 61   gt 62
            ||
Sbjct: 1996 gt 1995

---

>gb|AY137462.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; chloroplast gene for chloroplast product
          Length = 1477

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1137 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1078

              
Query: 61   gt 62
            ||
Sbjct: 1077 gt 1076

---

>gb|AY137461.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY137460.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY137459.1| Hordeum roshevitzii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137458.1| Hordeum cordobense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137457.1| Hordeum patagonicum subsp. magellanicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137456.1| Hordeum vulgare subsp. vulgare ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137455.1| Hordeum bogdanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1612

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137454.1| Hordeum bulbosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137453.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137452.1| Hordeum pusillum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137451.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137450.1| Hordeum intercedens ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1610

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137449.1| Hordeum chilense ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137448.1| Hordeum stenostachys ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137447.1| Hordeum patagonicum subsp. santacrucense ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137445.1| Hordeum patagonicum subsp. setifolium ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137444.1| Hordeum patagonicum subsp. patagonicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137443.1| Hordeum pubiflorum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137442.1| Hordeum euclaston ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1606

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137441.1| Hordeum comosum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137440.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137439.1| Hordeum flexuosum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; chloroplast gene
            for chloroplast product
          Length = 1615

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137438.1| Hordeum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1621

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137437.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1628

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137436.1| Hordeum marinum subsp. marinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137435.1| Hordeum brevisubulatum subsp. violaceum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137434.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137433.1| Hordeum marinum subsp. gussoneanum specimen-voucher H28
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137432.1| Hordeum marinum subsp. gussoneanum specimen-voucher H161
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137431.1| Hordeum marinum subsp. gussoneanum specimen-voucher H837
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137430.1| Hordeum marinum subsp. gussoneanum specimen-voucher H832
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137429.1| Hordeum marinum subsp. gussoneanum specimen-voucher H828
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137428.1| Hordeum marinum subsp. gussoneanum specimen-voucher H826
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137427.1| Hordeum marinum subsp. gussoneanum specimen-voucher H824
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137426.1| Hordeum marinum subsp. gussoneanum specimen-voucher H823
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137425.1| Hordeum marinum subsp. gussoneanum specimen-voucher H820
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137424.1| Hordeum marinum subsp. gussoneanum specimen-voucher H81
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137423.1| Hordeum marinum subsp. gussoneanum specimen-voucher H64
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1616

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137422.1| Hordeum marinum subsp. marinum specimen-voucher H620
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137421.1| Hordeum marinum subsp. marinum specimen-voucher H607
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137420.1| Hordeum marinum subsp. marinum specimen-voucher H544
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137419.1| Hordeum marinum subsp. marinum specimen-voucher H522
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137418.1| Hordeum marinum subsp. marinum specimen-voucher H87
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY137417.1| Hordeum marinum subsp. marinum specimen-voucher H41
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast gene for
            chloroplast product
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>emb|AJ746301.1| Poa trivialis chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1287

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1104 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1045

              
Query: 61   gt 62
            ||
Sbjct: 1044 gt 1043

---

>emb|AJ746298.1| Phleum pratense chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1332

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1125 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1066

              
Query: 61   gt 62
            ||
Sbjct: 1065 gt 1064

---

>emb|AJ746293.1| Lolium perenne subsp. perenne chloroplast partial rbcL gene for
            ribulose bisphosphate carboxylase large chain
          Length = 1296

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1120 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1061

              
Query: 61   gt 62
            ||
Sbjct: 1060 gt 1059

---

>emb|AJ746292.1| Hordeum secalinum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1299

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1123 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1064

              
Query: 61   gt 62
            ||
Sbjct: 1063 gt 1062

---

>emb|AJ746290.1| Glyceria fluitans chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1105 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1046

              
Query: 61   gt 62
            ||
Sbjct: 1045 gt 1044

---

>emb|AJ746287.1| Bromus commutatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ746286.1| Bromus erectus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ746281.1| Alopecurus geniculatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1329

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1125 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1066

              
Query: 61   gt 62
            ||
Sbjct: 1065 gt 1064

---

>emb|AJ746279.1| Holcus lanatus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1301

