ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbags9h21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_473060.1| Oryza sativa (japonica cultivar-group), predic... 347 2e-92
2gb|BT017833.1| Zea mays clone EL01N0509B09.c mRNA sequence 335 9e-89
3ref|NM_184009.1| Oryza sativa (japonica cultivar-group), predic... 331 1e-87
4gb|BT018281.1| Zea mays clone EL01T0204F12.c mRNA sequence 331 1e-87
5dbj|AK120842.1| Oryza sativa (japonica cultivar-group) cDNA clon... 327 2e-86
6gb|BT017941.1| Zea mays clone EL01N0521B03.c mRNA sequence 323 3e-85
7gb|BT016465.1| Zea mays clone Contig298 mRNA sequence 319 5e-84
8gb|AY104035.1| Zea mays PCO096331 mRNA sequence 315 8e-83
9dbj|AK102699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 2e-68
10gb|AF061508.1|AF061508 Zea mays ribosomal protein L25 mRNA, part... 266 7e-68
11gb|AY110987.1| Zea mays CL1782_3 mRNA sequence 260 4e-66
12emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clon... 252 1e-63
13dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 252 1e-63
14emb|AL442115.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 252 1e-63
15dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 236 6e-59
16dbj|AP003764.3| Oryza sativa (japonica cultivar-group) genomic D... 236 6e-59
17dbj|AP003852.2| Oryza sativa (japonica cultivar-group) genomic D... 236 6e-59
18gb|BT018262.1| Zea mays clone EL01T0202C04.c mRNA sequence 190 3e-45
19gb|AF349961.1| Daucus carota ribosome protein L23a mRNA, complet... 168 1e-38
20gb|AF031542.1|AF031542 Fritillaria agrestis ribosomal protein L2... 168 1e-38
21gb|DQ200381.1| Solanum tuberosum clone 062E11 ribosomal protein ... 153 7e-34
22ref|NM_129504.3| Arabidopsis thaliana ATRPL23A (RIBOSOMAL PROTEI... 147 4e-32
23gb|AY039850.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, com... 147 4e-32
24gb|AY037235.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, com... 147 4e-32
25gb|AF325056.2|AF325056 Arabidopsis thaliana At2g39460 (At2g39460... 147 4e-32
26emb|BX819997.1|CNS0A8JW Arabidopsis thaliana Full-length cDNA Co... 147 4e-32
27gb|AY086212.1| Arabidopsis thaliana clone 22479 mRNA, complete s... 147 4e-32
28gb|AY060540.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, com... 141 3e-30
29gb|AF034694.1|AF034694 Arabidopsis thaliana ribosomal protein L2... 139 1e-29
30emb|X92350.1|SORPL23 S.oleracea mRNA for ribosomal protein L23 (... 125 2e-25
31gb|DQ296187.1| Brassica rapa clone 135 unknown mRNA 125 2e-25
32gb|L18908.1|TOBRPL25A Nicotiana tabacum ribosomal protein L25, c... 119 9e-24
33ref|NM_115386.2| Arabidopsis thaliana RNA binding / structural c... 111 2e-21
34emb|X92367.1|SORPL235 S.oleracea mRNA for ribosomal protein L23 ... 111 2e-21
35gb|BT000478.1| Arabidopsis thaliana ribosomal L23a - like protei... 111 2e-21
36gb|AY050445.1| Arabidopsis thaliana AT3g55280/T26I12_160 mRNA, c... 111 2e-21
37gb|AY085736.1| Arabidopsis thaliana clone 17531 mRNA, complete s... 111 2e-21
38emb|BX825416.1|CNS0A7I7 Arabidopsis thaliana Full-length cDNA Co... 103 6e-19
39gb|AF548321.1| Branchiostoma belcheri ribosomal protein L23a mRN... 101 2e-18
40gb|AY232233.1| Drosophila yakuba clone yak-ad_RpL23a mRNA sequence 98 3e-17
41gb|AF281334.1| Oncorhynchus mykiss 60S ribosomal protein mRNA, p... 96 1e-16
42gb|AC004218.3| Arabidopsis thaliana chromosome 2 clone F12L6 map... 94 5e-16
43gb|AY874405.1| Solanum tuberosum isolate CT240 cultivar HH1-9, g... 94 5e-16
44gb|AY874403.1| Solanum tuberosum isolate CT240 cultivar USW-2230... 94 5e-16
45ref|XM_787855.1| PREDICTED: Strongylocentrotus purpuratus simila... 90 8e-15
46emb|AL132954.1|ATT26I12 Arabidopsis thaliana DNA chromosome 3, B... 90 8e-15
47emb|BX841999.1|CNS09YA4 Arabidopsis thaliana Full-length cDNA Co... 90 8e-15
48gb|AY874404.1| Solanum berthaultii isolate CT240 cultivar B11B, ... 88 3e-14
49gb|AF401578.1| Ictalurus punctatus ribosomal protein L23a mRNA, ... 86 1e-13
50gb|DQ450529.1| Drosophila melanogaster L23A ribosomal protein na... 82 2e-12
51gb|AC010038.5| Drosophila melanogaster 3L BAC RP98-14O14 (Roswel... 82 2e-12
52gb|AC105264.3| Drosophila melanogaster 3L BAC RP98-17K18 (Roswel... 82 2e-12
53gb|AC093192.2| Drosophila melanogaster 3L BAC RP98-48J18 (Roswel... 82 2e-12
54gb|AY094921.1| Drosophila melanogaster RH35480 full insert cDNA 82 2e-12
55ref|NM_079162.2| Drosophila melanogaster Ribosomal protein L23A ... 82 2e-12
56gb|AF080130.1|AF080130 Drosophila melanogaster ribosomal protein... 82 2e-12
57gb|AE003472.1| Drosophila melanogaster chromosome 3L, section 6 ... 82 2e-12
58gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, r... 82 2e-12
59gb|U40948.1| Caenorhabditis elegans cosmid F55D10, complete sequ... 80 8e-12
60gb|DQ138322.1| Myxobolus cerebralis ribosomal protein L23-like m... 80 8e-12
61ref|NM_076407.3| Caenorhabditis elegans Ribosomal Protein, Large... 80 8e-12
62emb|AL115487.1|CNS01CG7 Botrytis cinerea strain T4 cDNA library 80 8e-12
63emb|AL115271.1|CNS01CA7 Botrytis cinerea strain T4 cDNA library 80 8e-12
64emb|AL114669.1|CNS01BTH Botrytis cinerea strain T4 cDNA library 80 8e-12
65emb|AL114551.1|CNS01BQ7 Botrytis cinerea strain T4 cDNA library 80 8e-12
66emb|AL112682.1|CNS01AAA Botrytis cinerea strain T4 cDNA library 80 8e-12
67emb|AL111598.1|CNS019G6 Botrytis cinerea strain T4 cDNA library 80 8e-12
68emb|AL111416.1|CNS019B4 Botrytis cinerea strain T4 cDNA library 80 8e-12
69emb|AL110748.1|CNS018SL Botrytis cinerea strain T4 cDNA library 80 8e-12
70emb|AL110918.1|CNS018XB Botrytis cinerea strain T4 cDNA library 80 8e-12
71ref|XM_757052.1| Ustilago maydis 521 hypothetical protein (UM059... 78 3e-11
72gb|AC139707.10| Medicago truncatula clone mth2-16b22, complete s... 76 1e-10
73gb|BC098550.1| Danio rerio ribosomal protein L23a, mRNA (cDNA cl... 74 5e-10
74ref|XM_415820.1| PREDICTED: Gallus gallus similar to 60S ribosom... 74 5e-10
75gb|AY561517.1| Danio rerio ribosomal protein L23a (rpl23a) mRNA,... 74 5e-10
76ref|XM_677033.1| Aspergillus nidulans FGSC A4 hypothetical prote... 74 5e-10
77ref|NM_001001593.1| Danio rerio ribosomal protein L23a (rpl23a),... 74 5e-10
78gb|BT021430.1| Drosophila melanogaster GM06171 full insert cDNA 74 5e-10
79emb|AL112366.1|CNS01A1I Botrytis cinerea strain T4 cDNA library 72 2e-09
80emb|BX819433.1|CNS0A8ZH Arabidopsis thaliana Full-length cDNA Co... 70 8e-09
81ref|XM_365965.1| Magnaporthe grisea 70-15 hypothetical protein (... 66 1e-07
82ref|XM_382669.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 66 1e-07
83emb|Z75541.1|CEF52B5 Caenorhabditis elegans Cosmid F52B5, comple... 66 1e-07
84ref|NM_059862.2| Caenorhabditis elegans Ribosomal Protein, Large... 66 1e-07
85gb|AY849680.1| Magnaporthe grisea 60S ribosomal protein L23-like... 66 1e-07
86gb|U02032.1|HSU02032 Human ribosomal protein L23a mRNA, partial cds 66 1e-07
87gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, c... 64 5e-07
88ref|XM_511611.1| PREDICTED: Pan troglodytes similar to breast ca... 62 2e-06
89ref|XM_523627.1| PREDICTED: Pan troglodytes similar to Rpl23a pr... 62 2e-06
90ref|XM_511361.1| PREDICTED: Pan troglodytes similar to ribosomal... 62 2e-06
91ref|XM_528535.1| PREDICTED: Pan troglodytes similar to Rpl23a pr... 62 2e-06
92ref|XM_514120.1| PREDICTED: Pan troglodytes similar to Rpl23a pr... 62 2e-06
93gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21... 62 2e-06
94gb|BC058041.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA c... 62 2e-06
95gb|BC014459.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA c... 62 2e-06
96ref|NM_000984.5| Homo sapiens ribosomal protein L23a (RPL23A), mRNA 62 2e-06
97gb|DP000044.2| Callithrix jacchus target 106 genomic scaffold 62 2e-06
98ref|XM_505871.1| Yarrowia lipolytica CLIB122, YALI0F25531g predi... 62 2e-06
99gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, com... 62 2e-06
100emb|BX054544.1|CNS09E90 Single read from an extremity of a full-... 62 2e-06
101gb|AC112491.4| Homo sapiens 3 BAC RP11-3P17 (Roswell Park Cancer... 62 2e-06
102gb|BC036642.1| Mus musculus, clone IMAGE:3371217, mRNA 62 2e-06
103emb|CR616046.1| full-length cDNA clone CS0DE014YB21 of Placenta ... 62 2e-06
104gb|AC011979.7| Homo sapiens chromosome 11, clone RP11-16F15, com... 62 2e-06
105ref|NG_002546.1| Homo sapiens ribosomal protein L23a pseudogene ... 62 2e-06
106ref|XM_937620.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 62 2e-06
107ref|XM_377521.3| PREDICTED: Homo sapiens similar to 60S ribosoma... 62 2e-06
108ref|XM_939952.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 62 2e-06
109ref|XM_941396.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 62 2e-06
110ref|XM_930113.1| PREDICTED: Homo sapiens similar to 60S ribosoma... 62 2e-06
111gb|AD000091.1|CH19F15314 Homo sapiens DNA from chromosome 19p13.... 62 2e-06
112ref|XM_340850.2| PREDICTED: Rattus norvegicus ribosomal protein ... 62 2e-06
113ref|XM_577114.1| PREDICTED: Rattus norvegicus similar to 60S rib... 62 2e-06
114gb|AC010761.10| Homo sapiens chromosome 17, clone RP11-386F9, co... 62 2e-06
115dbj|AK130965.1| Homo sapiens cDNA FLJ27455 fis, clone UBA04121, ... 62 2e-06
116emb|AJ277546.2|HSA277546 Homo sapiens WEE1 gene for protein kina... 62 2e-06
117emb|X65228.1|RRRPL23A R.rattus mRNA for ribosomal protein L23a 62 2e-06
118emb|AL132801.5|CNS01DTN Human chromosome 14 DNA sequence BAC R-6... 62 2e-06
119gb|AF001689.1|AF001689 Homo sapiens ribosomal protein L23A (RPL2... 62 2e-06
120emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 62 2e-06
121gb|U37230.1|HSU37230 Human ribosomal protein L23a mRNA, complete... 62 2e-06
122gb|U43701.1|HSU43701 Human ribosomal protein L23a mRNA, complete... 62 2e-06
123emb|Y12508.1|HSIGFBP H.sapiens IGFBP-4 gene 62 2e-06
124gb|L13799.1|HUMCH13C1A Homo sapiens (clone 01) liver expressed p... 62 2e-06
125gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 60 8e-06
126gb|AC007683.5| Homo sapiens BAC clone RP11-401L13 from 7, comple... 60 8e-06
127gb|AY498860.1| Homo sapiens tumor necrosis factor receptor super... 60 8e-06
128ref|XM_569415.1| Cryptococcus neoformans var. neoformans JEC21 r... 60 8e-06
129emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chr... 60 8e-06
130emb|AL157386.14| Human DNA sequence from clone RP11-170J3 on chr... 60 8e-06
131gb|DQ214298.1| Taeniopygia guttata clone 0061P0010E07 60S riboso... 58 3e-05
132gb|BC077046.1| Xenopus tropicalis MGC89958 protein, mRNA (cDNA c... 58 3e-05
133emb|BX019711.1|CNS08NDF Single read from an extremity of a full-... 58 3e-05
134gb|AY972826.1| Aedes albopictus ribosomal protein L23a mRNA, com... 58 3e-05
135gb|AY857437.1| Suberites domuncula L23a mRNA, complete cds 58 3e-05
136ref|NM_001005109.1| Xenopus tropicalis MGC89958 protein (MGC8995... 58 3e-05
137gb|AC153889.19| Mus musculus 10 BAC RP23-434A12 (Roswell Park Ca... 56 1e-04
138gb|AC167202.8| Mus musculus BAC RP24-243A15 (Roswell Park Cance... 56 1e-04
139ref|XM_521892.1| PREDICTED: Pan troglodytes similar to Rpl23a pr... 56 1e-04
140ref|XM_508278.1| PREDICTED: Pan troglodytes similar to Rpl23a pr... 56 1e-04
141gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Ho... 56 1e-04
142gb|AC087066.3| Rattus norvegicus strain Brown Norway clone RP31-... 56 1e-04
143gb|AC087067.3| Rattus norvegicus strain Brown Norway clone RP31-... 56 1e-04
144ref|XM_001002232.1| PREDICTED: Mus musculus similar to 60S ribos... 56 1e-04
145ref|XM_984537.1| PREDICTED: Mus musculus similar to 60S ribosoma... 56 1e-04
146ref|XM_984283.1| PREDICTED: Mus musculus similar to 60S ribosoma... 56 1e-04
147ref|XM_983917.1| PREDICTED: Mus musculus similar to 60S ribosoma... 56 1e-04
148gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome... 56 1e-04
149gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome... 56 1e-04
150emb|BX053332.1|CNS09DBC Single read from an extremity of a full-... 56 1e-04
151emb|BX071919.1|CNS09RNN Single read from an extremity of a full-... 56 1e-04
152emb|BX071918.1|CNS09RNM Single read from an extremity of a full-... 56 1e-04
153emb|BX071899.1|CNS09RN3 Single read from an extremity of a full-... 56 1e-04
154emb|BX071898.1|CNS09RN2 Single read from an extremity of a full-... 56 1e-04
155emb|BX071572.1|CNS09RE0 Single read from an extremity of a full-... 56 1e-04
156emb|BX070849.1|CNS09QTX Single read from an extremity of a full-... 56 1e-04
157emb|BX070057.1|CNS09Q7X Single read from an extremity of a full-... 56 1e-04
158emb|BX060970.1|CNS09J7I Single read from an extremity of a full-... 56 1e-04
159emb|BX060969.1|CNS09J7H Single read from an extremity of a full-... 56 1e-04
160emb|BX068513.1|CNS09P11 Single read from an extremity of a full-... 56 1e-04
161emb|BX068512.1|CNS09P10 Single read from an extremity of a full-... 56 1e-04
162emb|BX067321.1|CNS09O3X Single read from an extremity of a full-... 56 1e-04
163emb|BX067206.1|CNS09O0Q Single read from an extremity of a full-... 56 1e-04
164emb|BX066586.1|CNS09NJI Single read from an extremity of a full-... 56 1e-04
165emb|BX066585.1|CNS09NJH Single read from an extremity of a full-... 56 1e-04
166emb|BX066443.1|CNS09NFJ Single read from an extremity of a full-... 56 1e-04
167emb|BX066442.1|CNS09NFI Single read from an extremity of a full-... 56 1e-04
168emb|BX062873.1|CNS09KOD Single read from an extremity of a full-... 56 1e-04
169emb|BX060551.1|CNS09IVV Single read from an extremity of a full-... 56 1e-04
170emb|BX060550.1|CNS09IVU Single read from an extremity of a full-... 56 1e-04
171emb|BX059628.1|CNS09I68 Single read from an extremity of a full-... 56 1e-04
172emb|BX058866.1|CNS09HL2 Single read from an extremity of a full-... 56 1e-04
173emb|BX058865.1|CNS09HL1 Single read from an extremity of a full-... 56 1e-04
174emb|BX054450.1|CNS09E6E Single read from an extremity of a full-... 56 1e-04
175emb|BX053901.1|CNS09DR5 Single read from an extremity of a full-... 56 1e-04
176emb|BX053900.1|CNS09DR4 Single read from an extremity of a full-... 56 1e-04
177emb|BX052734.1|CNS09CUQ Single read from an extremity of a full-... 56 1e-04
178emb|BX052705.1|CNS09CTX Single read from an extremity of a full-... 56 1e-04
179emb|BX051821.1|CNS09C5D Single read from an extremity of a full-... 56 1e-04
180emb|BX051339.1|CNS09BRZ Single read from an extremity of a full-... 56 1e-04
181emb|BX050056.1|CNS09ASC Single read from an extremity of a full-... 56 1e-04
182emb|BX049916.1|CNS09AOG Single read from an extremity of a full-... 56 1e-04
183emb|BX048611.1|CNS099O7 Single read from an extremity of a full-... 56 1e-04
184emb|BX047300.1|CNS098NS Single read from an extremity of a full-... 56 1e-04
185emb|BX047299.1|CNS098NR Single read from an extremity of a full-... 56 1e-04
186emb|BX047041.1|CNS098GL Single read from an extremity of a full-... 56 1e-04
187emb|BX045321.1|CNS0974T Single read from an extremity of a full-... 56 1e-04
188emb|BX045193.1|CNS09719 Single read from an extremity of a full-... 56 1e-04
189emb|BX045140.1|CNS096ZS Single read from an extremity of a full-... 56 1e-04
190emb|BX044621.1|CNS096LD Single read from an extremity of a full-... 56 1e-04
191emb|BX042669.1|CNS09535 Single read from an extremity of a full-... 56 1e-04
192emb|BX041906.1|CNS094HY Single read from an extremity of a full-... 56 1e-04
193emb|BX040647.1|CNS093IZ Single read from an extremity of a full-... 56 1e-04
194emb|BX040287.1|CNS0938Z Single read from an extremity of a full-... 56 1e-04
195emb|BX039799.1|CNS092VF Single read from an extremity of a full-... 56 1e-04
196emb|BX039798.1|CNS092VE Single read from an extremity of a full-... 56 1e-04
197emb|BX033324.1|CNS08XVK Single read from an extremity of a full-... 56 1e-04
198emb|BX033323.1|CNS08XVJ Single read from an extremity of a full-... 56 1e-04
199emb|BX033172.1|CNS08XRC Single read from an extremity of a full-... 56 1e-04
200emb|BX022463.1|CNS08PHV Single read from an extremity of a full-... 56 1e-04
201emb|BX022462.1|CNS08PHU Single read from an extremity of a full-... 56 1e-04
202emb|BX022320.1|CNS08PDW Single read from an extremity of a full-... 56 1e-04
203emb|BX026874.1|CNS08SWE Single read from an extremity of a full-... 56 1e-04
204emb|BX026580.1|CNS08SO8 Single read from an extremity of a full-... 56 1e-04
205emb|BX022838.1|CNS08PSA Single read from an extremity of a full-... 56 1e-04
206emb|BX025008.1|CNS08RGK Single read from an extremity of a full-... 56 1e-04
207emb|BX023269.1|CNS08Q49 Single read from an extremity of a full-... 56 1e-04
208emb|BX023034.1|CNS08PXQ Single read from an extremity of a full-... 56 1e-04
209emb|BX021957.1|CNS08P3T Single read from an extremity of a full-... 56 1e-04
210emb|BX021487.1|CNS08OQR Single read from an extremity of a full-... 56 1e-04
211emb|BX020862.1|CNS08O9E Single read from an extremity of a full-... 56 1e-04
212emb|BX019000.1|CNS08MTO Single read from an extremity of a full-... 56 1e-04
213emb|BX017300.1|CNS08LIG Single read from an extremity of a full-... 56 1e-04
214emb|BX016716.1|CNS08L28 Single read from an extremity of a full-... 56 1e-04
215emb|BX016715.1|CNS08L27 Single read from an extremity of a full-... 56 1e-04
216emb|BX016430.1|CNS08KUA Single read from an extremity of a full-... 56 1e-04
217emb|BX015793.1|CNS08KCL Single read from an extremity of a full-... 56 1e-04
218emb|BX015752.1|CNS08KBG Single read from an extremity of a full-... 56 1e-04
219emb|BX014341.1|CNS08J89 Single read from an extremity of a full-... 56 1e-04
220emb|BX014340.1|CNS08J88 Single read from an extremity of a full-... 56 1e-04
221emb|BX011071.1|CNS08GPF Single read from an extremity of a full-... 56 1e-04
222emb|BX010970.1|CNS08GMM Single read from an extremity of a full-... 56 1e-04
223emb|BX010969.1|CNS08GML Single read from an extremity of a full-... 56 1e-04
224emb|BX010291.1|CNS08G3R Single read from an extremity of a full-... 56 1e-04
225emb|BX010257.1|CNS08G2T Single read from an extremity of a full-... 56 1e-04
226emb|BX010256.1|CNS08G2S Single read from an extremity of a full-... 56 1e-04
227emb|BX009853.1|CNS08FRL Single read from an extremity of a full-... 56 1e-04
228emb|BX009843.1|CNS08FRB Single read from an extremity of a full-... 56 1e-04
229emb|BX009817.1|CNS08FQL Single read from an extremity of a full-... 56 1e-04
230emb|BX008690.1|CNS08EVA Single read from an extremity of a full-... 56 1e-04
