ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9i18
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470257.1| Oryza sativa (japonica cultivar-group), predic... 50 0.010
2gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence 50 0.010
3gb|BT016816.1| Zea mays clone Contig649 mRNA sequence 50 0.010
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 50 0.010
5gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome... 50 0.010
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.010
7dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
8dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
9dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
10dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
11dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.010
12emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-... 46 0.15
13emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-... 44 0.61
14emb|BX058217.1|CNS09H31 Single read from an extremity of a full-... 44 0.61
15emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-... 44 0.61
16emb|BX050629.1|CNS09B89 Single read from an extremity of a full-... 44 0.61
17emb|BX048891.1|CNS099VZ Single read from an extremity of a full-... 44 0.61
18emb|BX048575.1|CNS099N7 Single read from an extremity of a full-... 44 0.61
19emb|BX047759.1|CNS0990J Single read from an extremity of a full-... 44 0.61
20emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-... 44 0.61
21emb|BX039669.1|CNS092RT Single read from an extremity of a full-... 44 0.61
22emb|BX037240.1|CNS090WC Single read from an extremity of a full-... 44 0.61
23emb|BX036580.1|CNS090E0 Single read from an extremity of a full-... 44 0.61
24emb|BX036124.1|CNS0901C Single read from an extremity of a full-... 44 0.61
25emb|BX029509.1|CNS08UXL Single read from an extremity of a full-... 44 0.61
26emb|BX028945.1|CNS08UHX Single read from an extremity of a full-... 44 0.61
27emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-... 44 0.61
28emb|BX027649.1|CNS08THX Single read from an extremity of a full-... 44 0.61
29emb|BX027278.1|CNS08T7M Single read from an extremity of a full-... 44 0.61
30emb|BX026134.1|CNS08SBU Single read from an extremity of a full-... 44 0.61
31emb|BX020909.1|CNS08OAP Single read from an extremity of a full-... 44 0.61
32emb|BX019905.1|CNS08NIT Single read from an extremity of a full-... 44 0.61
33emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-... 44 0.61
34emb|BX016863.1|CNS08L6B Single read from an extremity of a full-... 44 0.61
35emb|BX010707.1|CNS08GFB Single read from an extremity of a full-... 44 0.61
36emb|BX010159.1|CNS08G03 Single read from an extremity of a full-... 44 0.61
37emb|BX010158.1|CNS08G02 Single read from an extremity of a full-... 44 0.61
38emb|BX009177.1|CNS08F8T Single read from an extremity of a full-... 44 0.61
39emb|BX007586.1|CNS08E0M Single read from an extremity of a full-... 44 0.61
40gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, comple... 42 2.4
41gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, co... 42 2.4
42emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G2... 42 2.4
43ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diph... 42 2.4
44gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 2.4
45ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA 42 2.4
46gb|AY007505.3| Streptococcus mitis phage SM1,complete genome 40 9.6
47gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete... 40 9.6
48gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosom... 40 9.6
49gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosom... 40 9.6
50emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, comple... 40 9.6
51gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, comple... 40 9.6
52gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, comple... 40 9.6
53emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chr... 40 9.6
54emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 o... 40 9.6
55emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N2... 40 9.6
56emb|BX013132.1|CNS08IAO Single read from an extremity of a full-... 40 9.6
57gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, comp... 40 9.6
58gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, compl... 40 9.6
59gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, comple... 40 9.6
60gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome... 40 9.6
61gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, comp... 40 9.6
62gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome... 40 9.6
63gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome... 40 9.6
64gb|AC126425.2| Lemur catta, clone -162D1, complete sequence 40 9.6
65gb|AC131599.2| Lemur catta, clone -206F2, complete sequence 40 9.6
66gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complet... 40 9.6
67gb|AC093901.2| Homo sapiens BAC clone RP11-730J4 from 2, complet... 40 9.6
68gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, co... 40 9.6
69gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromo... 40 9.6
70gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, compl... 40 9.6
71dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 9.6
72dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complet... 40 9.6
73emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-2... 40 9.6
74dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.6
75dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 9.6
76dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.6
77gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, co... 40 9.6
78dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, c... 40 9.6 
>ref|XM_470257.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2151