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1130 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1071

              
Query: 61   gt 62
            ||
Sbjct: 1070 gt 1069

---

>emb|AJ746276.1| Trisetum flavescens chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1323

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1122 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1063

              
Query: 61   gt 62
            ||
Sbjct: 1062 gt 1061

---

>emb|AJ746262.1| Koeleria cristata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1370

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|AJ746257.1| Avena fatua chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>gb|AY601671.1| Hordeum capense ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1619

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY607060.1| Psathyrostachys caduca voucher H6702 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1617

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY607059.1| Psathyrostachys rupestris subsp. rupestris voucher H6701
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1611

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY607057.1| Psathyrostachys huashanica voucher H3087 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1594

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY607056.1| Psathyrostachys fragilis subsp. villosus voucher H4378
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY607055.1| Psathyrostachys fragilis subsp. villosus voucher H4375
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY607054.1| Psathyrostachys fragilis subsp. secaliformis voucher H4348
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1589

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1270 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1211

              
Query: 61   gt 62
            ||
Sbjct: 1210 gt 1209

---

>gb|AY607053.1| Psathyrostachys lanuginosa isolate C voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213

---

>gb|AY607052.1| Psathyrostachys lanuginosa isolate B voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213

---

>gb|AY607051.1| Psathyrostachys lanuginosa isolate A voucher H8803
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213

---

>gb|AY607050.1| Psathyrostachys juncea voucher H7544 ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast
          Length = 1614

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1274 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1215

              
Query: 61   gt 62
            ||
Sbjct: 1214 gt 1213

---

>gb|AY622890.1| Diarrhena obovata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY836185.1| Thinopyrum bessarabicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3054

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1128 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1069

              
Query: 61   gt 62
            ||
Sbjct: 1068 gt 1067

---

>gb|AY836184.1| Taeniatherum caput-medusae ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3179

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836183.1| Aegilops speltoides ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; and rbcL-psaI
            intergenic spacer, partial sequence; chloroplast
          Length = 2360

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836182.1| Pseudoroegneria spicata ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3138

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836181.1| Secale strictum ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3155

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836180.1| Psathyrostachys stoloniformis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2309

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1137 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1078

              
Query: 61   gt 62
            ||
Sbjct: 1077 gt 1076

---

>gb|AY836179.1| Psathyrostachys fragilis subsp. villosus ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            psaI gene, partial sequence; chloroplast
          Length = 3071

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836178.1| Psathyrostachys fragilis subsp. fragilis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836177.1| Crithopsis delileana ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2752

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836176.1| Peridictyon sanctum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3106

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836175.1| Aegilops tauschii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2136

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836174.1| Thinopyrum elongatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3158

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836173.1| Hordeum vulgare subsp. spontaneum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3110

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836172.1| Hordeum murinum subsp. glaucum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3095

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836171.1| Hordeum marinum subsp. gussoneanum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3108

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836170.1| Hordeum erectifolium ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3102

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836169.1| Hordeum brachyantherum subsp. californicum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3089

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836168.1| Heteranthelium piliferum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2371

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836167.1| Henrardia persica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2372

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836166.1| Festucopsis serpentini ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 3166

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836165.1| Eremopyrum triticeum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2366

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836164.1| Eremopyrum distans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2374

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836163.1| Haynaldia villosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3190

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836162.1| Triticum monococcum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3192

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836161.1| Aegilops comosa ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3171

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836160.1| Australopyrum velutinum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2268

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1130 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1071

              
Query: 61   gt 62
            ||
Sbjct: 1070 gt 1069

---

>gb|AY836159.1| Australopyrum retrofractum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2373

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836158.1| Australopyrum pectinatum ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; rbcL-psaI intergenic spacer, complete sequence; and
            photosystem I subunit VIII (psaI) gene, partial cds;
            chloroplast
          Length = 2365

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836157.1| Amblyopyrum muticum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 3183

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836156.1| Agropyron cristatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, complete cds; rbcL-psaI
            intergenic spacer, complete sequence; and photosystem I
            subunit VIII (psaI) gene, partial cds; chloroplast
          Length = 2360