231emb|BX007724.1|CNS08E4G Single read from an extremity of a full-... 56 1e-04
232emb|BX007723.1|CNS08E4F Single read from an extremity of a full-... 56 1e-04
233emb|BX006872.1|CNS08DGS Single read from an extremity of a full-... 56 1e-04
234emb|BX006131.1|CNS08CW7 Single read from an extremity of a full-... 56 1e-04
235emb|BX006130.1|CNS08CW6 Single read from an extremity of a full-... 56 1e-04
236gb|AY972825.1| Anopheles stephensi ribosomal protein L23a mRNA, ... 56 1e-04
237gb|AC174742.8| Mus musculus BAC RP24-258O12 (Roswell Park Cance... 56 1e-04
238gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold 56 1e-04
239ref|XM_316082.2| Anopheles gambiae str. PEST ENSANGP00000024740 ... 56 1e-04
240ref|XM_316083.2| Anopheles gambiae str. PEST ENSANGP00000012554 ... 56 1e-04
241gb|AC172027.4| Mus musculus BAC RP24-219P17 (Roswell Park Cance... 56 1e-04
242gb|AC171183.6| Mus musculus BAC RP24-545B2 (Roswell Park Cancer... 56 1e-04
243emb|AL672193.10| Mouse DNA sequence from clone RP23-443O18 on ch... 56 1e-04
244gb|AC123752.8| Mus musculus chromosome 1, clone RP24-194N4, comp... 54 5e-04
245gb|BC086883.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c... 54 5e-04
246gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome... 54 5e-04
247gb|BC026656.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c... 54 5e-04
248gb|BC029892.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c... 54 5e-04
249gb|BC016558.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c... 54 5e-04
250gb|AC103405.14| Mus musculus chromosome 19, clone RP23-98J4, com... 54 5e-04
251ref|NM_207523.1| Mus musculus ribosomal protein L23a (Rpl23a), mRNA 54 5e-04
252ref|XM_622785.3| PREDICTED: Mus musculus ribosomal protein L23a,... 54 5e-04
253ref|XM_903849.2| PREDICTED: Mus musculus ribosomal protein L23a,... 54 5e-04
254ref|XM_001002269.1| PREDICTED: Mus musculus similar to 60S ribos... 54 5e-04
255ref|XR_003020.1| PREDICTED: Mus musculus similar to 60S ribosoma... 54 5e-04
256ref|XR_003599.1| PREDICTED: Mus musculus hypothetical protein LO... 54 5e-04
257gb|AF452721.1| Mus musculus ribosomal protein L23a mRNA, complet... 54 5e-04
258gb|AC132259.3| Mus musculus BAC clone RP24-369B15 from chromosom... 54 5e-04
259gb|AC122291.4| Mus musculus BAC clone RP23-255N20 from 15, compl... 54 5e-04
260emb|AL360091.28| Human DNA sequence from clone RP11-384C4 on chr... 54 5e-04
261emb|AL591070.19| Mouse DNA sequence from clone RP23-185A18 on ch... 54 5e-04
262emb|AL390140.1|HSM802785 Homo sapiens genomic DNA; cDNA DKFZp547... 54 5e-04
263emb|BX005100.9| Mouse DNA sequence from clone RP23-76P22 on chro... 54 5e-04
264dbj|AK141850.1| Mus musculus 12 days embryo spinal ganglion cDNA... 54 5e-04
265dbj|AK152095.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 5e-04
266ref|NR_002229.1| Homo sapiens ribosomal protein L23a pseudogene ... 54 5e-04
267dbj|AK165432.1| Mus musculus adult male kidney cDNA, RIKEN full-... 54 5e-04
268dbj|AK161721.1| Mus musculus adult male thymus cDNA, RIKEN full-... 54 5e-04
269gb|BC086884.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c... 54 5e-04
270dbj|AK028387.1| Mus musculus 18 days pregnant adult female place... 54 5e-04
271gb|BC096637.1| Mus musculus ribosomal protein L23a, mRNA (cDNA c... 54 5e-04
272gb|AC139452.4| Homo sapiens 3 BAC RP11-301L7 (Roswell Park Cance... 54 5e-04
273gb|AC154563.2| Mus musculus BAC clone RP23-401E22 from chromosom... 54 5e-04
274gb|AC154738.2| Mus musculus BAC clone RP24-390D14 from chromosom... 54 5e-04
275gb|AC092839.4| Homo sapiens BAC clone RP11-257N16 from 2, comple... 54 5e-04
276ref|XM_574848.1| PREDICTED: Rattus norvegicus similar to 60S rib... 54 5e-04
277ref|XM_218061.3| PREDICTED: Rattus norvegicus similar to 60S rib... 54 5e-04
278gb|AC093038.4| Homo sapiens BAC clone RP13-541C6 from 2, complet... 54 5e-04
279gb|BC096740.1| Homo sapiens ribosomal protein L23a pseudogene 13... 54 5e-04
280gb|BC098172.1| Homo sapiens ribosomal protein L23a pseudogene 13... 54 5e-04
281gb|BC096706.1| Homo sapiens ribosomal protein L23a pseudogene 13... 54 5e-04
282gb|AC154471.2| Mus musculus BAC clone RP23-195D3 from chromosome... 54 5e-04
283gb|AC004807.1|AC004807 Mus musculus chromosome 11, clone mCIT.26... 54 5e-04
284gb|AC113182.14| Mus musculus chromosome 8, clone RP23-39F24, com... 54 5e-04
285emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chr... 54 5e-04
286gb|DQ214299.1| Taeniopygia guttata clone 0061P0022D04 60S riboso... 52 0.002
287gb|DQ214297.1| Taeniopygia guttata clone 0061P0010B09 60S riboso... 52 0.002
288gb|AC146204.3| Pan troglodytes BAC clone RP43-25M3 from 7, compl... 52 0.002
289emb|BX067205.1|CNS09O0P Single read from an extremity of a full-... 52 0.002
290emb|BX026579.1|CNS08SO7 Single read from an extremity of a full-... 52 0.002
291gb|AC005007.1|AC005007 Homo sapiens BAC clone GS1-51M12 from 7p2... 52 0.002
292ref|XM_573792.1| PREDICTED: Rattus norvegicus similar to 60S rib... 52 0.002
293ref|XM_222721.3| PREDICTED: Rattus norvegicus similar to 2310050... 52 0.002
294gb|BC078526.1| Xenopus laevis MGC85348 protein, mRNA (cDNA clone... 50 0.007
295ref|XR_003525.1| PREDICTED: Mus musculus hypothetical LOC633918 ... 50 0.007
296gb|AC121855.3| Mus musculus BAC clone RP24-97C18 from chromosome... 50 0.007
297emb|AL513016.5| Human DNA sequence from clone RP11-474O21 on chr... 50 0.007
298emb|BX011072.1|CNS08GPG Single read from an extremity of a full-... 50 0.007
299emb|CR855878.5| Human DNA sequence from clone RP13-469P20 on chr... 50 0.007
300gb|AF234162.1|AF234162 Leishmania braziliensis ribosomal protein... 50 0.007
301gb|AC005884.1|AC005884 Homo sapiens chromosome 17, clone hRPK.2... 50 0.007
302gb|U44800.1|PGU44800 Puccinia graminis f. sp. avenae ribosomal p... 50 0.007
303ref|XM_583734.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
304ref|XM_864088.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
305ref|XM_871857.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
306ref|XM_871768.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
307ref|XM_594319.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
308ref|XM_863859.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
309ref|XM_878778.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
310ref|XM_878746.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
311ref|XM_878716.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
312ref|XM_866556.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
313ref|XM_882175.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
314ref|XM_868968.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
315ref|XM_874719.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
316ref|XM_874636.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
317ref|XM_591988.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
318ref|XM_868944.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 48 0.029
319ref|XM_957984.1| Neurospora crassa OR74A hypothetical protein (N... 48 0.029
320ref|XM_326080.1| Neurospora crassa OR74A hypothetical protein (N... 48 0.029
321gb|BC114200.1| Bos taurus similar to 60S ribosomal protein L23a,... 48 0.029
322emb|BX071573.1|CNS09RE1 Single read from an extremity of a full-... 48 0.029
323emb|BX070668.1|CNS09QOW Single read from an extremity of a full-... 48 0.029
324emb|BX067322.1|CNS09O3Y Single read from an extremity of a full-... 48 0.029
325emb|BX063120.1|CNS09KV8 Single read from an extremity of a full-... 48 0.029
326emb|BX057144.1|CNS09G98 Single read from an extremity of a full-... 48 0.029
327emb|BX054545.1|CNS09E91 Single read from an extremity of a full-... 48 0.029
328emb|BX050057.1|CNS09ASD Single read from an extremity of a full-... 48 0.029
329emb|BX045141.1|CNS096ZT Single read from an extremity of a full-... 48 0.029
330emb|BX044622.1|CNS096LE Single read from an extremity of a full-... 48 0.029
331emb|BX039559.1|CNS092OR Single read from an extremity of a full-... 48 0.029
332emb|BX031929.1|CNS08WST Single read from an extremity of a full-... 48 0.029
333emb|BX022321.1|CNS08PDX Single read from an extremity of a full-... 48 0.029
334emb|BX026300.1|CNS08SGG Single read from an extremity of a full-... 48 0.029
335emb|BX018573.1|CNS08MHT Single read from an extremity of a full-... 48 0.029
336emb|BX016431.1|CNS08KUB Single read from an extremity of a full-... 48 0.029
337emb|BX015794.1|CNS08KCM Single read from an extremity of a full-... 48 0.029
338emb|BX009854.1|CNS08FRM Single read from an extremity of a full-... 48 0.029
339emb|BX009844.1|CNS08FRC Single read from an extremity of a full-... 48 0.029
340emb|BX008691.1|CNS08EVB Single read from an extremity of a full-... 48 0.029
341gb|DP000053.1| Oryctolagus cuniculus target 126 genomic scaffold 48 0.029
342ref|XM_516856.1| PREDICTED: Pan troglodytes similar to Rpl23a pr... 46 0.11
343gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome ... 46 0.11
344ref|XR_002727.1| PREDICTED: Mus musculus similar to 60S ribosoma... 46 0.11
345ref|XM_982279.1| PREDICTED: Mus musculus similar to 60S ribosoma... 46 0.11
346ref|XM_847323.1| PREDICTED: Canis familiaris similar to 60S ribo... 46 0.11
347ref|XM_905447.2| PREDICTED: Mus musculus similar to 60S ribosoma... 46 0.11
348ref|XM_136585.3| PREDICTED: Mus musculus similar to 60S ribosoma... 46 0.11
349gb|AC123557.4| Mus musculus BAC clone RP23-183P22 from 1, comple... 46 0.11
350emb|AL603865.4| Human DNA sequence from clone RP11-129H15 on chr... 46 0.11
351emb|AL162411.23| Human DNA sequence from clone RP11-106A1 on chr... 46 0.11
352emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chr... 46 0.11
353gb|AC099673.2| Homo sapiens chromosome 1 clone RP11-109H10, comp... 46 0.11
354gb|AC132032.1| Homo sapiens 3 BAC RP11-4H14 (Roswell Park Cancer... 46 0.11
355gb|AC099335.2| Homo sapiens chromosome 1 clone RP11-104D3, compl... 46 0.11
356gb|AC153852.9| Mus musculus 10 BAC RP23-136F8 (Roswell Park Canc... 46 0.11
357gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex B... 46 0.11
358gb|AC148682.1| Macaca mulatta Major Histocompatibility Complex M... 46 0.11
359dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 46 0.11
360ref|XM_224270.3| PREDICTED: Rattus norvegicus similar to putativ... 46 0.11
361ref|XM_344325.2| PREDICTED: Rattus norvegicus similar to 60S rib... 46 0.11
362gb|AC118202.8| Mus musculus chromosome 10, clone RP23-378J3, com... 46 0.11
363gb|AC145303.4| Mus musculus BAC clone RP23-411P20 from 14, compl... 46 0.11
364emb|AL714007.10| Mouse DNA sequence from clone RP23-295M3 on chr... 46 0.11
365ref|NM_023006.1| Homo sapiens kallikrein 15 (KLK15), transcript ... 44 0.45
366ref|NM_017509.2| Homo sapiens kallikrein 15 (KLK15), transcript ... 44 0.45
367ref|NM_138563.1| Homo sapiens kallikrein 15 (KLK15), transcript ... 44 0.45
368ref|NM_138564.1| Homo sapiens kallikrein 15 (KLK15), transcript ... 44 0.45
369gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 44 0.45
370gb|AY373374.1| Homo sapiens kallikrein 15 isoform 6 preproprotei... 44 0.45
371gb|AY373373.1| Homo sapiens kallikrein 15 isoform 5 preproprotei... 44 0.45
372gb|AC008745.7| Homo sapiens chromosome 19 clone CTD-2571L23, com... 44 0.45
373gb|AC010325.7| Homo sapiens chromosome 19 clone CTD-2568A17, com... 44 0.45
374gb|AY094609.1| Homo sapiens kallikrein 1, renal/pancreas/salivar... 44 0.45
375gb|AF303046.1|AF303046 Homo sapiens prostinogen mRNA, complete cds 44 0.45
376gb|AF242195.1|AF242195 Homo sapiens KLK15 (KLK15) gene, complete... 44 0.45
377gb|AF243527.1|AF243527 Homo sapiens serine protease gene cluster... 44 0.45
378ref|XM_578099.1| PREDICTED: Rattus norvegicus similar to 60S rib... 44 0.45
379gb|AY873984.1| Oikopleura dioica fosmid Oiko-OtxiI.10F.1A orthod... 44 0.45
380gb|AY873985.1| Oikopleura dioica fosmid Oiko-OtxiIII.7D.4A ortho... 44 0.45
381gb|AY873983.1| Oikopleura dioica fosmid Oiko-OtxiVIII.7E.98 orth... 44 0.45
382emb|AL805935.6| Mouse DNA sequence from clone RP23-326E10 on chr... 44 0.45
383gb|AY441143.1| Armigeres subalbatus ASAP ID: 42583 cytosolic lar... 42 1.8
384gb|AY431258.1| Aedes aegypti ASAP ID: 37257 cytosolic large ribo... 42 1.8
385gb|AC108777.7| Mus musculus chromosome 18, clone RP23-368H22, co... 42 1.8
386gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence 42 1.8
387gb|AC105378.10| Trypanosoma brucei chromosome 7 clone RPCI93-27E... 42 1.8
388gb|AC154354.2| Mus musculus BAC clone RP23-203C5 from chromosome... 42 1.8
389ref|XM_873448.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
390ref|XM_864494.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
391ref|XM_873326.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
392ref|XM_873228.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
393ref|XM_873124.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
394ref|XM_873022.1| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
395ref|XM_589100.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
396ref|XM_603720.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 42 1.8
397ref|XM_905304.2| PREDICTED: Mus musculus similar to 60S ribosoma... 42 1.8
398ref|XM_820575.1| Trypanosoma brucei TREU927 clone RPCI93-27E10 6... 42 1.8
399ref|XM_820574.1| Trypanosoma brucei TREU927 clone RPCI93-27E10 6... 42 1.8
400emb|CR936845.11| Mouse DNA sequence from clone DN-279H6 on chrom... 42 1.8
401emb|AL110502.1|HSDJ635E8 Human DNA sequence from clone RP4-635E8... 42 1.8
402emb|BX062946.1|CNS09KQE Single read from an extremity of a full-... 42 1.8
403emb|BX061971.1|CNS09JZB Single read from an extremity of a full-... 42 1.8
404emb|BX051417.1|CNS09BU5 Single read from an extremity of a full-... 42 1.8
405emb|BX047042.1|CNS098GM Single read from an extremity of a full-... 42 1.8
406emb|BX045322.1|CNS0974U Single read from an extremity of a full-... 42 1.8
407emb|BX040648.1|CNS093J0 Single read from an extremity of a full-... 42 1.8
408emb|BX021746.1|CNS08OXY Single read from an extremity of a full-... 42 1.8
409emb|BX015401.1|CNS08K1P Single read from an extremity of a full-... 42 1.8
410emb|BX013157.1|CNS08IBD Single read from an extremity of a full-... 42 1.8
411emb|BX012975.1|CNS08I6B Single read from an extremity of a full-... 42 1.8
412emb|BX009818.1|CNS08FQM Single read from an extremity of a full-... 42 1.8
413emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chro... 42 1.8
414gb|BC041993.1| Homo sapiens cDNA clone IMAGE:5304009 42 1.8
415gb|AC067796.11| Homo sapiens chromosome 18, clone RP11-609K12, c... 42 1.8
416gb|AC093690.5| Homo sapiens BAC clone RP11-731I19 from 2, comple... 42 1.8
417gb|AC158388.2| Mus musculus BAC clone RP24-545I9 from chromosome... 42 1.8
418ref|XM_574925.1| PREDICTED: Rattus norvegicus similar to 60S rib... 42 1.8
419emb|AL445883.3|CNS07EEQ Human chromosome 14 DNA sequence BAC R-9... 42 1.8
420emb|AL355885.4|CNS05TCW Human chromosome 14 DNA sequence BAC R-4... 42 1.8
421gb|L21172.1|TRBRPL25A Trypanosoma brucei brucei ribosomal protei... 42 1.8
422ref|XM_472119.1| Oryza sativa (japonica cultivar-group), predic... 40 7.0
423gb|AC145785.2| Xenopus tropicalis clone CH216-102H4, complete se... 40 7.0
424ref|XM_369574.1| Magnaporthe grisea 70-15 chromosome III hypothe... 40 7.0
425gb|AC009974.10| Homo sapiens BAC clone RP11-459I19 from 2, compl... 40 7.0
426gb|AC094950.6| Rattus norvegicus 14 BAC CH230-6H12 (Children's H... 40 7.0
427gb|BC065219.1| Homo sapiens cDNA clone IMAGE:5724338, partial cds 40 7.0
428gb|AC008020.37| Mus musculus strain 129S6/SvEvTac chromosome 16 ... 40 7.0
429emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on ch... 40 7.0
430emb|AL589822.18| Human DNA sequence from clone RP11-109G10 on ch... 40 7.0
431emb|AL354930.11| Human DNA sequence from clone RP11-185B14 on ch... 40 7.0
432emb|AL133395.21| Human DNA sequence from clone RP11-446H13 on ch... 40 7.0
433emb|BX052733.1|CNS09CUP Single read from an extremity of a full-... 40 7.0
434emb|BX006514.1|CNS08D6U Single read from an extremity of a full-... 40 7.0
435emb|AL663020.4|OSJN00220 Oryza sativa genomic DNA, chromosome 4,... 40 7.0
436emb|AL732632.4| Zebrafish DNA sequence from clone CH211-140K5 in... 40 7.0
437dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 7.0
438gb|AF034131.1| Gossypium hirsutum MYB-like DNA-binding domain pr... 40 7.0
439gb|AE012414.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 7.0
440gb|AC099789.2| Homo sapiens chromosome 1 clone RP11-377K22, comp... 40 7.0
441gb|CP000249.1| Frankia sp. CcI3, complete genome 40 7.0
442gb|AC139319.6| Mus musculus BAC clone RP24-439B16 from chromosom... 40 7.0
443gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 7.0
444gb|AF377314.1|AF377314 Synthetic construct clone R7 Gossypium hi... 40 7.0
445gb|AF377313.1|AF377313 Synthetic construct clone R6 Gossypium hi... 40 7.0
446gb|AF377312.1|AF377312 Synthetic construct clone R4 Gossypium hi... 40 7.0
447gb|AF377311.1|AF377311 Synthetic construct clone R3 Gossypium hi... 40 7.0
448gb|AF377310.1|AF377310 Synthetic construct clone R2 Gossypium hi... 40 7.0
449gb|AF377309.1|AF377309 Synthetic construct clone R1 Gossypium hi... 40 7.0
450gb|AF377308.1|AF377308 Gossypium hirsutum A-genome myb-like tran... 40 7.0
451gb|AF377306.1|AF377306 Gossypium herbaceum myb-like transcriptio... 40 7.0
452gb|AF377305.1|AF377305 Gossypium raimondii myb-like transcriptio... 40 7.0
453emb|AJ621037.1| Tetraodon nigroviridis partial non-LTR retrotran... 40 7.0
454gb|AC011298.7| Homo sapiens BAC clone RP11-118M12 from 2, comple... 40 7.0
455gb|AC079831.24| Mus musculus strain C57BL/6J chromosome 16 clone... 40 7.0
456ref|NM_203458.2| Homo sapiens Notch homolog 2 (Drosophila) N-ter... 40 7.0
457gb|AF377307.1| Gossypium hirsutum D-genome myb-like transcriptio... 40 7.0
458gb|AC112784.5| Homo sapiens BAC clone RP13-555N8 from 2, complet... 40 7.0
459gb|AC133573.11| Mus musculus strain C57BL/6J clone rp23-139f17, ... 40 7.0
460gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 7.0
461dbj|AP003050.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 7.0
462gb|AC113264.21| Mus musculus strain C57BL/6J chromosome 16 clone... 40 7.0
463emb|AM167520.1| Malus x domestica transposon gene for putative D... 40 7.0