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 523  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2115 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2063
to top
>gb|BT018844.1| Zea mays clone EL01N0554B10.d mRNA sequence
          Length = 2441

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 535  tgctgtttgggccacctttgccgcgtagg 563
            ||||| |||||||||||||||||||||||
Sbjct: 1961 tgctgcttgggccacctttgccgcgtagg 1933
to top
>gb|BT016816.1| Zea mays clone Contig649 mRNA sequence
          Length = 1830

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 535  tgctgtttgggccacctttgccgcgtagg 563
            ||||| |||||||||||||||||||||||
Sbjct: 1317 tgctgcttgggccacctttgccgcgtagg 1289
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 523     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108402 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108454



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 586     aggggcggctttctctgccg 605
               ||||||||||||||||||||
Sbjct: 8815955 aggggcggctttctctgccg 8815974
to top
>gb|AC099401.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1134F05,
             complete sequence
          Length = 101799

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 523   cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
             |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 31415 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 31467
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                    
Query: 523     cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
               |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 3108513 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 3108565



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 586     aggggcggctttctctgccg 605
               ||||||||||||||||||||
Sbjct: 8813790 aggggcggctttctctgccg 8813809
to top
>dbj|AK119641.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F09, full
            insert sequence
          Length = 2166

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 523  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1763 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1711
to top
>dbj|AK111578.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075E22, full
            insert sequence
          Length = 2862

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 523  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2352 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2300
to top
>dbj|AK111489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A14, full
            insert sequence
          Length = 2762

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 523  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 2300 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 2248
to top
>dbj|AK103405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128D05, full
           insert sequence
          Length = 1271

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 523 cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
           |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 928 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 876
to top
>dbj|AK062076.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-044-F04, full
            insert sequence
          Length = 1771

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 523  cttctcggccgctgctgtttgggccacctttgccgcgtaggtaacggctggag 575
            |||||| | ||||||||||||||| ||||| || || ||||||||| ||||||
Sbjct: 1264 cttctcagtcgctgctgtttgggcgaccttcgctgcataggtaacgactggag 1212
to top
>emb|BX035467.1|CNS08ZJ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 595

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 513 ccgcaggcttcttctcggccgctgctg 539
           |||| ||||||||||||||||||||||
Sbjct: 381 ccgccggcttcttctcggccgctgctg 407
to top
>emb|BX066712.1|CNS09NN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 701 ggcttcttctcggccgctgctg 722
to top
>emb|BX058217.1|CNS09H31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 349 ggcttcttctcggccgctgctg 370
to top
>emb|BX055758.1|CNS09F6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 366 ggcttcttctcggccgctgctg 387
to top
>emb|BX050629.1|CNS09B89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 491

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 343 ggcttcttctcggccgctgctg 364
to top
>emb|BX048891.1|CNS099VZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 352 ggcttcttctcggccgctgctg 373
to top
>emb|BX048575.1|CNS099N7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 692 ggcttcttctcggccgctgctg 671
to top
>emb|BX047759.1|CNS0990J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 333

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 154 ggcttcttctcggccgctgctg 175
to top
>emb|BX047713.1|CNS098Z9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC22BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 354 ggcttcttctcggccgctgctg 375
to top
>emb|BX039669.1|CNS092RT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX037240.1|CNS090WC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgctg 398
to top
>emb|BX036580.1|CNS090E0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 199 ggcttcttctcggccgctgctg 220
to top
>emb|BX036124.1|CNS0901C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 367 ggcttcttctcggccgctgctg 388
to top
>emb|BX029509.1|CNS08UXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 356 ggcttcttctcggccgctgctg 377
to top
>emb|BX028945.1|CNS08UHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX028103.1|CNS08TUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 459