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836155.1| Bromus sterilis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3234

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|AY836154.1| Bromus arvensis ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, complete cds; rbcL-psaI intergenic
            spacer, complete sequence; and photosystem I subunit VIII
            (psaI) gene, partial cds; chloroplast
          Length = 3215

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1209 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1150

              
Query: 61   gt 62
            ||
Sbjct: 1149 gt 1148

---

>gb|U88403.1|ASU88403 Amphipogon strictus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>dbj|AB042240.3| Triticum aestivum chloroplast DNA, complete genome
          Length = 134545

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 56070 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 56011

               
Query: 61    gt 62
             ||
Sbjct: 56010 gt 56009

---

>gb|L15300.1|ASTCPRBCL Avena sativa ribulosbisphosphate dehydrogenase (rbcL) gene, complete
            cds
          Length = 1623

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1259 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1200

              
Query: 61   gt 62
            ||
Sbjct: 1199 gt 1198

---

>emb|Z49844.1|HBCHRBPCX H.brachyantherum chloroplast rbcL gene for ribulosebiphosphate
            carboxylase
          Length = 1224

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|Z49842.1|HLCHRBPCX H.lechleri chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1431

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>gb|L14621.1|PUZRBCL Puccinellia distans chloroplast ribulose 1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds
          Length = 1484

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>dbj|D00206.1|WHTCPRBCL Triticum aestivum chloroplast gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (H-type), complete
            cds
          Length = 1755

 Score =  111 bits (56), Expect = 2e-22
 Identities = 60/62 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1256 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1197

              
Query: 61   gt 62
            ||
Sbjct: 1196 gt 1195

---

>gb|AY395536.1| Schedonorus pratensis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  107 bits (54), Expect = 3e-21
 Identities = 58/60 (96%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1082

---

>gb|AY607058.1| Psathyrostachys rupestris subsp. daghestanica voucher H6703
            ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast
          Length = 1471

 Score =  105 bits (53), Expect = 1e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||
Sbjct: 1130 catatgccaaacatgaataccacctgaagctaccggtataacanctggcatggataccca 1071

              
Query: 61   gt 62
            ||
Sbjct: 1070 gt 1069

---

>emb|Z49836.1|BICHRBPCX B.inermis chloroplast rbcL gene for ribulosebiphosphate carboxylase
          Length = 1434

 Score =  105 bits (53), Expect = 1e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgncaaacatgaataccacctgaagctaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>gb|AY632370.1| Phaenosperma globosa ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1143

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1117 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1058

              
Query: 61   gt 62
            ||
Sbjct: 1057 gt 1056

---

>gb|AY632361.1| Brachypodium pinnatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1277

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1108 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1049

              
Query: 61   gt 62
            ||
Sbjct: 1048 gt 1047

---

>gb|AY691634.1| Hierochloe brunonis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691631.1| Amphibromus fluitans ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctaccggtataacacctggcagggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY395527.1| Agrostis capillaris ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1408

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ784835.1| Ammophila breviligulata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1346

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1142 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1083

              
Query: 61   gt 62
            ||
Sbjct: 1082 gt 1081

---

>emb|AJ784828.1| Hierochloe odorata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1358

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082

---

>emb|AJ784824.1| Phaenosperma globosa chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1357

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1148 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1089

              
Query: 61   gt 62
            ||
Sbjct: 1088 gt 1087

---

>emb|AJ746285.1| Briza media chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1332

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ746258.1| Brachypodium sylvaticum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1397

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||
Sbjct: 1151 catatgccaaacatgaataccacctgaagctactggtataacacctggcatggataccca 1092

              
Query: 61   gt 62
            ||
Sbjct: 1091 gt 1090

---

>emb|AJ746172.1| Ampelodesmos mauritanica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1362

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>gb|AY622886.1| Anisopogon avenaceus ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY622885.1| Ampelodesmos mauritanica ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit gene, partial cds;
            chloroplast
          Length = 1330