>ref|XM_473060.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  347 bits (175), Expect = 2e-92
 Identities = 310/355 (87%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||| ||||||||||||||||| |||||||| |||||||||||||||||||| || 
Sbjct: 455 atgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttcacgtaa 396

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||||| || || ||||||||||| ||||| || ||||| |||||||| ||||||
Sbjct: 395 gccttcttcttcccatcaggcctgatcagagtgttcactttctttgcctggatgtcgtac 336

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||||||||||||||||||||||| ||||| |||||||| |||||||| 
Sbjct: 335 atcttcttgacagcagccttgatcttcttcttgtcagccttaaggtcaacaatgaagacc 276

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           || ||||||||||| ||||||||||||||||| || || ||||| |  || ||||| |||
Sbjct: 275 agagtgttgttgtcttcgatcttcttcattgcggattcagtggtaaggggatacttaagg 216

                                                                       
Query: 404 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 463
           |||||||| || |||||||||||||| || ||||||||||  || |||||||||||||||
Sbjct: 215 atctggtactgatcaagcttgttcctcccaggggtactgactcttgggtacttggggtcc 156

                                                                  
Query: 464 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
           || | |||   || |||||||||||||||||||||||| || |||||||||||||
Sbjct: 155 ctagacttcttcaaggtcttggggcggtgaaatgtcacggatgtgcggatcttct 101



to top

>gb|BT017833.1| Zea mays clone EL01N0509B09.c mRNA sequence
          Length = 824

 Score =  335 bits (169), Expect = 9e-89
 Identities = 313/361 (86%)
 Strand = Plus / Minus

                                                                       
Query: 158 acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
           ||||| ||||||||||| |||||||| || ||||||||||||||||| || |||||||||
Sbjct: 530 acttagatgatgccgattttgttggcaacatcaagagcatcatagtcaggagtcagcttc 471

                                                                       
Query: 218 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 277
           || || ||||||||||| || || |||||||||| |||||| |||||||| |||||||| 
Sbjct: 470 acgtaagccttcttcttcccatcaggcctgatcaaggtgttgaccttctttgcctggatg 411

                                                                       
Query: 278 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 337
           || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 410 tcatacatcttcttgacggcagccttgatcttcttcttgtctgccttgaggtcaacaatg 351

                                                                       
Query: 338 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 397
           ||||| || |||||||| || || ||||||||||| || || || ||||| |  ||||||
Sbjct: 350 aagaccagagtgttgttatcttcaatcttcttcatcgctgattctgtggtaagggggtac 291

                                                                       
Query: 398 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 457
           ||||| || ||||| || ||||||||||||||||| |  || ||||| |  |||||||||
Sbjct: 290 ttgagaatttggtactgatcaagcttgttccttccggtagtgctgattcgtgggtacttg 231

                                                                       
Query: 458 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 517
           |||||||| |||||   ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 230 gggtccctagccttcttcagggtcgtggggcggtgaaatgtcacagacgtgcggatcttc 171

            
Query: 518 t 518
           |
Sbjct: 170 t 170



to top

>ref|NM_184009.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 459

 Score =  331 bits (167), Expect = 1e-87
 Identities = 308/355 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||| || ||||||||||| |||||||||||||||||||| || |||||||| || 
Sbjct: 455 atgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttcacgtaa 396

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| || |||
Sbjct: 395 gccttcttcttgccgtcaggcctgatcagagtgttaactttctttgcctggatgtcatac 336

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || || |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 335 atcttcttgacagctgccttgatcttcttcttgtctgccttgaggtcgacgatgaagaca 276

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           |||||||||||||| || ||||||||||| ||||| ||||| || |  ||||||||||||
Sbjct: 275 agggtgttgttgtcttcaatcttcttcatggcagattcggtcgtaagggggtacttgagg 216

                                                                       
Query: 404 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 463
           || ||||| || |||||||||||||| || || | |||||  || |||||||| ||||| 
Sbjct: 215 atttggtactgatcaagcttgttcctgccaggtgcactgactcttgggtacttagggtct 156

                                                                  
Query: 464 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
           || |||||   ||||||||| || | |||||||||||| || |||||||||||||
Sbjct: 155 ctcgccttcttcagggtctttggtctgtgaaatgtcaccgaagtgcggatcttct 101



to top

>gb|BT018281.1| Zea mays clone EL01T0204F12.c mRNA sequence
          Length = 912

 Score =  331 bits (167), Expect = 1e-87
 Identities = 308/355 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||||||||| ||||||||||| ||||||||||||||||| ||  | |||||||| || 
Sbjct: 608 atgatgccgattttgttggccacatcaagagcatcatagtcaggcataagcttcacgtaa 549