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX027649.1|CNS08THX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 289 ggcttcttctcggccgctgctg 310
to top
>emb|BX027278.1|CNS08T7M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 361 ggcttcttctcggccgctgctg 382
to top
>emb|BX026134.1|CNS08SBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 281 ggcttcttctcggccgctgctg 302
to top
>emb|BX020909.1|CNS08OAP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 332 ggcttcttctcggccgctgctg 353
to top
>emb|BX019905.1|CNS08NIT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1030

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 370 ggcttcttctcggccgctgctg 391
to top
>emb|BX017103.1|CNS08LCZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 353 ggcttcttctcggccgctgctg 374
to top
>emb|BX016863.1|CNS08L6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 657

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 304 ggcttcttctcggccgctgctg 325
to top
>emb|BX010707.1|CNS08GFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 350 ggcttcttctcggccgctgctg 371
to top
>emb|BX010159.1|CNS08G03 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 524

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 369 ggcttcttctcggccgctgctg 390
to top
>emb|BX010158.1|CNS08G02 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 669 ggcttcttctcggccgctgctg 648
to top
>emb|BX009177.1|CNS08F8T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 368 ggcttcttctcggccgctgctg 389
to top
>emb|BX007586.1|CNS08E0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 518 ggcttcttctcggccgctgctg 539
           ||||||||||||||||||||||
Sbjct: 362 ggcttcttctcggccgctgctg 383
to top
>gb|AY596616.1| Saccharum officinarum clone SCCCCL3005B06, complete sequence
          Length = 2129

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 535  tgctgtttgggccacctttgc 555
            |||||||||||||||||||||
Sbjct: 1655 tgctgtttgggccacctttgc 1635
to top
>gb|AC119853.9| Mus musculus chromosome 16, clone RP23-231E23, complete sequence
          Length = 236274

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 594    ctttctctgccggaaccttca 614
              |||||||||||||||||||||
Sbjct: 107700 ctttctctgccggaaccttca 107720
to top
>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33
             Contains the 5' end of the CHD5 gene for  chromodomain
             helicase DNA binding protein 5, the RPL22 gene for
             ribosomal protein L22, eight novel genes, the ICMT gene
             for isoprenylcysteine carboxyl methyltransferase, possible
             ortholog of rodent transcription factor HES-3, the 3' end
             of the gene for brain acyl-CoA hydrolase (BACH) and seven
             CpG islands, complete sequence
          Length = 166518

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 659   ttgatggcatcctgttgtttc 679
             |||||||||||||||||||||
Sbjct: 94318 ttgatggcatcctgttgtttc 94298
to top
>ref|XM_695555.1| PREDICTED: Danio rerio similar to Farnesyl-diphosphate
           farnesyltransferase (Squalene synthetase) (SQS) (SS)
           (FPP:FPP farnesyltransferase) (LOC571911), partial mRNA
          Length = 752

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 570 ctggaggaccagcagcagggg 590
           |||||||||||||||||||||
Sbjct: 292 ctggaggaccagcagcagggg 312
to top
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 567    cggctggaggaccagcagcag 587
              |||||||||||||||||||||
Sbjct: 616609 cggctggaggaccagcagcag 616629
to top
>ref|NM_208906.1| Eremothecium gossypii ACR151Wp (ACR151W), mRNA
          Length = 2649

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 567 cggctggaggaccagcagcag 587
           |||||||||||||||||||||
Sbjct: 265 cggctggaggaccagcagcag 285
to top
>gb|AY007505.3| Streptococcus mitis phage SM1,complete genome
          Length = 34692

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 641   ggagacttcggcttcccatt 660
             ||||||||||||||||||||
Sbjct: 12036 ggagacttcggcttcccatt 12017
to top
>gb|AY430810.1| Neodiprion sertifer nucleopolyhdrovirus, complete genome
          Length = 86462

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 408   cattacgtttgttcctcatg 427
             ||||||||||||||||||||
Sbjct: 10531 cattacgtttgttcctcatg 10550
to top
>gb|AC147259.3| Mus musculus BAC clone RP24-178N16 from chromosome Y, complete sequence
          Length = 149994

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 295    acaagagaaaaaggaggagc 314
              ||||||||||||||||||||
Sbjct: 104706 acaagagaaaaaggaggagc 104725
to top
>gb|AC124704.4| Mus musculus BAC clone RP23-480H24 from chromosome 6, complete sequence
          Length = 185099