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|U31380.1|TMU31380 Thysanolaena maxima ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score =  103 bits (52), Expect = 5e-20
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>emb|AJ746255.1| Aira praecox chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1126

 Score =  101 bits (51), Expect = 2e-19
 Identities = 55/57 (96%)
 Strand = Plus / Minus

                                                                     
Query: 6    gccaaacatgaataccacctgaagctaccgntataacacctgncatggatacccagt 62
            |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 1126 gccaaacatgaataccacctgaagctaccggtataacacctggcatggatacccagt 1070

---

>gb|AY632364.1| Glyceria grandis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 99.6 bits (50), Expect = 7e-19
 Identities = 57/60 (95%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccacctgaagccaccggtataacacctggcatggataccca 1039

---

>gb|AY137446.1| Hordeum patagonicum subsp. mustersii ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, complete
            cds; chloroplast gene for chloroplast product
          Length = 1614

 Score = 99.6 bits (50), Expect = 7e-19
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| |||||||  || ||||||||||||
Sbjct: 1271 catatgccaaacatgaataccacctgaagctaccggtataacanntggcatggataccca 1212

              
Query: 61   gt 62
            ||
Sbjct: 1211 gt 1210

---

>gb|AY632375.1| Zoysia sp. JID-2004 ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1176

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY632374.1| Zeugites pittieri ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1175

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaatacctcctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY632373.1| Uniola paniculata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1039

              
Query: 61   gt 62
            ||
Sbjct: 1038 gt 1037

---

>gb|AY632368.1| Panicum virgatum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1201

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY632367.1| Molinia caerulea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1039

              
Query: 61   gt 62
            ||
Sbjct: 1038 gt 1037

---

>gb|AY632365.1| Melica cupanii ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; plastid
          Length = 1267

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||
Sbjct: 1098 catatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggataccca 1039

              
Query: 61   gt 62
            ||
Sbjct: 1038 gt 1037

---

>gb|AY632363.1| Distichlis spicata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; plastid
          Length = 1176

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY632362.1| Buergersiochloa bambusoides ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds; plastid
          Length = 1171

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>ref|NM_195989.1| Oryza sativa (japonica cultivar-group) putative rbcL; RuBisCO large
            subunit from chromosome 10 chloroplast insertion
            (OSJNBb0075K12.39), mRNA
          Length = 1434

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>gb|AY691644.1| Zotovia thomsonii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691637.1| Imperata cheesemanii ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691633.1| Microlaena avenacea ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1149 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY691630.1| Agrostis magellanica ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1347

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1149 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1090

              
Query: 61   gt 62
            ||
Sbjct: 1089 gt 1088

---

>gb|AY640153.1| Merxmuellera rangei ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY522330.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare chloroplast,
             complete genome
          Length = 134551

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55263 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55204

               
Query: 61    gt 62
             ||
Sbjct: 55203 gt 55202

---

>gb|AY522331.1| Oryza sativa (japonica cultivar-group) isolate PA64S chloroplast,
             complete genome
          Length = 134551

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55263 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55204

               
Query: 61    gt 62
             ||
Sbjct: 55203 gt 55202

---

>gb|AY522329.1| Oryza sativa (indica cultivar-group) isolate 93-11 chloroplast,
             complete genome
          Length = 134496

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55211 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55152

               
Query: 61    gt 62
             ||
Sbjct: 55151 gt 55150

---

>gb|AY395535.1| Dactylis glomerata ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast
          Length = 1349

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ784836.1| Muhlenbergia racemosa chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1361

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082

---

>emb|AJ784834.1| Lamarckia aurea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1328

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1145 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1086

              
Query: 61   gt 62
            ||
Sbjct: 1085 gt 1084

---

>emb|AJ784833.1| Spodiopogon sibiricus chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1359

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1146 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1087

              
Query: 61   gt 62
            ||
Sbjct: 1086 gt 1085

---

>emb|AJ784831.1| Dactylis marina chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1353

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1159 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1100

              
Query: 61   gt 62
            ||
Sbjct: 1099 gt 1098

---

>emb|AJ784829.1| Bouteloua gracilis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1275

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1080 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1021