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||||| || || ||||||||||||||||| |||||||||||||| || || |||
Sbjct: 548 gccttcttctttccatcaggcctgatcagggtgttgaccttcttggcctgaatgtcatac 489

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||||||||||||||||||||||||||||||||||| || |||||||||
Sbjct: 488 atcttcttgacagcagccttgatcttcttcttgtctgccttgaggtcgacaatgaagaca 429

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           || |||||||| || || ||||||||||| || || || ||||| |  || |||||||| 
Sbjct: 428 agagtgttgttatcttcaatcttcttcatcgccgattctgtggtgaggggatacttgaga 369

                                                                       
Query: 404 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 463
           || ||||| || ||||||||||||||||| |  || ||||| || |||||||||||||||
Sbjct: 368 atttggtactgatcaagcttgttccttccggtagtgctgattcttgggtacttggggtcc 309

                                                                  
Query: 464 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
           || |||||   ||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 308 ctagccttcttcagggtcttggggcggtgaaatgtcacggacgtgcggatcttct 254



to top

>dbj|AK120842.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022J07, full
           insert sequence
          Length = 687

 Score =  327 bits (165), Expect = 2e-86
 Identities = 312/361 (86%)
 Strand = Plus / Minus

                                                                       
Query: 158 acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
           ||||| |||||||| || ||||||||||| |||||||||||||||||||| |  ||||||
Sbjct: 544 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagcgagcttc 485

                                                                       
Query: 218 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 277
           || || ||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| 
Sbjct: 484 acgtaagccttcttcttgccgtcaggcctgatcagagtgttaactttctttgcctggatg 425

                                                                       
Query: 278 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 337
           || |||||||| || || || |||||||||||||||||||||||||||||||| ||||||
Sbjct: 424 tcatacatcttcttgacagctgccttgatcttcttcttgtctgccttgaggtcgacgatg 365

                                                                       
Query: 338 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 397
           |||||||||||||||||||| || ||||||||||| ||||| ||||| || |  ||||||
Sbjct: 364 aagacaagggtgttgttgtcttcaatcttcttcatggcagattcggtcgtaagggggtac 305

                                                                       
Query: 398 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 457
           |||||||| ||||| || |||||||||||||| || || | |||||  || |||||||| 
Sbjct: 304 ttgaggatttggtactgatcaagcttgttcctgccaggtgcactgactcttgggtactta 245

                                                                       
Query: 458 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 517
           ||||| || |||||   ||||||||| || | |||||||||||| || ||||||||||||
Sbjct: 244 gggtctctcgccttcttcagggtctttggtctgtgaaatgtcaccgaagtgcggatcttc 185

            
Query: 518 t 518
           |
Sbjct: 184 t 184



to top

>gb|BT017941.1| Zea mays clone EL01N0521B03.c mRNA sequence
          Length = 770

 Score =  323 bits (163), Expect = 3e-85
 Identities = 307/355 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||||||||| ||||||||||| ||||||||||||||||| || || |||||||| || 
Sbjct: 609 atgatgccgattttgttggccacatcaagagcatcatagtcaggcgtaagcttcacgtaa 550

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||||| || || || |||||||||||||| |||||||||||||| || || |||
Sbjct: 549 gccttcttctttccatcaggtctgatcagggtgttgaccttcttggcctgaatgtcatac 490

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 489 atcttcttgacagcagccttgatcttcttcttgtctgccttgaggtcgacaatgaagacc 430

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           || |||||||| || || ||||||||||| || || || ||||| |  || |||||||| 
Sbjct: 429 agagtgttgttatcttcaatcttcttcatcgccgattctgtggtgaggggatacttgaga 370

                                                                       
Query: 404 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 463
           || ||||| || ||||||||||||||||| |  || ||||| || |||||||||||||||
Sbjct: 369 atttggtactgatcaagcttgttccttccggaagtgctgattcttgggtacttggggtcc 310

                                                                  
Query: 464 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
           || |||||   ||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 309 ctagccttcttcagggtcttggggcggtgaaatgtcacggacgtgcggatcttct 255



to top

>gb|BT016465.1| Zea mays clone Contig298 mRNA sequence
          Length = 630

 Score =  319 bits (161), Expect = 5e-84
 Identities = 311/361 (86%)
 Strand = Plus / Minus

                                                                       
Query: 158 acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
           ||||| ||||||||||| |||||||| || ||||||||||||||||| || |||||||||
Sbjct: 470 acttagatgatgccgattttgttggcaacatcaagagcatcatagtcaggagtcagcttc 411

                                                                       
Query: 218 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 277
           || || ||||| || || || || |||||||||| |||||| |||||||| |||||||| 
Sbjct: 410 acgtaagccttttttttcccatcaggcctgatcaaggtgttgaccttctttgcctggatg 351

                                                                       
Query: 278 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 337
           || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 350 tcatacatcttcttgacggcagccttgatcttcttcttgtctgccttgaggtcaacaatg 291

                                                                       
Query: 338 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 397
           ||||| || |||||||| || || ||||||||||| || || || ||||| |  ||||||
Sbjct: 290 aagaccagagtgttgttatcttcaatcttcttcatcgctgattctgtggtaagggggtac 231

                                                                       
Query: 398 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 457
           ||||| || ||||| || ||||||||||||||||| |  || ||||| |  |||||||||
Sbjct: 230 ttgagaatttggtactgatcaagcttgttccttccggtagtgctgattcgtgggtacttg 171

                                                                       
Query: 458 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 517
           |||||||| |||||   ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 170 gggtccctagccttcttcagggtcgtggggcggtgaaatgtcacagacgtgcggatcttc 111

            
Query: 518 t 518
           |
Sbjct: 110 t 110



to top

>gb|AY104035.1| Zea mays PCO096331 mRNA sequence
          Length = 1154

 Score =  315 bits (159), Expect = 8e-83
 Identities = 306/355 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||||||||| ||||||||||| ||||||||||||||||| ||  | |||||||| || 
Sbjct: 844 atgatgccgattttgttggccacatcaagagcatcatagtcaggcataagcttcacgtaa 785

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||||| || || |||||||||| |||||| |||||||||||||| || || |||
Sbjct: 784 gccttcttctttccatcaggcctgatcaaggtgttgaccttcttggcctgaatgtcatac 725

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||||||||||||||||||||||||||||||||||| || |||||||| 
Sbjct: 724 atcttcttgacagcagccttgatcttcttcttgtctgccttgaggtcgacaatgaagacc 665

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           || |||||||| || || ||||||||||| || || || ||||| |  || |||||||| 
Sbjct: 664 agagtgttgttatcttcaatcttcttcatcgccgattctgtggtgaggggatacttgaga 605

                                                                       
Query: 404 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 463
           || ||||| || ||||||||||||||||| |  || ||||| || |||||||||||||||
Sbjct: 604 atttggtactgatcaagcttgttccttccggtagtgctgattcttgggtacttggggtcc 545

                                                                  
Query: 464 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
           || |||||   ||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 544 ctagccttcttcagggtcttggggcggtgaaatgtcacggacgtgcggatcttct 490



to top

>dbj|AK102699.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033103K16, full
           insert sequence
          Length = 1188

 Score =  268 bits (135), Expect = 2e-68
 Identities = 255/295 (86%)
 Strand = Plus / Minus

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||||||||||| ||||||||||| |||||||| ||||| |||||||| || |||
Sbjct: 475 gccttcttcttgccgtcaggcctgatcagagtgttaactttctttgcctggatgtcatac 416

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || || |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 415 atcttcttgacagctgccttgatcttcttcttgtctgccttgaggtcgacgatgaagaca 356

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           |||||||||||||| || ||||||||||| ||||| ||||| || |  ||||||||||||
Sbjct: 355 agggtgttgttgtcttcaatcttcttcatggcagattcggtcgtaagggggtacttgagg 296

                                                                       
Query: 404 atctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtcc 463
           || ||||| || |||||||||||||| || || | |||||  || |||||||| ||||| 
Sbjct: 295 atttggtactgatcaagcttgttcctgccaggtgcactgactcttgggtacttagggtct 236

                                                                  
Query: 464 ctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
           || |||||   ||||||||| || | |||||||||||| || |||||||||||||
Sbjct: 235 ctcgccttcttcagggtctttggtctgtgaaatgtcaccgaagtgcggatcttct 181



to top

>gb|AF061508.1|AF061508 Zea mays ribosomal protein L25 mRNA, partial cds
          Length = 599

 Score =  266 bits (134), Expect = 7e-68
 Identities = 269/314 (85%)
 Strand = Plus / Minus

                                                                       
Query: 158 acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
           ||||| |||||||| || ||||||||||| ||||||||||||||||| || |||||||||
Sbjct: 334 acttagatgatgccaattttgttggccacatcaagagcatcatagtcgggagtcagcttc 275

                                                                       
Query: 218 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 277
           || || ||||||||||| || || |||||||||| |||||| || ||||| |||||||| 
Sbjct: 274 acgtaagccttcttcttcccatcaggcctgatcaaggtgttgactttctttgcctggatg 215

                                                                       
Query: 278 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 337
           || |||||||| || || |||||||||||||||||||||||||||||||||||||| |||
Sbjct: 214 tcatacatcttcttgacggcagccttgatcttcttcttgtctgccttgaggtcaacaatg 155

                                                                       
Query: 338 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 397
           ||||| || |||||||| || || ||||||||||| || || || ||||| |  ||||||
Sbjct: 154 aagaccagagtgttgttatcttcaatcttcttcatcgctgattctgtggtaagggggtac 95

                                                                       
Query: 398 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 457
           ||||| || ||||| || ||||||||||||||||| |  || ||||| |  |||||||||
Sbjct: 94  ttgagaatttggtactgatcaagcttgttccttccggtagtgctgattcgtgggtacttg 35

                         
Query: 458 gggtccctggcctt 471
           |||||||| |||||
Sbjct: 34  gggtccctagcctt 21



to top

>gb|AY110987.1| Zea mays CL1782_3 mRNA sequence
          Length = 878

 Score =  260 bits (131), Expect = 4e-66
 Identities = 301/361 (83%)
 Strand = Plus / Minus

                                                                       
Query: 158 acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
           ||||| |||||||| || ||||||||||| ||||| ||||| ||||| |||||||| |||
Sbjct: 519 acttagatgatgccaattttgttggccacatcaagggcatcgtagtcgggtgtcagtttc 460

                                                                       
Query: 218 acataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggata 277
           ||||| ||||||||||| || || ||||||||||||||||| |||||||| || || || 
Sbjct: 459 acataagccttcttcttcccatcaggcctgatcagggtgttgaccttctttgcttgaatg 400

                                                                       
Query: 278 tcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatg 337
           || |||||||| || |||||||||||||||     ||||||||||||||||||||| || 
Sbjct: 399 tcatacatcttcttgaccgcagccttgatcnnnnncttgtctgccttgaggtcaacaata 340

                                                                       
Query: 338 aagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtac 397
           ||||| || |||||||| || || ||||||||||||||||| || ||||| |     |||
Sbjct: 339 aagaccagagtgttgttatcttcaatcttcttcattgcagattctgtggtgannnnntac 280

                                                                       
Query: 398 ttgaggatctggtattggtcaagcttgttccttcccggggtactgatcctggggtacttg 457
           ||||| || ||||| || ||||||||||| ||||| |  || ||||| || |||||||| 
Sbjct: 279 ttgagaatttggtactgatcaagcttgtttcttccagtagtgctgattcttgggtacttc 220

                                                                       
Query: 458 gggtccctggccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttc 517
           ||||||||||||||   ||||||||||||  |||||||||| ||||| ||||| ||||||
Sbjct: 219 gggtccctggccttcttcagggtcttgggctggtgaaatgttacagatgtgcgaatcttc 160

            
Query: 518 t 518
           |
Sbjct: 159 t 159



to top

>emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02,
              complete sequence
          Length = 173171

 Score =  252 bits (127), Expect = 1e-63
 Identities = 238/275 (86%)
 Strand = Plus / Plus

                                                                          
Query: 244    cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
              ||||||||| ||||| || ||||| |||||||| ||||||||||| || || ||||||||
Sbjct: 104239 cctgatcagagtgttcactttctttgcctggatgtcgtacatcttcttgacagcagcctt 104298

                                                                          
Query: 304    gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
              ||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||
Sbjct: 104299 gatcttcttcttgtcagccttaaggtcaacaatgaagaccagagtgttgttgtcttcgat 104358

                                                                          
Query: 364    cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
              |||||||||||| || || ||||| |  || ||||| ||||||||||| || ||||||||
Sbjct: 104359 cttcttcattgcggattcagtggtaaggggatacttaaggatctggtactgatcaagctt 104418

                                                                          
Query: 424    gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 483
              |||||| || ||||||||||  || ||||||||||||||||| | |||   || ||||||
Sbjct: 104419 gttcctcccaggggtactgactcttgggtacttggggtccctagacttcttcaaggtctt 104478

                                                 
Query: 484    ggggcggtgaaatgtcacagacgtgcggatcttct 518
              |||||||||||||||||| || |||||||||||||
Sbjct: 104479 ggggcggtgaaatgtcacggatgtgcggatcttct 104513



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                          
Query: 158    acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
              ||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 104074 acttagatgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttc 104133

                                            
Query: 218    acataggccttcttcttgccgtccggcctg 247
              || || ||||||||||| || || ||||||
Sbjct: 104134 acgtaagccttcttcttcccatcaggcctg 104163



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 21     atcaaattcatgaaagtgtgcagc 44
              |||||||||||| |||||||||||
Sbjct: 103950 atcaaattcatggaagtgtgcagc 103973



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  252 bits (127), Expect = 1e-63
 Identities = 238/275 (86%)
 Strand = Plus / Plus

                                                                            
Query: 244      cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
                ||||||||| ||||| || ||||| |||||||| ||||||||||| || || ||||||||
Sbjct: 24983654 cctgatcagagtgttcactttctttgcctggatgtcgtacatcttcttgacagcagcctt 24983713

                                                                            
Query: 304      gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
                ||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||
Sbjct: 24983714 gatcttcttcttgtcagccttaaggtcaacaatgaagaccagagtgttgttgtcttcgat 24983773

                                                                            
Query: 364      cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
                |||||||||||| || || ||||| |  || ||||| ||||||||||| || ||||||||
Sbjct: 24983774 cttcttcattgcggattcagtggtaaggggatacttaaggatctggtactgatcaagctt 24983833

                                                                            
Query: 424      gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 483
                |||||| || ||||||||||  || ||||||||||||||||| | |||   || ||||||
Sbjct: 24983834 gttcctcccaggggtactgactcttgggtacttggggtccctagacttcttcaaggtctt 24983893

                                                   
Query: 484      ggggcggtgaaatgtcacagacgtgcggatcttct 518
                |||||||||||||||||| || |||||||||||||
Sbjct: 24983894 ggggcggtgaaatgtcacggatgtgcggatcttct 24983928



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                            
Query: 158      acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
                ||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 24983489 acttagatgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttc 24983548

                                              
Query: 218      acataggccttcttcttgccgtccggcctg 247
                || || ||||||||||| || || ||||||
Sbjct: 24983549 acgtaagccttcttcttcccatcaggcctg 24983578



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 21       atcaaattcatgaaagtgtgcagc 44
                |||||||||||| |||||||||||
Sbjct: 24983365 atcaaattcatggaagtgtgcagc 24983388



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 301      cttgatcttcttcttgtctg 320
                ||||||||||||||||||||
Sbjct: 17700188 cttgatcttcttcttgtctg 17700207



to top

>emb|AL442115.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0711G06, complete
              sequence
          Length = 148644

 Score =  252 bits (127), Expect = 1e-63
 Identities = 238/275 (86%)
 Strand = Plus / Plus

                                                                          
Query: 244    cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
              ||||||||| ||||| || ||||| |||||||| ||||||||||| || || ||||||||
Sbjct: 111713 cctgatcagagtgttcactttctttgcctggatgtcgtacatcttcttgacagcagcctt 111772

