>ref|NM_115855.2| Arabidopsis thaliana ATGDI2 (RAB GDP DISSOCIATION INHIBITOR 2);
          RAB GDP-dissociation inhibitor AT3G59920 (ATGDI2) mRNA,
          complete cds
          Length = 1683

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 12 gagatcgatgaacgtagaga 31
          ||||||||||||||||||||
Sbjct: 85 gagatcgatgaacgtagaga 66

>emb|AL138647.1|ATF24G16 Arabidopsis thaliana DNA chromosome 3, BAC clone F24G16
          Length = 100906

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 12    gagatcgatgaacgtagaga 31
             ||||||||||||||||||||
Sbjct: 67954 gagatcgatgaacgtagaga 67935

>emb|AJ001397.1|ATRABGDI2 Arabidopsis thaliana mRNA for rab GDP dissociation inhibitor,
          isoform 2
          Length = 1684

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 12 gagatcgatgaacgtagaga 31
          ||||||||||||||||||||
Sbjct: 76 gagatcgatgaacgtagaga 57

>gb|AY081269.1| Arabidopsis thaliana Rab GDP dissociation inhibitor (At3g59920)
          mRNA, complete cds
          Length = 1672

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 12 gagatcgatgaacgtagaga 31
          ||||||||||||||||||||
Sbjct: 87 gagatcgatgaacgtagaga 68

>gb|U57682.1|RCU57682 Rhodobacter capsulatus cosmids 143-147, complete sequence
          Length = 86896

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 57    gctntgcgaccaccaaggcgct 78
             ||| ||||||||||||||||||
Sbjct: 81089 gctctgcgaccaccaaggcgct 81068


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 198,393
Number of Sequences: 3902068
Number of extensions: 198393
Number of successful extensions: 8152
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8147
Number of HSP's gapped (non-prelim): 5
length of query: 99
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 78
effective length of database: 17,151,101,840
effective search space: 1337785943520
effective search space used: 1337785943520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)