              
Query: 61   gt 62
            ||
Sbjct: 1020 gt 1019

---

>emb|AJ784826.1| Imperata cylindrica chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1356

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082

---

>emb|AJ784820.1| Calamagrostis epigejos chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1350

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1142 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1083

              
Query: 61   gt 62
            ||
Sbjct: 1082 gt 1081

---

>emb|AJ784818.1| Andropogon gerardii chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1338

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1143 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1084

              
Query: 61   gt 62
            ||
Sbjct: 1083 gt 1082

---

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 125552 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 125493

                
Query: 61     gt 62
              ||
Sbjct: 125492 gt 125491



 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 30492 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 30433

               
Query: 61    gt 62
             ||
Sbjct: 30432 gt 30431

---

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 124579 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 124520

                
Query: 61     gt 62
              ||
Sbjct: 124519 gt 124518



 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 29998 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 29939

               
Query: 61    gt 62
             ||
Sbjct: 29938 gt 29937

---

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 124579 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 124520

                
Query: 61     gt 62
              ||
Sbjct: 124519 gt 124518



 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 29998 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 29939

               
Query: 61    gt 62
             ||
Sbjct: 29938 gt 29937

---

>emb|X55828.1|CHNMRBCL Neurachne munroi chloroplast rbcL gene for the rubisco large subunit
            (EC 4.1.1.39)
          Length = 1990

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1578 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1519

              
Query: 61   gt 62
            ||
Sbjct: 1518 gt 1517

---

>emb|X55827.1|CHNTRBCL Neurachne tenuifolia chloroplast rbcL gene for the rubisco large
            subunit (EC 4.1.1.39)
          Length = 2010

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1598 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1539

              
Query: 61   gt 62
            ||
Sbjct: 1538 gt 1537

---

>emb|X15901.1|CHOSXX Oryza sativa (japonica cultivar-group) chloroplast genome
          Length = 134525

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55255 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55196

               
Query: 61    gt 62
             ||
Sbjct: 55195 gt 55194

---

>emb|AJ746300.1| Puelia ciliata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1289

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1076 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015

---

>emb|AJ746299.1| Phragmites australis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1341

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ746297.1| Oryza sativa chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|AJ746295.1| Molinia caerulea chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1309

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1141 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ746294.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1295

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||
Sbjct: 1119 catatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggataccca 1060

              
Query: 61   gt 62
            ||
Sbjct: 1059 gt 1058

---

>emb|AJ746291.1| Guaduella marantifolia chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1239

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1026 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 967

              
Query: 61   gt 62
            ||
Sbjct: 966  gt 965

---

>emb|AJ746289.1| Elytrophorus globularis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>emb|AJ746284.1| Arundo donax chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>emb|AJ746282.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1408

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1141 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1082

              
Query: 61   gt 62
            ||
Sbjct: 1081 gt 1080

---

>emb|AJ746275.1| Raddia brasiliensis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|AJ746274.1| Phragmites sp. TH-203 chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1161 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|AJ746271.1| Otatea acuminata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1409

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1144 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1085

              
Query: 61   gt 62
            ||
Sbjct: 1084 gt 1083

---

>emb|AJ746269.1| Olmeca recta chloroplast partial rbcL gene for ribulose bisphosphate
            carboxylase large chain
          Length = 1385

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1146 catatgccaaacatgaataccgcctgaagccaccggtataacacctggcatggataccca 1087

              
Query: 61   gt 62
            ||
Sbjct: 1086 gt 1085

---

>emb|AJ746268.1| Dactylis glomerata chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1388

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||||| ||||||||||| || ||| |||||
Sbjct: 1121 catatgccaaacatgaataccacctgaagctaccggtataacacctggcaaggaaaccca 1062

              
Query: 61   gt 62
            ||
Sbjct: 1061 gt 1060

---

>emb|AJ746264.1| Digitaria sanguinalis chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| || |||||||||| ||||||||||| ||||||||||||
Sbjct: 1076 catatgccaaacatgaatacccccagaagctaccggtataacacctggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015

---

>emb|AJ746263.1| Melica uniflora chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1343