                                                                          
Query: 304    gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
              ||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |||||
Sbjct: 111773 gatcttcttcttgtcagccttaaggtcaacaatgaagaccagagtgttgttgtcttcgat 111832

                                                                          
Query: 364    cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
              |||||||||||| || || ||||| |  || ||||| ||||||||||| || ||||||||
Sbjct: 111833 cttcttcattgcggattcagtggtaaggggatacttaaggatctggtactgatcaagctt 111892

                                                                          
Query: 424    gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 483
              |||||| || ||||||||||  || ||||||||||||||||| | |||   || ||||||
Sbjct: 111893 gttcctcccaggggtactgactcttgggtacttggggtccctagacttcttcaaggtctt 111952

                                                 
Query: 484    ggggcggtgaaatgtcacagacgtgcggatcttct 518
              |||||||||||||||||| || |||||||||||||
Sbjct: 111953 ggggcggtgaaatgtcacggatgtgcggatcttct 111987



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                          
Query: 158    acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
              ||||| |||||||| ||||||||||||||||| |||||||| ||||||||||||||||||
Sbjct: 111548 acttagatgatgccaatcttgttggccacgtcgagagcatcgtagtctggtgtcagcttc 111607

                                            
Query: 218    acataggccttcttcttgccgtccggcctg 247
              || || ||||||||||| || || ||||||
Sbjct: 111608 acgtaagccttcttcttcccatcaggcctg 111637



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 21     atcaaattcatgaaagtgtgcagc 44
              |||||||||||| |||||||||||
Sbjct: 111424 atcaaattcatggaagtgtgcagc 111447



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  236 bits (119), Expect = 6e-59
 Identities = 236/275 (85%)
 Strand = Plus / Minus

                                                                            
Query: 244      cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
                ||||||||| |||||||| ||||| |||||||| || |||||||| || || || |||||
Sbjct: 13880684 cctgatcagagtgttaactttctttgcctggatgtcatacatcttcttgacagctgcctt 13880625

                                                                            
Query: 304      gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
                ||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 13880624 gatcttcttcttgtctgccttgaggtcgacgatgaagacaagggtgttgttgtcttcaat 13880565

                                                                            
Query: 364      cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
                ||||||||| ||||| ||||| || |  |||||||||||||| ||||| || ||||||||
Sbjct: 13880564 cttcttcatggcagattcggtcgtaagggggtacttgaggatttggtactgatcaagctt 13880505

                                                                            
Query: 424      gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 483
                |||||| || || | |||||  || |||||||| ||||| || |||||   |||||||||
Sbjct: 13880504 gttcctgccaggtgcactgactcttgggtacttagggtctctcgccttcttcagggtctt 13880445

                                                   
Query: 484      ggggcggtgaaatgtcacagacgtgcggatcttct 518
                 || | |||||||||||| || |||||||||||||
Sbjct: 13880444 tggtctgtgaaatgtcaccgaagtgcggatcttct 13880410



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Minus

                                                                            
Query: 158      acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
                ||||| |||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 13880857 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttc 13880798

                                              
Query: 218      acataggccttcttcttgccgtccggcctg 247
                || || ||||||||||||||||| ||||||
Sbjct: 13880797 acgtaagccttcttcttgccgtcaggcctg 13880768



to top

>dbj|AP003764.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1051E10
          Length = 207782

 Score =  236 bits (119), Expect = 6e-59
 Identities = 236/275 (85%)
 Strand = Plus / Minus

                                                                         
Query: 244   cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
             ||||||||| |||||||| ||||| |||||||| || |||||||| || || || |||||
Sbjct: 40986 cctgatcagagtgttaactttctttgcctggatgtcatacatcttcttgacagctgcctt 40927

                                                                         
Query: 304   gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
             ||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 40926 gatcttcttcttgtctgccttgaggtcgacgatgaagacaagggtgttgttgtcttcaat 40867

                                                                         
Query: 364   cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
             ||||||||| ||||| ||||| || |  |||||||||||||| ||||| || ||||||||
Sbjct: 40866 cttcttcatggcagattcggtcgtaagggggtacttgaggatttggtactgatcaagctt 40807

                                                                         
Query: 424   gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 483
             |||||| || || | |||||  || |||||||| ||||| || |||||   |||||||||
Sbjct: 40806 gttcctgccaggtgcactgactcttgggtacttagggtctctcgccttcttcagggtctt 40747

                                                
Query: 484   ggggcggtgaaatgtcacagacgtgcggatcttct 518
              || | |||||||||||| || |||||||||||||
Sbjct: 40746 tggtctgtgaaatgtcaccgaagtgcggatcttct 40712



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Minus

                                                                         
Query: 158   acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
             ||||| |||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 41159 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttc 41100

                                           
Query: 218   acataggccttcttcttgccgtccggcctg 247
             || || ||||||||||||||||| ||||||
Sbjct: 41099 acgtaagccttcttcttgccgtcaggcctg 41070



to top

>dbj|AP003852.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0440D10
          Length = 144340

 Score =  236 bits (119), Expect = 6e-59
 Identities = 236/275 (85%)
 Strand = Plus / Minus

                                                                          
Query: 244    cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
              ||||||||| |||||||| ||||| |||||||| || |||||||| || || || |||||
Sbjct: 118087 cctgatcagagtgttaactttctttgcctggatgtcatacatcttcttgacagctgcctt 118028

                                                                          
Query: 304    gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
              ||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||
Sbjct: 118027 gatcttcttcttgtctgccttgaggtcgacgatgaagacaagggtgttgttgtcttcaat 117968

                                                                          
Query: 364    cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
              ||||||||| ||||| ||||| || |  |||||||||||||| ||||| || ||||||||
Sbjct: 117967 cttcttcatggcagattcggtcgtaagggggtacttgaggatttggtactgatcaagctt 117908

                                                                          
Query: 424    gttccttcccggggtactgatcctggggtacttggggtccctggccttggacagggtctt 483
              |||||| || || | |||||  || |||||||| ||||| || |||||   |||||||||
Sbjct: 117907 gttcctgccaggtgcactgactcttgggtacttagggtctctcgccttcttcagggtctt 117848

                                                 
Query: 484    ggggcggtgaaatgtcacagacgtgcggatcttct 518
               || | |||||||||||| || |||||||||||||
Sbjct: 117847 tggtctgtgaaatgtcaccgaagtgcggatcttct 117813



 Score =  107 bits (54), Expect = 4e-20
 Identities = 81/90 (90%)
 Strand = Plus / Minus

                                                                          
Query: 158    acttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttc 217
              ||||| |||||||| || ||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 118260 acttaaatgatgccaattttgttggccacatcaagagcatcatagtctggagtgagcttc 118201

                                            
Query: 218    acataggccttcttcttgccgtccggcctg 247
              || || ||||||||||||||||| ||||||
Sbjct: 118200 acgtaagccttcttcttgccgtcaggcctg 118171



to top

>gb|BT018262.1| Zea mays clone EL01T0202C04.c mRNA sequence
          Length = 476

 Score =  190 bits (96), Expect = 3e-45
 Identities = 288/352 (81%)
 Strand = Plus / Minus

                                                                       
Query: 167 atgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacataggcc 226
           |||||||| |||||||| || |||||||||||||||||  | ||||||||||| || |||
Sbjct: 400 atgccgattttgttggcaacatcaagagcatcatagtcaagagtcagcttcacgtaagcc 341

                                                                       
Query: 227 ttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtacatc 286
           | |||||| || || || ||||||| || ||| |||||||| |||||||| || ||||||
Sbjct: 340 tgcttcttcccatcagggctgatcaaggggttgaccttctttgcctggatgtcatacatc 281

                                                                       
Query: 287 ttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagg 346
           || || || ||||||||||||||||||||||||||||||||| |||| |||||||| |  
Sbjct: 280 ttcttgacggcagccttgatcttcttcttgtctgccttgagggcaaccatgaagaccaca 221

                                                                       
Query: 347 gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgaggatc 406
           | || | | || || ||||||||||| ||  | || | ||| |  ||| ||||||| || 
Sbjct: 220 gggtggatatcttcaatcttcttcatcgctaattctgaggtaagggggcacttgagaatt 161

                                                                       
Query: 407 tggtattggtcaagcttgttccttcccggggtactgatcctggggtacttggggtccctg 466
           ||||| || ||||||||||||||||| |  || ||||| |  ||| ||||||||||||| 
Sbjct: 160 tggtactgatcaagcttgttccttccggtagtgctgattcgtgggaacttggggtcccta 101

                                                               
Query: 467 gccttggacagggtcttggggcggtgaaatgtcacagacgtgcggatcttct 518
             |||   ||||||| |||||||||||||||||||||||  |||||||||||
Sbjct: 100 cacttcttcagggtcgtggggcggtgaaatgtcacagacacgcggatcttct 49



to top

>gb|AF349961.1| Daucus carota ribosome protein L23a mRNA, complete cds
          Length = 732

 Score =  168 bits (85), Expect = 1e-38
 Identities = 199/237 (83%)
 Strand = Plus / Minus

                                                                       
Query: 194 gcatcatagtctggtgtcagcttcacataggccttcttcttgccgtccggcctgatcagg 253
           ||||| |||||||| |||| | | |||||||| |||||  | ||||| ||||||||||  
Sbjct: 443 gcatcgtagtctggagtcaacctaacataggctttctttgttccgtcgggcctgatcaat 384

                                                                       
Query: 254 gtgttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttcttc 313
           ||||| |||||||||| ||| |||||||||||||| || || ||| |||| |||||||||
Sbjct: 383 gtgttgaccttcttggtctgaatatcgtacatcttcttgacagcatccttaatcttcttc 324

                                                                       
Query: 314 ttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcatt 373
           ||||  ||   || |||||| ||||| || |||||||| ||||| || ||||||||||||
Sbjct: 323 ttgttggcacggatgtcaacaatgaaaaccagggtgttattgtcttcaatcttcttcatt 264

                                                                    
Query: 374 gcagactcggtggtcaaagggtacttgaggatctggtattggtcaagcttgttcctt 430
           ||||| || |||||||| ||||||||||| |||||||| || |||||||||||||||
Sbjct: 263 gcagattcagtggtcaatgggtacttgagaatctggtactgatcaagcttgttcctt 207



to top

>gb|AF031542.1|AF031542 Fritillaria agrestis ribosomal protein L23a (rpl23a) mRNA, complete
           cds
          Length = 715

 Score =  168 bits (85), Expect = 1e-38
 Identities = 265/325 (81%)
 Strand = Plus / Minus

                                                                       
Query: 194 gcatcatagtctggtgtcagcttcacataggccttcttcttgccgtccggcctgatcagg 253
           |||||||||||||| |||||    ||||| ||||||||| | || || ||||||||||||
Sbjct: 538 gcatcatagtctggcgtcagtcggacatacgccttcttcgttccatcaggcctgatcagg 479

                                                                       
Query: 254 gtgttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttcttc 313
           || || || ||||||| ||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 478 gtattgactttcttggtctgaatatcatacatcttcttcacagcagctttgatcttcttc 419

                                                                       
Query: 314 ttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcatt 373
           ||||| ||    | |||||| ||||| ||||| ||||||||||| || ||||| ||||| 
Sbjct: 418 ttgtccgctcgaatgtcaacaatgaaaacaagagtgttgttgtcttcaatctttttcatg 359

                                                                       
Query: 374 gcagactcggtggtcaaagggtacttgaggatctggtattggtcaagcttgttccttccc 433
           || ||||| |||||||  || ||||||||||||||||| || || ||||||||||||   
Sbjct: 358 gccgactcagtggtcagtggatacttgaggatctggtagtgatctagcttgttccttgga 299

                                                                       
Query: 434 ggggtactgatcctggggtacttggggtccctggccttggacagggtcttggggcggtga 493
           |||| |||||| |||||||| |||||||  ||  ||||   |||||||||||| || |||
Sbjct: 298 ggggcactgattctggggtatttggggtttctatccttcttcagggtcttgggacgatga 239

                                    
Query: 494 aatgtcacagacgtgcggatcttct 518
           || || || || |||||||||||||
Sbjct: 238 aaagttaccgatgtgcggatcttct 214



to top

>gb|DQ200381.1| Solanum tuberosum clone 062E11 ribosomal protein L25-like protein
           mRNA, complete cds
          Length = 696

 Score =  153 bits (77), Expect = 7e-34
 Identities = 221/269 (82%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||| ||||||||||| || | ||||||||||||||| |||| | ||||||| 
Sbjct: 524 atgatcccgattttgttggccacatccaaagcatcatagtctggagtcaacctcacatat 465

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || |||||||||| ||| || |  ||||| | ||| || || |||
Sbjct: 464 gccttcttagtcccatcaggcctgatcaaggtattgattttctttgtctgaatgtcatac 405

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || |||||||||||||||||||| || || |||| ||| || ||||| |||
Sbjct: 404 atcttcttcacggcagccttgatcttcttcttatcagctttgatgtccacaatgaaaaca 345

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           |||||||||||||| || |||||||||||||||||||| ||||| | ||| ||||| || 
Sbjct: 344 agggtgttgttgtcttcaatcttcttcattgcagactcagtggtgagaggatactttaga 285

                                        
Query: 404 atctggtattggtcaagcttgttccttcc 432
           |||   || || ||||| |||||||||||
Sbjct: 284 atcgcatactgatcaagtttgttccttcc 256



to top

>ref|NM_129504.3| Arabidopsis thaliana ATRPL23A (RIBOSOMAL PROTEIN L23A); RNA binding
           / structural constituent of ribosome AT2G39460
           (ATRPL23A) mRNA, complete cds
          Length = 772

 Score =  147 bits (74), Expect = 4e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 594 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 535

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 534 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 475

                                                                       
Query: 277 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 474 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 415

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 414 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 355

                                             
Query: 397 cttgaggatctggtattggtcaagcttgttcctt 430
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 354 cttaaggatttggtagtgatccaacttgttcctt 321



to top

>gb|AY039850.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, complete cds
          Length = 666

 Score =  147 bits (74), Expect = 4e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 521 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 462

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 461 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 402

                                                                       
Query: 277 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 401 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 342

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 341 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 282

                                             
Query: 397 cttgaggatctggtattggtcaagcttgttcctt 430
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 281 cttaaggatttggtagtgatccaacttgttcctt 248



to top

>gb|AY037235.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, complete cds
          Length = 666

 Score =  147 bits (74), Expect = 4e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 521 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 462

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 461 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 402

                                                                       
Query: 277 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 401 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 342

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 341 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 282

                                             
Query: 397 cttgaggatctggtattggtcaagcttgttcctt 430
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 281 cttaaggatttggtagtgatccaacttgttcctt 248



to top

>gb|AF325056.2|AF325056 Arabidopsis thaliana At2g39460 (At2g39460/F12L6.12) mRNA, complete
           cds
          Length = 693

 Score =  147 bits (74), Expect = 4e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 516 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 457

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 456 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 397

                                                                       
Query: 277 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 396 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 337

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 336 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 277

                                             
Query: 397 cttgaggatctggtattggtcaagcttgttcctt 430
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 276 cttaaggatttggtagtgatccaacttgttcctt 243



to top

>emb|BX819997.1|CNS0A8JW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS59ZB09 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1400

 Score =  147 bits (74), Expect = 4e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                        
Query: 157  gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
            |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 1261 gacttacatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 1202

                                                                        
Query: 217  cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
            ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 1201 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 1142

                                                                        
Query: 277  atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
             || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 1141 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 1082

                                                                        
Query: 337  gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
            ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 1081 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 1022

                                              
Query: 397  cttgaggatctggtattggtcaagcttgttcctt 430
            ||| ||||| ||||| || || | ||||||||||
Sbjct: 1021 cttaaggatttggtagtgatccaacttgttcctt 988



to top

>gb|AY086212.1| Arabidopsis thaliana clone 22479 mRNA, complete sequence
          Length = 701