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 424    catggctagctgggaggatc 443
              ||||||||||||||||||||
Sbjct: 129909 catggctagctgggaggatc 129928
to top
>emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, complete sequence
          Length = 36302

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tttccttttctctttttctg 214
             ||||||||||||||||||||
Sbjct: 35437 tttccttttctctttttctg 35418
to top
>gb|AC074193.6| Homo sapiens BAC clone RP11-611P20 from 7, complete sequence
          Length = 44380

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   aaacagggatgatgatagta 286
             ||||||||||||||||||||
Sbjct: 33833 aaacagggatgatgatagta 33814
to top
>gb|AC079809.4| Homo sapiens BAC clone RP11-958M14 from 7, complete sequence
          Length = 102918

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 296    caagagaaaaaggaggagctaggggaac 323
              ||||| |||||||||||| |||||||||
Sbjct: 100575 caagaaaaaaaggaggaggtaggggaac 100548
to top
>emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chromosome 10 Contains the
             3' end of gene FLJ37160, the LOXL4 gene for lysyl
             oxidase-like 4, a novel gene and a CpG island, complete
             sequence
          Length = 188192

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tttccttttctctttttctg 214
             ||||||||||||||||||||
Sbjct: 19096 tttccttttctctttttctg 19077
to top
>emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 on chromosome Xq22.1-23
             Contains the 3' end of the gene for a likely ortholog of
             mouse neuralin 1 (NRLN1), complete sequence
          Length = 121600

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tgtcttgccacaggtttcct 200
             ||||||||||||||||||||
Sbjct: 42276 tgtcttgccacaggtttcct 42257
to top
>emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N21 on chromosome 20p12.3-13
              Contains the CHGB gene for chromogranin B (secretogranin
              1), a novel pseudogene, the gene for CGI-09 protein
              (CGI-09), the C20orf154 gene for a novel MCM2/3/5 family
              member, a pseudogene similar to part of cytochrome c
              oxidase I, the C20orf155 gene for a novel CDP-alcohol
              phosphatidyltransferase family member, the 3' end of a
              novel gene and four CpG islands, complete sequence
          Length = 139352

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    aggtttccttttctcttttt 211
              ||||||||||||||||||||
Sbjct: 102619 aggtttccttttctcttttt 102600
to top
>emb|BX013132.1|CNS08IAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 518 ggcttcttctcggccgctgc 537
           ||||||||||||||||||||
Sbjct: 377 ggcttcttctcggccgctgc 396
to top
>gb|AC114877.2| Homo sapiens chromosome 3 clone CTD-2270K17, complete sequence
          Length = 179246

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 267    aaacagggatgatgatagta 286
              ||||||||||||||||||||
Sbjct: 164637 aaacagggatgatgatagta 164656
to top
>gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, complete sequence
          Length = 114276

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   gtttccttttctctttttct 213
             ||||||||||||||||||||
Sbjct: 52890 gtttccttttctctttttct 52871
to top
>gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, complete sequence
          Length = 106449

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tttccttttctctttttctg 214
             ||||||||||||||||||||
Sbjct: 94582 tttccttttctctttttctg 94563
to top
>gb|AC174806.2| Mus musculus BAC clone RP24-526I8 from chromosome y, complete
            sequence
          Length = 155247

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 295  acaagagaaaaaggaggagc 314
            ||||||||||||||||||||
Sbjct: 6323 acaagagaaaaaggaggagc 6342
to top
>gb|AC103922.2| Homo sapiens chromosome 3 clone RP11-226E22, complete sequence
          Length = 164479

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 267    aaacagggatgatgatagta 286
              ||||||||||||||||||||
Sbjct: 115439 aaacagggatgatgatagta 115420
to top
>gb|AC139168.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1364E02,
            complete sequence
          Length = 126027

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 586  aggggcggctttctctgccg 605
            ||||||||||||||||||||
Sbjct: 6843 aggggcggctttctctgccg 6862
to top
>gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1364E02,
             complete sequence
          Length = 112265