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||||||||| |||| ||||||||| | ||||||||||||
Sbjct: 1076 catatgccaaacatgaataccacctgaagccaccggtataacaccaggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015

---

>emb|AJ746256.1| Anthoxanthum odoratum chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1428

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||||||||||||||| | ||||||||||| || |||||||||
Sbjct: 1161 catatgccaaacatgaataccacctgaagctactggtataacacctggcagggataccca 1102

              
Query: 61   gt 62
            ||
Sbjct: 1101 gt 1100

---

>emb|AJ746171.1| Bambusa valida chloroplast partial rbcL gene for ribulose
            bisphosphate carboxylase large chain
          Length = 1339

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1144 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1085

              
Query: 61   gt 62
            ||
Sbjct: 1084 gt 1083

---

>gb|U29900.1| Phragmites australis ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AC122148.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
             OSJNAb0075K12, complete sequence
          Length = 125936

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 53465 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 53406

               
Query: 61    gt 62
             ||
Sbjct: 53405 gt 53404

---

>gb|AE009947.2| Saccharum hybrid cultivar SP-80-3280 chloroplast, complete genome
          Length = 141182

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 120242 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 120183

                
Query: 61     gt 62
              ||
Sbjct: 120182 gt 120181

---

>gb|AF164780.1| Puelia ciliata ribulose 1,5 bisphosphate carboxylase (rbcL) gene,
            partial cds; chloroplast gene for chloroplast product
          Length = 1289

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1076 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1017

              
Query: 61   gt 62
            ||
Sbjct: 1016 gt 1015

---

>gb|AF164778.1| Guaduella marantifolia ribulose 1,5 bisphosphate carboxylase (rbcL)
            gene, partial cds; chloroplast gene for chloroplast
            product
          Length = 1239

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1026 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 967

              
Query: 61   gt 62
            ||
Sbjct: 966  gt 965

---

>gb|AC092750.2| Oryza sativa (japonica cultivar-group) cultivar Nipponbare from
              chromosome 10, complete sequence
          Length = 134933

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 128398 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 128339

                
Query: 61     gt 62
              ||
Sbjct: 128338 gt 128337

---

>gb|U88405.1|EGU88405 Elytrophorus globularis ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene,
            chloroplast gene encoding chloroplast protein, partial
            cds
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|U31360.1|ADU31360 Arundo donax ribulose-1,5-bisphosphate carboxylase large subunit
            (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|U13229.1|PAU13229 Phragmites australis ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, partial cds; chloroplast gene
            for chloroplast product
          Length = 1320

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|U13226.1|ADU13226 Arundo donax ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit (rbcL) gene, partial cds; chloroplast gene for
            chloroplast product
          Length = 1398

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                           
Query: 1       catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
               ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 5614303 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 5614244

                 
Query: 61      gt 62
               ||
Sbjct: 5614243 gt 5614242



 Score = 40.1 bits (20), Expect = 0.58
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 1        catatgccaaacatgaatac 20
                ||||||||||||||||||||
Sbjct: 26145112 catatgccaaacatgaatac 26145093

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 10347073 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 10347014

                  
Query: 61       gt 62
                ||
Sbjct: 10347013 gt 10347012

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 23203832 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 23203891

                  
Query: 61       gt 62
                ||
Sbjct: 23203892 gt 23203893

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 33527409 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 33527468

                  
Query: 61       gt 62
                ||
Sbjct: 33527469 gt 33527470

---

>gb|AY618663.1| Streptogyna americana ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1304

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY618662.1| Isachne arundinacea ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1285

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1112 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1053

              
Query: 61   gt 62
            ||
Sbjct: 1052 gt 1051

---

>gb|AY618661.1| Danthoniopsis petiolata ribulose 1,5-bisphosphate carboxylase large
            subunit gene, partial cds; chloroplast
          Length = 1305