 Score =  147 bits (74), Expect = 4e-32
 Identities = 224/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 528 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 469

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
           ||| || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 468 cacgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 409

                                                                       
Query: 277 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 408 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 349

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 348 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 289

                                             
Query: 397 cttgaggatctggtattggtcaagcttgttcctt 430
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 288 cttaaggatttggtagtgatccaacttgttcctt 255



to top

>gb|AY060540.1| Arabidopsis thaliana At2g39460/F12L6.12 mRNA, complete cds
          Length = 465

 Score =  141 bits (71), Expect = 3e-30
 Identities = 218/267 (81%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||||||||||||||| || || || | |||||||||||||||||| ||| |||| || 
Sbjct: 461 atgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcctcacgtaa 402

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || |||||||| || ||||| || ||||||| |||||| || |||
Sbjct: 401 gccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggatgtcatac 342

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| |||| |||||||||||||| ||    | |||||| ||||| |||
Sbjct: 341 atcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaatgaaaaca 282

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           || ||||||||||| || ||||||||||| ||||| || ||||| |  |||||||| |||
Sbjct: 281 agagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggtacttaagg 222

                                      
Query: 404 atctggtattggtcaagcttgttcctt 430
           || ||||| || || | ||||||||||
Sbjct: 221 atttggtagtgatccaacttgttcctt 195



to top

>gb|AF034694.1|AF034694 Arabidopsis thaliana ribosomal protein L23a (AtrpL23a) mRNA,
           complete cds
          Length = 703

 Score =  139 bits (70), Expect = 1e-29
 Identities = 223/274 (81%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 504 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 445

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
           ||  || ||||||||  | || || |||||||| || ||||| || ||||||| ||||||
Sbjct: 444 catgtaagccttcttggttccatcaggcctgatgagtgtgttcactttcttggtctggat 385

                                                                       
Query: 277 atcgtacatcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgat 336
            || |||||||| || || ||| |||| |||||||||||||| ||    | |||||| ||
Sbjct: 384 gtcatacatcttcttaacagcatccttaatcttcttcttgtcagcacgaatgtcaacaat 325

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           ||| ||||| ||||||||||| || ||||||||||| ||||| || ||||| |  |||||
Sbjct: 324 gaaaacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtggtgagtgggta 265

                                             
Query: 397 cttgaggatctggtattggtcaagcttgttcctt 430
           ||| ||||| ||||| || || | ||||||||||
Sbjct: 264 cttaaggatttggtagtgatccaacttgttcctt 231



to top

>emb|X92350.1|SORPL23 S.oleracea mRNA for ribosomal protein L23 (635bp)
          Length = 635

 Score =  125 bits (63), Expect = 2e-25
 Identities = 213/263 (80%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||||||||| || || || | |||||||||||||||||| ||    || || 
Sbjct: 522 atgattccgatcttgtttgcaacatccaaagcatcatagtctggtgtaaggcggacgtat 463

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  |||| || ||||||||||  || || || |||||||||||||| || |||
Sbjct: 462 gccttcttggtgccatcgggcctgatcaaagtattcactttcttggcctggatgtcatac 403

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| |||||||||||||||| || ||   ||  || || || || || 
Sbjct: 402 atcttcttgacggcatccttgatcttcttcttatcagcacggatatcgacaataaacacc 343

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | ||||||||||||||||||||||||||| ||||||||||| ||||| ||| | || |||
Sbjct: 342 aaggtgttgttgtcctcgatcttcttcatggcagactcggtagtcaacgggaatttaagg 283

                                  
Query: 404 atctggtattggtcaagcttgtt 426
           |||||||| ||||| | ||||||
Sbjct: 282 atctggtagtggtccaacttgtt 260



to top

>gb|DQ296187.1| Brassica rapa clone 135 unknown mRNA
          Length = 705

 Score =  125 bits (63), Expect = 2e-25
 Identities = 171/207 (82%)
 Strand = Plus / Minus

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||| | || || |||||||| ||||| || || ||||||| ||| || || |||
Sbjct: 475 gccttcttcgttccatcaggcctgatgagggtattgactttcttggtctgaatgtcatac 416

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| | ||||||||||||||||| ||   || |||||| |||||||| 
Sbjct: 415 atcttcttgacagcatctttgatcttcttcttgtcagcacggatgtcaacaatgaagacc 356

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | ||| |||||||| ||||||||||||||||||||||||||||| |  ||||||||||||
Sbjct: 355 aaggtattgttgtcttcgatcttcttcattgcagactcggtggtgagtgggtacttgagg 296

                                      
Query: 404 atctggtattggtcaagcttgttcctt 430
           ||   ||| ||||| | ||||||||||
Sbjct: 295 attccgtagtggtccaacttgttcctt 269



to top

>gb|L18908.1|TOBRPL25A Nicotiana tabacum ribosomal protein L25, complete cds
          Length = 695

 Score =  119 bits (60), Expect = 9e-24
 Identities = 174/212 (82%)
 Strand = Plus / Minus

                                                                       
Query: 176 ttgttggccacgtcaagagcatcatagtctggtgtcagcttcacataggccttcttcttg 235
           |||||||| ||||| | |||||||||||| || |||| | ||||||| || |||||| | 
Sbjct: 500 ttgttggcaacgtccaaagcatcatagtcaggagtcaacctcacatatgctttcttcgtc 441

                                                                       
Query: 236 ccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttacc 295
           || || ||||| || | ||| || || ||||| | ||| || || |||||||| || || 
Sbjct: 440 ccatcaggcctaattaaggtattgactttctttgtctgaatgtcatacatcttcttcacg 381

                                                                       
Query: 296 gcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttg 355
           ||| |||| |||||||| || || ||||||| ||| || ||||| |||||||||||||||
Sbjct: 380 gcatccttaatcttctttttatcagccttgatgtccacaatgaaaacaagggtgttgttg 321

                                           
Query: 356 tcctcgatcttcttcattgcagactcggtggt 387
           ||||| |||||||||||||||||||| |||||
Sbjct: 320 tcctcaatcttcttcattgcagactctgtggt 289



to top

>ref|NM_115386.2| Arabidopsis thaliana RNA binding / structural constituent of
           ribosome AT3G55280 mRNA, complete cds
          Length = 773

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 579 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 520

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 519 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 460

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 459 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 400

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 399 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 340

                   
Query: 404 atctggta 411
           ||||||||
Sbjct: 339 atctggta 332



to top

>emb|X92367.1|SORPL235 S.oleracea mRNA for ribosomal protein L23 (578bp)
          Length = 578

 Score =  111 bits (56), Expect = 2e-21
 Identities = 173/212 (81%)
 Strand = Plus / Minus

                                                                       
Query: 197 tcatagtctggtgtcagcttcacataggccttcttcttgccgtccggcctgatcagggtg 256
           ||||||||||||||||     ||||| ||||||||  |||| || |||||||||| ||| 
Sbjct: 477 tcatagtctggtgtcaagcgaacataagccttcttggtgccatcgggcctgatcaaggta 418

                                                                       
Query: 257 ttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttcttcttg 316
           || || ||||||| ||| ||||| |||||||| || || ||  | || || |||||||||
Sbjct: 417 ttcactttcttggactgaatatcatacatcttcttgacggcgtctttaattttcttcttg 358

                                                                       
Query: 317 tctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgca 376
           || ||   ||  ||||||||||| || | ||||||||||||||| |||||||||||||||
Sbjct: 357 tcagcacggatatcaacgatgaaaaccaaggtgttgttgtcctcaatcttcttcattgca 298

                                           
Query: 377 gactcggtggtcaaagggtacttgaggatctg 408
           ||||| |||||||| ||||| || ||||||||
Sbjct: 297 gactcagtggtcaaggggtatttaaggatctg 266



to top

>gb|BT000478.1| Arabidopsis thaliana ribosomal L23a - like protein
           (At3g55280/T26I12_160) mRNA, complete cds
          Length = 465

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 461 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 402

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 401 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 342

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 341 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 282

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 281 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 222

                   
Query: 404 atctggta 411
           ||||||||
Sbjct: 221 atctggta 214



to top

>gb|AY050445.1| Arabidopsis thaliana AT3g55280/T26I12_160 mRNA, complete cds
          Length = 706

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 512 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 453

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 452 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 393

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 392 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 333

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 332 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 273

                   
Query: 404 atctggta 411
           ||||||||
Sbjct: 272 atctggta 265



to top

>gb|AY085736.1| Arabidopsis thaliana clone 17531 mRNA, complete sequence
          Length = 725

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||| ||||| ||||| || | ||||||||| || || |||| | ||||||| 
Sbjct: 578 atgatcccgattttgttagccacatccaaagcatcataatcaggagtcaacctcacatac 519

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 518 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 459

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 458 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 399

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 398 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 339

                   
Query: 404 atctggta 411
           ||||||||
Sbjct: 338 atctggta 331



to top

>emb|BX825416.1|CNS0A7I7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL35ZH04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 595

 Score =  103 bits (52), Expect = 6e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           ||||| ||||| ||||| ||||| || | ||| ||||| || || |||| | ||||||| 
Sbjct: 447 atgatcccgattttgttagccacatccaaagcctcataatcaggagtcaacctcacatac 388

                                                                       
Query: 224 gccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggatatcgtac 283
           ||||||||  | || || ||||| || |||||||| || ||||||| ||| || || |||
Sbjct: 387 gccttctttgttccatcgggcctaatgagggtgttgactttcttggtctgaatgtcatac 328

                                                                       
Query: 284 atcttttttaccgcagccttgatcttcttcttgtctgccttgaggtcaacgatgaagaca 343
           ||||| || || ||| | |||||||| |||||||| ||   || |||||| |||||||| 
Sbjct: 327 atcttcttgacagcatctttgatctttttcttgtcagcacggatgtcaacaatgaagact 268

                                                                       
Query: 344 agggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggtacttgagg 403
           | |||||||||||| || ||||| ||||| ||||| || || || | |||||||||||||
Sbjct: 267 aaggtgttgttgtcttcaatctttttcatggcagattcagtagtgagagggtacttgagg 208

                   
Query: 404 atctggta 411
           ||||||||
Sbjct: 207 atctggta 200



to top

>gb|AF548321.1| Branchiostoma belcheri ribosomal protein L23a mRNA, complete cds
          Length = 748

 Score =  101 bits (51), Expect = 2e-18
 Identities = 57/59 (96%)
 Strand = Plus / Minus

                                                                      
Query: 329 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggt 387
           |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcaacgatgaagaccagcgtgttgttgtcctcgatcttcttcattgcagactcggtggt 398



to top

>gb|AY232233.1| Drosophila yakuba clone yak-ad_RpL23a mRNA sequence
          Length = 432

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 61/65 (93%)
 Strand = Plus / Minus

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           |||||| ||||||||||||||||||||||||||||| |||| ||||||||||| ||||||
Sbjct: 258 gaagaccagggtgttgttgtcctcgatcttcttcatggcagcctcggtggtcagagggta 199

                
Query: 397 cttga 401
           |||||
Sbjct: 198 cttga 194



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 163 tatgatgccgatcttgttggc 183
           |||||||||||||||||||||
Sbjct: 432 tatgatgccgatcttgttggc 412



to top

>gb|AF281334.1| Oncorhynchus mykiss 60S ribosomal protein mRNA, partial cds
          Length = 347

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 320 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagac 379
           ||||||| ||| ||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 131 gccttgacgtctacgatgaagacgagggtgttgttgtcctcgatcttcttcatggcagac 72

                               
Query: 380 tcggtggtcaaagggtactt 399
           || || |||| |||| ||||
Sbjct: 71  tctgtcgtcagagggaactt 52



to top

>gb|AC004218.3| Arabidopsis thaliana chromosome 2 clone F12L6 map CIC10A06, complete
             sequence
          Length = 102312

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 152/187 (81%)
 Strand = Plus / Minus

                                                                         
Query: 244   cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
             |||||| || ||||| || ||||||| |||||| || |||||||| || || ||| ||||
Sbjct: 44422 cctgatgagtgtgttcactttcttggtctggatgtcatacatcttcttaacagcatcctt 44363

                                                                         
Query: 304   gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
              |||||||||||||| ||    | |||||| ||||| ||||| ||||||||||| || ||
Sbjct: 44362 aatcttcttcttgtcagcacgaatgtcaacaatgaaaacaagagtgttgttgtcttcaat 44303

                                                                         
Query: 364   cttcttcattgcagactcggtggtcaaagggtacttgaggatctggtattggtcaagctt 423
             ||||||||| ||||| || ||||| |  |||||||| ||||| ||||| || || | |||
Sbjct: 44302 cttcttcatcgcagattcagtggtgagtgggtacttaaggatttggtagtgatccaactt 44243

                    
Query: 424   gttcctt 430
             |||||||
Sbjct: 44242 gttcctt 44236



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                         
Query: 157   gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
             |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 44597 gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 44538

                            
Query: 217   cacataggccttctt 231
             ||| || ||||||||
Sbjct: 44537 cacgtaagccttctt 44523



to top

>gb|AY874405.1| Solanum tuberosum isolate CT240 cultivar HH1-9, genomic sequence
          Length = 840

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 305 atcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatc 364
           |||||||||||||| || |  | |||||| ||||| |||||||| ||||||||||| |||
Sbjct: 253 atcttcttcttgtcagcatgaatgtcaacaatgaaaacaagggtattgttgtcctcaatc 194

                                  
Query: 365 ttcttcattgcagactcggtggt 387
           |||||||||||||||||||||||
Sbjct: 193 ttcttcattgcagactcggtggt 171



to top

>gb|AY874403.1| Solanum tuberosum isolate CT240 cultivar USW-2230 Saco, genomic
           sequence
          Length = 873

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 305 atcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatc 364
           |||||||||||||| || |  | |||||| ||||| |||||||| ||||||||||| |||
Sbjct: 253 atcttcttcttgtcagcatgaatgtcaacaatgaaaacaagggtattgttgtcctcaatc 194

                                  
Query: 365 ttcttcattgcagactcggtggt 387
           |||||||||||||||||||||||
Sbjct: 193 ttcttcattgcagactcggtggt 171



to top

>ref|XM_787855.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal
           protein L23a (LOC588157), mRNA
          Length = 486

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||||| ||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 333 cttgtttgccttgagggcaacgatgaagacgagggtgttgttctcctcgatcttcttcat 274

                                        
Query: 373 tgcagactcggtggtcaaagggtacttga 401
            ||   |||||| ||||  ||||||||||
Sbjct: 273 ggcgctctcggtcgtcagggggtacttga 245



to top

>emb|AL132954.1|ATT26I12 Arabidopsis thaliana DNA chromosome 3, BAC clone T26I12
          Length = 88997

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 132/161 (81%)
 Strand = Plus / Minus

                                                                         
Query: 251   agggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagccttgatcttc 310
             |||||||| || ||||||| ||| || || |||||||| || || ||| | |||||||| 
Sbjct: 69736 agggtgttgactttcttggtctgaatgtcatacatcttcttgacagcatctttgatcttt 69677

                                                                         
Query: 311   ttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttc 370
             |||||||| ||   || |||||| |||||||| | |||||||||||| || ||||| |||
Sbjct: 69676 ttcttgtcagcacggatgtcaacaatgaagactaaggtgttgttgtcttcaatctttttc 69617

                                                      
Query: 371   attgcagactcggtggtcaaagggtacttgaggatctggta 411
             || ||||| || || || | |||||||||||||||||||||
Sbjct: 69616 atggcagattcagtagtgagagggtacttgaggatctggta 69576



to top

>emb|BX841999.1|CNS09YA4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB55ZB10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 743

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 222/277 (80%), Gaps = 3/277 (1%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 597 gacttagatgatgccgatcttgttagctacatccaaagcatcatagtctggtgtaagcct 538

                                                                       
Query: 217 cacataggccttcttcttgccgtccggcctgatcagggtgttaaccttcttggcctggat 276
            || || ||||||||  | || || |||||||| || |||||||| ||||||| |||| |
Sbjct: 537 tacgtaagccttcttggttccatcaggcctgatgagtgtgttaactttcttggtctggtt 478