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 586   aggggcggctttctctgccg 605
             ||||||||||||||||||||
Sbjct: 59108 aggggcggctttctctgccg 59127
to top
>gb|AC126425.2| Lemur catta, clone -162D1, complete sequence
          Length = 154718

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tttccttttctctttttctg 214
             ||||||||||||||||||||
Sbjct: 27273 tttccttttctctttttctg 27254
to top
>gb|AC131599.2| Lemur catta, clone -206F2, complete sequence
          Length = 155606

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   tttccttttctctttttctg 214
             ||||||||||||||||||||
Sbjct: 90464 tttccttttctctttttctg 90483
to top
>gb|AC093628.3| Homo sapiens BAC clone RP11-98N20 from 4, complete sequence
          Length = 159991

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 298    agagaaaaaggaggagctag 317
              ||||||||||||||||||||
Sbjct: 124092 agagaaaaaggaggagctag 124073
to top
>gb|AC093901.2| Homo sapiens BAC clone RP11-730J4 from 2, complete sequence
          Length = 161153

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 196    ttccttttctctttttctgc 215
              ||||||||||||||||||||
Sbjct: 144694 ttccttttctctttttctgc 144675
to top
>gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, complete sequence
          Length = 190728

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   gtttccttttctctttttct 213
             ||||||||||||||||||||
Sbjct: 22737 gtttccttttctctttttct 22718
to top
>gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromosome 7, complete
              sequence
          Length = 180623

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 296    caagagaaaaaggaggagctaggggaac 323
              ||||| |||||||||||| |||||||||
Sbjct: 140763 caagaaaaaaaggaggaggtaggggaac 140790
to top
>gb|AC138070.3| Homo sapiens chromosome 3 clone RP11-263E3, complete sequence
          Length = 169834

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 267   aaacagggatgatgatagta 286
             ||||||||||||||||||||
Sbjct: 17593 aaacagggatgatgatagta 17612
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 497     ggcttcttctcggtcaccgc 516
               ||||||||||||||||||||
Sbjct: 1176320 ggcttcttctcggtcaccgc 1176339
to top
>dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complete sequence
          Length = 150613

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 201   tttctctttttctgccgatt 220
             ||||||||||||||||||||
Sbjct: 74780 tttctctttttctgccgatt 74761
to top
>emb|AL121769.4|CNS01DSD Human chromosome 14 DNA sequence BAC R-299L17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 167344

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   aacaagagaaaaaggaggag 313
             ||||||||||||||||||||
Sbjct: 65335 aacaagagaaaaaggaggag 65354
to top
>dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-428C14, complete
             sequence
          Length = 166893

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 191   caggtttccttttctctttt 210
             ||||||||||||||||||||
Sbjct: 74125 caggtttccttttctctttt 74144
to top
>dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-956A8, complete
             sequence
          Length = 114109

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   tttagagctaagcaaactga 267
             ||||||||||||||||||||
Sbjct: 94632 tttagagctaagcaaactga 94651
to top
>dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-640N11, complete
             sequence
          Length = 161547

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   tttagagctaagcaaactga 267
             ||||||||||||||||||||
Sbjct: 31460 tttagagctaagcaaactga 31479
to top
>gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, complete sequence
          Length = 177014

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   agagaaaaaggaggagctag 317
             ||||||||||||||||||||
Sbjct: 59532 agagaaaaaggaggagctag 59513
to top
>dbj|AP001862.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2060O22, complete
             sequence
          Length = 111557

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   agagaaaaaggaggagctag 317
             ||||||||||||||||||||
Sbjct: 78153 agagaaaaaggaggagctag 78134


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,407,173
Number of Sequences: 3902068
Number of extensions: 5407173
Number of successful extensions: 117388
Number of sequences better than 10.0: 78
Number of HSP's better than 10.0 without gapping: 80
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 117040
Number of HSP's gapped (non-prelim): 348
length of query: 698
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 675
effective length of database: 17,143,297,704
effective search space: 11571725950200
effective search space used: 11571725950200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top