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY622898.1| Piptatherum miliaceum ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||| ||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccaccagaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY622897.1| Olyra latifolia ribulose-1,5-bisphosphate carboxylase/oxygenase large
            subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY622896.1| Nassella viridula ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            |||||||||||||||||||||||| ||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccaccagaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|AY622891.1| Ehrharta calycina ribulose-1,5-bisphosphate carboxylase/oxygenase
            large subunit gene, partial cds; chloroplast
          Length = 1342

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>gb|U13228.1|LOU13228 Leersia oryzoides chloroplast ribulose-1,5-bisphosphate
            carboxylase/oxygenase large subunit (rbcL) gene, partial
            cds
          Length = 1320

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070

---

>dbj|AP003280.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0557A01
          Length = 147201

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 72606 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 72665

               
Query: 61    gt 62
             ||
Sbjct: 72666 gt 72667

---

>dbj|AP004236.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0417D05
          Length = 165752

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                          
Query: 1      catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
              ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 154480 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 154539

                
Query: 61     gt 62
              ||
Sbjct: 154540 gt 154541

---

>dbj|AP003623.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0642B07
          Length = 139297

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 38594 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 38653

               
Query: 61    gt 62
             ||
Sbjct: 38654 gt 38655

---

>dbj|AK105600.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-A05, full
            insert sequence
          Length = 2485

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1216 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1157

              
Query: 61   gt 62
            ||
Sbjct: 1156 gt 1155

---

>dbj|AK062203.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G09, full
           insert sequence
          Length = 838

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 221 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 162

             
Query: 61  gt 62
           ||
Sbjct: 161 gt 160

---

>dbj|AK058623.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-B12, full
           insert sequence
          Length = 1243

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                       
Query: 1   catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
           ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 959 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 900

             
Query: 61  gt 62
           ||
Sbjct: 899 gt 898

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                            
Query: 1        catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
                ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 10353112 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 10353053

                  
Query: 61       gt 62
                ||
Sbjct: 10353052 gt 10353051

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                           
Query: 1       catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
               ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 5614292 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 5614233

                 
Query: 61      gt 62
               ||
Sbjct: 5614232 gt 5614231



 Score = 40.1 bits (20), Expect = 0.58
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 1        catatgccaaacatgaatac 20
                ||||||||||||||||||||
Sbjct: 26073288 catatgccaaacatgaatac 26073269

---

>emb|BX000560.1|CNS08CE6 Oryza sativa chromosome 12, . BAC OSJNBa0021D06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 139684

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Plus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 38582 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 38641

               
Query: 61    gt 62
             ||
Sbjct: 38642 gt 38643

---

>dbj|AP006714.1| Saccharum officinarum chloroplast DNA, complete genome
          Length = 141182

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 58615 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 58556

               
Query: 61    gt 62
             ||
Sbjct: 58555 gt 58554

---

>dbj|AP006728.1| Oryza nivara chloroplast DNA, complete genome
          Length = 134494

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                         
Query: 1     catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
             ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 55190 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 55131

               
Query: 61    gt 62
             ||
Sbjct: 55130 gt 55129

---

>gb|U88406.1|SGU88406 Styppeiochloa gynoglossa ribulose-bisphosphate carboxylase/oxygenase
            large subunit (rbcL) gene, chloroplast gene encoding
            chloroplast protein, partial cds
          Length = 1344

 Score = 95.6 bits (48), Expect = 1e-17
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 1    catatgccaaacatgaataccacctgaagctaccgntataacacctgncatggataccca 60
            ||||||||||||||||||||| |||||||| |||| ||||||||||| ||||||||||||
Sbjct: 1131 catatgccaaacatgaataccccctgaagccaccggtataacacctggcatggataccca 1072

              
Query: 61   gt 62
            ||
Sbjct: 1071 gt 1070


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 263,766
Number of Sequences: 3902068
Number of extensions: 263766
Number of successful extensions: 27564
Number of sequences better than 10.0: 12079
Number of HSP's better than 10.0 without gapping: 12052
Number of HSP's successfully gapped in prelim test: 31
Number of HSP's that attempted gapping in prelim test: 15413
Number of HSP's gapped (non-prelim): 12154
length of query: 62
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 41
effective length of database: 17,151,101,840
effective search space: 703195175440
effective search space used: 703195175440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)

---