                                                                       
Query: 277 atcgtac-atcttttttac-cgcagccttgatcttcttcttgtctgccttgaggtcaacg 334
            || ||| ||||| || ||  ||| |||| |||||||||||||| ||    | ||| || 
Sbjct: 477 gtcatactatcttcttaactagcatccttaatcttcttcttgtcagcacgaatgtctaca 418

                                                                       
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtg-gtcaaagg 393
           ||||| ||||| ||||||||||| || ||||||||||| ||||| || ||| || |  ||
Sbjct: 417 atgaacacaagagtgttgttgtcttcaatcttcttcatcgcagattcagtgtgtgagtgg 358

                                                
Query: 394 gtacttgaggatctggtattggtcaagcttgttcctt 430
           |||||| ||||| ||||| || || | ||||||||||
Sbjct: 357 gtacttaaggatttggtagtgatccaacttgttcctt 321



to top

>gb|AY874404.1| Solanum berthaultii isolate CT240 cultivar B11B, genomic sequence
          Length = 858

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 305 atcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatc 364
           |||||||||||||| || |  | |||||| ||||| |||||||| ||||||||||| |||
Sbjct: 253 atcttcttcttgtcagcatgaatgtcaacaatgaaaacaagggtattgttgtcctcaatc 194

                               
Query: 365 ttcttcattgcagactcggt 384
           ||||||||||||||||||||
Sbjct: 193 ttcttcattgcagactcggt 174



to top

>gb|AF401578.1| Ictalurus punctatus ribosomal protein L23a mRNA, partial cds
          Length = 507

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 61/67 (91%)
 Strand = Plus / Minus

                                                                       
Query: 323 ttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcg 382
           |||| |||||| |||||||| || |||||||||||||||||||||||||| || ||||||
Sbjct: 300 ttgacgtcaacaatgaagaccagagtgttgttgtcctcgatcttcttcatggctgactcg 241

                  
Query: 383 gtggtca 389
           |||||||
Sbjct: 240 gtggtca 234



to top

>gb|DQ450529.1| Drosophila melanogaster L23A ribosomal protein natural variant
           (RpL23A) mRNA, complete cds
          Length = 834

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 657 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 598

                
Query: 397 cttga 401
           |||||
Sbjct: 597 cttga 593



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 160 ttatatgatgccgatcttgttggc 183
           ||||||||||||||||||||||||
Sbjct: 834 ttatatgatgccgatcttgttggc 811



to top

>gb|AC010038.5| Drosophila melanogaster 3L BAC RP98-14O14 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 172175

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                         
Query: 337   gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
             |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 53316 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 53257

                  
Query: 397   cttga 401
             |||||
Sbjct: 53256 cttga 53252



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 159   cttatatgatgccgatcttgttggc 183
             |||||||||||||||||||||||||
Sbjct: 53494 cttatatgatgccgatcttgttggc 53470



to top

>gb|AC105264.3| Drosophila melanogaster 3L BAC RP98-17K18 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 177583

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 337   gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
             |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 55697 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 55756

                  
Query: 397   cttga 401
             |||||
Sbjct: 55757 cttga 55761



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 159   cttatatgatgccgatcttgttggc 183
             |||||||||||||||||||||||||
Sbjct: 55519 cttatatgatgccgatcttgttggc 55543



to top

>gb|AC093192.2| Drosophila melanogaster 3L BAC RP98-48J18 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166862

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                          
Query: 337    gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
              |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 141438 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 141497

                   
Query: 397    cttga 401
              |||||
Sbjct: 141498 cttga 141502



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 159    cttatatgatgccgatcttgttggc 183
              |||||||||||||||||||||||||
Sbjct: 141260 cttatatgatgccgatcttgttggc 141284



to top

>gb|AY094921.1| Drosophila melanogaster RH35480 full insert cDNA
          Length = 1054

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 708 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 649

                
Query: 397 cttga 401
           |||||
Sbjct: 648 cttga 644



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 159 cttatatgatgccgatcttgttggc 183
           |||||||||||||||||||||||||
Sbjct: 886 cttatatgatgccgatcttgttggc 862



to top

>ref|NM_079162.2| Drosophila melanogaster Ribosomal protein L23A CG7977-RA (RpL23A),
           mRNA
          Length = 1041

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 708 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 649

                
Query: 397 cttga 401
           |||||
Sbjct: 648 cttga 644



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 159 cttatatgatgccgatcttgttggc 183
           |||||||||||||||||||||||||
Sbjct: 886 cttatatgatgccgatcttgttggc 862



to top

>gb|AF080130.1|AF080130 Drosophila melanogaster ribosomal protein L23a (rpl23a) mRNA,
           partial cds
          Length = 982

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 633 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 574

                
Query: 397 cttga 401
           |||||
Sbjct: 573 cttga 569



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 159 cttatatgatgccgatcttgttggc 183
           |||||||||||||||||||||||||
Sbjct: 811 cttatatgatgccgatcttgttggc 787



to top

>gb|AE003472.1| Drosophila melanogaster chromosome 3L, section 6 of 83 of the complete
              sequence
          Length = 303191

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                          
Query: 337    gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
              |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 132825 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 132884

                   
Query: 397    cttga 401
              |||||
Sbjct: 132885 cttga 132889



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 159    cttatatgatgccgatcttgttggc 183
              |||||||||||||||||||||||||
Sbjct: 132647 cttatatgatgccgatcttgttggc 132671



to top

>gb|AC005557.1|AC005557 Drosophila melanogaster, chromosome 3L, region 62A10-62B5, P1 clones
             DS02777, DS03222, DS02345, and DS04808, complete sequence
          Length = 257867

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                         
Query: 337   gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
             |||||| ||||||||||||||||||||||||||||| || | |||||||||||  |||||
Sbjct: 55991 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtcagtgggta 56050

                  
Query: 397   cttga 401
             |||||
Sbjct: 56051 cttga 56055



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 159   cttatatgatgccgatcttgttggc 183
             |||||||||||||||||||||||||
Sbjct: 55813 cttatatgatgccgatcttgttggc 55837



to top

>gb|U40948.1| Caenorhabditis elegans cosmid F55D10, complete sequence
          Length = 29498

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                        
Query: 332  acgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaa 391
            ||||||||||||||||||||||  ||||||||||||||||| || ||||| |||||||| 
Sbjct: 3244 acgatgaagacaagggtgttgtgctcctcgatcttcttcatggcggactcagtggtcaat 3185

                
Query: 392  gggt 395
            ||||
Sbjct: 3184 gggt 3181



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 173  atcttgttggccacgtcaagagcatcatagtc 204
            ||||||||||| ||||| |||||||| |||||
Sbjct: 3460 atcttgttggcaacgtcgagagcatcgtagtc 3429



to top

>gb|DQ138322.1| Myxobolus cerebralis ribosomal protein L23-like mRNA, complete
            sequence
          Length = 1461

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                        
Query: 328  gtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggt 387
            |||||||||||| || || |||||||||||||||||||||||||| |||||||| || ||
Sbjct: 1285 gtcaacgatgaacacgagcgtgttgttgtcctcgatcttcttcatcgcagactccgtcgt 1226

                                
Query: 388  caaagggtacttgaggatct 407
            ||  ||| |||||| |||||
Sbjct: 1225 cagcgggaacttgatgatct 1206



to top

>ref|NM_076407.3| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-25.1) (rpl-25.1) mRNA, complete cds
          Length = 504

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Minus

                                                                       
Query: 332 acgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaa 391
           ||||||||||||||||||||||  ||||||||||||||||| || ||||| |||||||| 
Sbjct: 278 acgatgaagacaagggtgttgtgctcctcgatcttcttcatggcggactcagtggtcaat 219

               
Query: 392 gggt 395
           ||||
Sbjct: 218 gggt 215



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 173 atcttgttggccacgtcaagagcatcatagtc 204
           ||||||||||| ||||| |||||||| |||||
Sbjct: 437 atcttgttggcaacgtcgagagcatcgtagtc 406



to top

>emb|AL115487.1|CNS01CG7 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 359 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 300



to top

>emb|AL115271.1|CNS01CA7 Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 351 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 292



to top

>emb|AL114669.1|CNS01BTH Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 347 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 288



to top

>emb|AL114551.1|CNS01BQ7 Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 344 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 285



to top

>emb|AL112682.1|CNS01AAA Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 361 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 302



to top

>emb|AL111598.1|CNS019G6 Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 359 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 300



to top

>emb|AL111416.1|CNS019B4 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 265 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 206



to top

>emb|AL110748.1|CNS018SL Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 354 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 295



to top

>emb|AL110918.1|CNS018XB Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 55/60 (91%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||||||||||||
Sbjct: 323 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgatcttcttcat 264



to top

>ref|XM_757052.1| Ustilago maydis 521 hypothetical protein (UM05998.1) partial mRNA
          Length = 444

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 327 ggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtg 385
           |||||||||||||||| || |||||||| ||||||||||||||||| || |||||||||
Sbjct: 277 ggtcaacgatgaagacgagcgtgttgttctcctcgatcttcttcatggccgactcggtg 219



to top

>gb|AC139707.10| Medicago truncatula clone mth2-16b22, complete sequence
          Length = 113689

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                         
Query: 244   cctgatcagggtgttaaccttcttggcctggatatcgtacatcttttttaccgcagcctt 303
             |||||||| ||||||||| |||||||||||||| || ||||| || || || ||| ||||
Sbjct: 27071 cctgatcaaggtgttaactttcttggcctggatgtcatacattttcttcacggcatcctt 27012

                                                                         
Query: 304   gatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgat 363
             ||| ||||| ||||| ||    | |||||| ||||| || |  ||||||||||| || ||
Sbjct: 27011 gattttctttttgtcagctcgcaagtcaacaatgaaaaccaaagtgttgttgtcttcaat 26952

                               
Query: 364   cttcttcattgcagactc 381
             |||||||||||| |||||
Sbjct: 26951 cttcttcattgcggactc 26934



to top

>gb|BC098550.1| Danio rerio ribosomal protein L23a, mRNA (cDNA clone MGC:110139
           IMAGE:7288150), complete cds
          Length = 626

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||| | |||||| || || || || ||||||||||||||||||||||||||
Sbjct: 325 cttgtttgcctttacgtcaacaataaacaccagagtgttgttgtcctcgatcttcttcat 266

                                        
Query: 373 tgcagactcggtggtcaaagggtacttga 401
            || ||||| |||||||| ||| ||||||
Sbjct: 265 ggccgactcagtggtcaaggggaacttga 237



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtg 209
           |||||||||||||||||||| || || |  |||||||| |||||||
Sbjct: 474 atgatgccgatcttgttggcaacatccaatgcatcataatctggtg 429



to top

>ref|XM_415820.1| PREDICTED: Gallus gallus similar to 60S ribosomal protein L23a
            (LOC417574), mRNA
          Length = 1542

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                        
Query: 313  cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
            ||||| ||||||||  ||||| ||||| || || || ||||| ||||| |||||||||||
Sbjct: 1338 cttgtttgccttgacatcaacaatgaaaaccagagtattgttatcctctatcttcttcat 1279

                                         
Query: 373  tgcagactcggtggtcaaagggtacttga 401
            |||||| || |||||||||||| ||||||
Sbjct: 1278 tgcagattctgtggtcaaagggaacttga 1250



to top

>gb|AY561517.1| Danio rerio ribosomal protein L23a (rpl23a) mRNA, complete cds
          Length = 553

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||| | |||||| || || || || ||||||||||||||||||||||||||
Sbjct: 340 cttgtttgcctttacgtcaacaataaacaccagagtgttgttgtcctcgatcttcttcat 281

                                        
Query: 373 tgcagactcggtggtcaaagggtacttga 401
            || ||||| |||||||| ||| ||||||
Sbjct: 280 ggccgactcagtggtcaaggggaacttga 252



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtg 209
           |||||||||||||||||||| || || |  |||||||| |||||||
Sbjct: 489 atgatgccgatcttgttggcaacatccaatgcatcataatctggtg 444



to top

>ref|XM_677033.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8856.2), mRNA
          Length = 462

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 320 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagac 379
           ||||||| ||| |||||||| |||||||||||||| ||||| ||||||||||| |||  |
Sbjct: 299 gccttgacgtccacgatgaacacaagggtgttgttctcctcaatcttcttcatagcactc 240

                            
Query: 380 tcggtggtcaaagggta 396
           |||||| |||| |||||
Sbjct: 239 tcggtgttcaaggggta 223



to top

>ref|NM_001001593.1| Danio rerio ribosomal protein L23a (rpl23a), mRNA
          Length = 553

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||| | |||||| || || || || ||||||||||||||||||||||||||
Sbjct: 340 cttgtttgcctttacgtcaacaataaacaccagagtgttgttgtcctcgatcttcttcat 281

                                        
Query: 373 tgcagactcggtggtcaaagggtacttga 401
            || ||||| |||||||| ||| ||||||
Sbjct: 280 ggccgactcagtggtcaaggggaacttga 252



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtg 209
           |||||||||||||||||||| || || |  |||||||| |||||||
Sbjct: 489 atgatgccgatcttgttggcaacatccaatgcatcataatctggtg 444



to top

>gb|BT021430.1| Drosophila melanogaster GM06171 full insert cDNA
          Length = 955

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           |||||| ||||||||||||||||||||||||||||| || | |||||||||||
Sbjct: 605 gaagaccagggtgttgttgtcctcgatcttcttcatggccgcctcggtggtca 553



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 159 cttatatgatgccgatcttgttggc 183
           |||||||||||||||||||||||||
Sbjct: 783 cttatatgatgccgatcttgttggc 759



to top

>emb|AL112366.1|CNS01A1I Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| |||||||| ||| || |||||||||||||||||||| |||||||| ||||||||
Sbjct: 343 cttgtttgccttgatgtcgacaatgaagacaagggtgttgttctcctcgattttcttcat 284



to top

>emb|BX819433.1|CNS0A8ZH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZC10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 267

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 157 gacttatatgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagctt 216
           |||||| ||||||||||||||||| || || || | |||||||||||||||||| ||| |
Sbjct: 91  gacttagatgatgccgatcttgttagcaacatccaaagcatcatagtctggtgtaagcct 32

                          
Query: 217 cacataggccttctt 231
           ||| || ||||||||
Sbjct: 31  cacgtaagccttctt 17



to top

>ref|XM_365965.1| Magnaporthe grisea 70-15 hypothetical protein (MG10185.4) partial
           mRNA
          Length = 474

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 320 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 311 gccttgatgtcgacgatgaagaccagggtgttgttctcctcaatcttcttcat 259



to top

>ref|XM_382669.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG02493.1) partial mRNA
          Length = 522

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 320 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 359 gccttgacgtcgacgatgaagacgagggtgttgttctcctccatcttcttcat 307



to top

>emb|Z75541.1|CEF52B5 Caenorhabditis elegans Cosmid F52B5, complete sequence
          Length = 33274

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                          
Query: 328   gtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
             |||||| ||||||||||||||||||| ||| ||||||||||||||
Sbjct: 32586 gtcaacaatgaagacaagggtgttgtggtcttcgatcttcttcat 32630



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 170   ccgatcttgttggccacgtcaagagcatcatagtc 204
             |||||||||||||| || ||||||||||| |||||
Sbjct: 32384 ccgatcttgttggcaacatcaagagcatcgtagtc 32418



to top

>ref|NM_059862.2| Caenorhabditis elegans Ribosomal Protein, Large subunit family
           member (rpl-25.2) (rpl-25.2) mRNA, complete cds
          Length = 498

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 328 gtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| ||||||||||||||||||| ||| ||||||||||||||
Sbjct: 277 gtcaacaatgaagacaagggtgttgtggtcttcgatcttcttcat 233



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 170 ccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||| || ||||||||||| |||||
Sbjct: 435 ccgatcttgttggcaacatcaagagcatcgtagtc 401



to top

>gb|AY849680.1| Magnaporthe grisea 60S ribosomal protein L23-like protein mRNA,
           complete cds
          Length = 1101

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 320 gccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||||| ||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 609 gccttgatgtcgacgatgaagaccagggtgttgttctcctcaatcttcttcat 557



to top

>gb|U02032.1|HSU02032 Human ribosomal protein L23a mRNA, partial cds
          Length = 492

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 329 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtc 388
           ||||| ||||| ||||| ||||||||||| || ||||||||||| |||||||| ||||||
Sbjct: 304 tcaacaatgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtc 245

            
Query: 389 a 389
           |
Sbjct: 244 a 244



to top

>gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, complete sequence
          Length = 205069

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                      
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
              ||||| ||||| ||||||||||| || ||||||||||| |||||||| ||||||||
Sbjct: 144443 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtcaa 144388



to top

>ref|XM_511611.1| PREDICTED: Pan troglodytes similar to breast carcinoma amplified
            sequence 3; metastasis associated antigen of breast
            cancer (LOC454802), mRNA
          Length = 4255

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 335  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
            ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 2370 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 2316



to top

>ref|XM_523627.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC468236),
           mRNA
          Length = 381

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 206 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 152



to top

>ref|XM_511361.1| PREDICTED: Pan troglodytes similar to ribosomal protein L23a; 60S
           ribosomal protein L23a; cDNA sequence BC029892
           (LOC454532), mRNA
          Length = 743

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 521 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 467



to top

>ref|XM_528535.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC473165),
           mRNA
          Length = 423

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 248 atgaacacaagtgtgttgttgtcttccatcttcttcatggcagactcagtggtca 194



to top

>ref|XM_514120.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC457651),
           mRNA
          Length = 642

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 322 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 268



to top

>gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21.1, complete
           sequence
          Length = 138999

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 82  atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 28



to top

>gb|BC058041.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA clone MGC:61848
           IMAGE:6716166), complete cds
          Length = 985

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 312 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 258



to top

>gb|BC014459.1| Homo sapiens ribosomal protein L23a, mRNA (cDNA clone MGC:23063
           IMAGE:4872948), complete cds
          Length = 545

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 300 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 246



to top

>ref|NM_000984.5| Homo sapiens ribosomal protein L23a (RPL23A), mRNA
          Length = 979

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 320 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 266



to top

>gb|DP000044.2| Callithrix jacchus target 106 genomic scaffold
          Length = 574594

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 127462 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 127516



to top

>ref|XM_505871.1| Yarrowia lipolytica CLIB122, YALI0F25531g predicted mRNA
          Length = 426

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcag 377
           ||||||||||||||||||  |||||||||||||||||| ||||
Sbjct: 251 atgaagacaagggtgttggagtcctcgatcttcttcatggcag 209



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 170 ccgatcttgttggccacgtcaagagcatc 198
           |||||||||||||| | ||||||||||||
Sbjct: 416 ccgatcttgttggcaatgtcaagagcatc 388



to top

>gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, complete sequence
          Length = 166234

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                    
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 94709 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 94763



to top

>emb|BX054544.1|CNS09E90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaagggta 396
           |||||| || |||||||||||||||||||||||||| || || ||||| ||||  |||||
Sbjct: 422 gaagacgagcgtgttgttgtcctcgatcttcttcatcgccgattcggtcgtcagcgggta 363

              
Query: 397 ctt 399
           |||
Sbjct: 362 ctt 360



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 595 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 536

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 535 gccttcttcttgccgtccgg 516



to top

>gb|AC112491.4| Homo sapiens 3 BAC RP11-3P17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 154758

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 55469 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 55415



to top

>gb|BC036642.1| Mus musculus, clone IMAGE:3371217, mRNA
          Length = 565

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 311 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 257



to top

>emb|CR616046.1| full-length cDNA clone CS0DE014YB21 of Placenta of Homo sapiens
            (human)
          Length = 1761

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 335  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
            ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 1607 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 1553



to top

>gb|AC011979.7| Homo sapiens chromosome 11, clone RP11-16F15, complete sequence
          Length = 154995

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 120072 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 120126



to top

>ref|NG_002546.1| Homo sapiens ribosomal protein L23a pseudogene 11 (RPL23AP11) on
           chromosome 14
          Length = 689

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| || |||||||||||| |||||||||| |||||||| |||||||
Sbjct: 396 atgaacacaagtgtcttgttgtcctcgctcttcttcatggcagactcagtggtca 342



to top

>ref|XM_937620.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC401904), mRNA
          Length = 960

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 305 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 251



to top

>ref|XM_377521.3| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC401904), mRNA
          Length = 960

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 305 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 251



to top

>ref|XM_939952.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC648294), mRNA
          Length = 534

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 307 atgaacacaagtgtgttgttgtcttccatcttcttcatggcagactcagtggtca 253



to top

>ref|XM_941396.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC652071), mRNA
          Length = 582

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 317 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 263



to top

>ref|XM_930113.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L23a
           (LOC647099), mRNA
          Length = 582

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 317 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 263



to top

>gb|AD000091.1|CH19F15314 Homo sapiens DNA from chromosome 19p13.1 cosmid f15314, genomic
             sequence
          Length = 41369

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 39693 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 39639



to top

>ref|XM_340850.2| PREDICTED: Rattus norvegicus ribosomal protein L23a (predicted)
           (Rpl23a_predicted), mRNA
          Length = 541

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || |||||||||||||
Sbjct: 309 atgaacacaagcgtgttgttgtcctctattttcttcatagccgactcggtggtca 255



to top

>ref|XM_577114.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L23a
           (LOC501709), mRNA
          Length = 471

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || |||||||||||||
Sbjct: 296 atgaacacaagcgtgttgttgtcctctattttcttcatagctgactcggtggtca 242



to top

>gb|AC010761.10| Homo sapiens chromosome 17, clone RP11-386F9, complete sequence
          Length = 177773

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 74961 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 74907



to top

>dbj|AK130965.1| Homo sapiens cDNA FLJ27455 fis, clone UBA04121, highly similar to
           60S ribosomal protein L23a
          Length = 538

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 309 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 255



to top

>emb|AJ277546.2|HSA277546 Homo sapiens WEE1 gene for protein kinase and partial ZNF143 gene for
             zinc finger transcription factor
          Length = 131998

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                    
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 92737 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 92683



to top

>emb|X65228.1|RRRPL23A R.rattus mRNA for ribosomal protein L23a
          Length = 534

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || |||||||||||||
Sbjct: 311 atgaacacaagcgtgttgttgtcctctattttcttcatagctgactcggtggtca 257



to top

>emb|AL132801.5|CNS01DTN Human chromosome 14 DNA sequence BAC R-661D19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 168624

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| || |||||||||||| |||||||||| |||||||| |||||||
Sbjct: 136980 atgaacacaagtgtcttgttgtcctcgctcttcttcatggcagactcagtggtca 136926



to top

>gb|AF001689.1|AF001689 Homo sapiens ribosomal protein L23A (RPL23A) gene, complete cds
          Length = 4111

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 335  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
            ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 2523 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 2469



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                          
Query: 335     atgaagacaagggtgttgttgtcctcgatcttcttcattgcag 377
               ||||||||||||||||||  |||||||||||||||||| ||||
Sbjct: 3279802 atgaagacaagggtgttggagtcctcgatcttcttcatggcag 3279844



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 170     ccgatcttgttggccacgtcaagagcatc 198
               |||||||||||||| | ||||||||||||
Sbjct: 3279637 ccgatcttgttggcaatgtcaagagcatc 3279665



to top

>gb|U37230.1|HSU37230 Human ribosomal protein L23a mRNA, complete cds
          Length = 578

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 319 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 265



to top

>gb|U43701.1|HSU43701 Human ribosomal protein L23a mRNA, complete cds
          Length = 546

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 317 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 263



to top

>emb|Y12508.1|HSIGFBP H.sapiens IGFBP-4 gene
          Length = 21619

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 58  atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 112



to top

>gb|L13799.1|HUMCH13C1A Homo sapiens (clone 01) liver expressed protein mRNA, 3'end
          Length = 500

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 270 atgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 216



to top

>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
              sequence
          Length = 2105742

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                          
Query: 300    ccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcct 359
              ||||||| ||| ||||||  ||||||| ||||||||||||||| |  |||||||  || |
Sbjct: 102286 ccttgatgttcctcttgttggccttgatgtcaacgatgaagaccaaagtgttgtgctctt 102345

                                    
Query: 360    cgatcttcttcattgcagactc 381
              | ||||||||||| ||||||||
Sbjct: 102346 caatcttcttcatggcagactc 102367



to top

>gb|AC007683.5| Homo sapiens BAC clone RP11-401L13 from 7, complete sequence
          Length = 155735

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 336   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 90064 tgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 90011



to top

>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8
             (TNFRSF8) gene, complete cds
          Length = 84102

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 336   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 18288 tgaatacaagtgtgttgttgtcttctatcttcttcatggcagactctgtggtca 18341



to top

>ref|XM_569415.1| Cryptococcus neoformans var. neoformans JEC21 ribosomal protein
            (CNC00350) partial mRNA
          Length = 1382

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                        
Query: 300  ccttgatcttcttcttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcct 359
            ||||||| ||| ||||||  ||||||| ||||||||||||||| |  |||||||  || |
Sbjct: 1124 ccttgatgttcctcttgttggccttgatgtcaacgatgaagaccaaagtgttgtgctctt 1065

                                  
Query: 360  cgatcttcttcattgcagactc 381
            | ||||||||||| ||||||||
Sbjct: 1064 caatcttcttcatggcagactc 1043



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 164  atgatgccgatcttgttggccacgtcaagagc 195
            |||| ||||||||||||||| || ||||||||
Sbjct: 1260 atgaagccgatcttgttggcaacctcaagagc 1229



to top

>emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chromosome 1 Contains the
             TNFRSF8 gene for tumor necrosis factor receptor
             superfamily member 8, a ribosomal protein L23a (RPL23A)
             pseudogene, the 5' end of the TNFRSF1B gene for tumor
             necrosis factor receptor superfamily member 1B and three
             CpG islands, complete sequence
          Length = 151498

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 336   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 33910 tgaatacaagtgtgttgttgtcttctatcttcttcatggcagactctgtggtca 33963



to top

>emb|AL157386.14| Human DNA sequence from clone RP11-170J3 on chromosome 10 Contains part
             of the SUFU gene for suppressor of fused homolog
             (Drosophila) and a 60S ribosomal protein L23a (RPL23A)
             pseudogene, complete sequence
          Length = 72536

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                   
Query: 336   tgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             |||| ||||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 52819 tgaacacaagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 52872



to top

>gb|DQ214298.1| Taeniopygia guttata clone 0061P0010E07 60S ribosomal protein
           L23a-like mRNA, complete sequence
          Length = 538

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttgtctgccttgaggtcaacgatgaagacaagggtgttgttgtcctcgatcttcttcat 372
           ||||| ||||||||  || |||||||| || || |||||||| |||||||||||||||||
Sbjct: 323 cttgtttgccttgacatccacgatgaacaccagcgtgttgttatcctcgatcttcttcat 264

                            
Query: 373 tgcagactcggtggtca 389
            || || || |||||||
Sbjct: 263 cgctgattctgtggtca 247



to top

>gb|BC077046.1| Xenopus tropicalis MGC89958 protein, mRNA (cDNA clone MGC:89958
           IMAGE:7025723), complete cds
          Length = 544

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 329 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtc 388
           ||||| ||||| || || || ||||||||||||||||||||||| || ||||| ||||||
Sbjct: 312 tcaacaatgaaaaccagagtattgttgtcctcgatcttcttcatggctgactcagtggtc 253

            
Query: 389 a 389
           |
Sbjct: 252 a 252



to top

>emb|BX019711.1|CNS08NDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 347 gtgttgttgtcctcgatcttcttcattgc 375
           |||||||||||||||||||||||||||||
Sbjct: 557 gtgttgttgtcctcgatcttcttcattgc 585



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 374 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 414



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 433 gccttcttcttgccgtccgg 452



to top

>gb|AY972826.1| Aedes albopictus ribosomal protein L23a mRNA, complete cds
          Length = 1355

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 344 agggtgttgttgtcctcgatcttcttcat 372
           |||||||||||||||||||||||||||||
Sbjct: 975 agggtgttgttgtcctcgatcttcttcat 947



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 221  taggccttcttcttgccgtccgg 243
            |||||||||||||||||||||||
Sbjct: 1098 taggccttcttcttgccgtccgg 1076



to top

>gb|AY857437.1| Suberites domuncula L23a mRNA, complete cds
          Length = 462

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 347 gtgttgttgtcctcgatcttcttcattgcagactcggtggt 387
           |||||||||||||| ||||||||||| || |||||||||||
Sbjct: 275 gtgttgttgtcctcaatcttcttcatggccgactcggtggt 235



to top

>ref|NM_001005109.1| Xenopus tropicalis MGC89958 protein (MGC89958), mRNA
          Length = 544

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 53/61 (86%)
 Strand = Plus / Minus

                                                                       
Query: 329 tcaacgatgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtc 388
           ||||| ||||| || || || ||||||||||||||||||||||| || ||||| ||||||
Sbjct: 312 tcaacaatgaaaaccagagtattgttgtcctcgatcttcttcatggctgactcagtggtc 253

            
Query: 389 a 389
           |
Sbjct: 252 a 252



to top

>gb|AC153889.19| Mus musculus 10 BAC RP23-434A12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190042

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                          
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 165178 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 165237

                                              
Query: 395    tacttgaggatctggtattggtcaagcttgtt 426
               |||||| |||    || ||||||||||||||
Sbjct: 165238 aacttgatgatagcatagtggtcaagcttgtt 165269



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 54416 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 54357

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 54356 aacttgatgatagcatagtggtcaagcttgtt 54325



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 32055 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 32114

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 32115 aacttgatgatagcatagtggtcaagcttgtt 32146



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 187751 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 187697



to top

>gb|AC167202.8| Mus musculus  BAC RP24-243A15 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 180658

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 36158 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 36099

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 36098 aacttgatgatagcatagtggtcaagcttgtt 36067



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 13814 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 13873

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 13874 aacttgatgatagcatagtggtcaagcttgtt 13905



to top

>ref|XM_521892.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC466493),
           mRNA
          Length = 471

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
           ||||| ||||| ||||||||||| || ||||||||||  |||||||| ||||||||
Sbjct: 296 atgaacacaagtgtgttgttgtcttctatcttcttcacggcagactcagtggtcaa 241



to top

>ref|XM_508278.1| PREDICTED: Pan troglodytes similar to Rpl23a protein (LOC451018),
           mRNA
          Length = 417

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 342 caagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           |||| ||||||||||| || ||||||||||| |||||||| |||||||
Sbjct: 235 caagtgtgttgttgtcttctatcttcttcatggcagactcagtggtca 188



to top

>gb|AC095247.5| Rattus norvegicus 4 BAC CH230-10C6 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 238466

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 335  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
            ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 4597 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 4652



to top

>gb|AC087066.3| Rattus norvegicus strain Brown Norway clone RP31-194D8, complete
           sequence
          Length = 166751

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
           ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 163 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 218



to top

>gb|AC087067.3| Rattus norvegicus strain Brown Norway clone RP31-40H10, complete sequence
          Length = 178746

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
              ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 172802 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 172857



to top

>ref|XM_001002232.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666738), mRNA
          Length = 548

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 308 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 249

                                           
Query: 395 tacttgaggatctggtattggtcaagcttgtt 426
            |||||| |||    || ||||||||||||||
Sbjct: 248 aacttgatgatagcatagtggtcaagcttgtt 217



to top

>ref|XM_984537.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666548), mRNA
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 308 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 249

                                           
Query: 395 tacttgaggatctggtattggtcaagcttgtt 426
            |||||| |||    || ||||||||||||||
Sbjct: 248 aacttgatgatagcatagtggtcaagcttgtt 217



to top

>ref|XM_984283.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666501), mRNA
          Length = 549

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 309 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 250

                                           
Query: 395 tacttgaggatctggtattggtcaagcttgtt 426
            |||||| |||    || ||||||||||||||
Sbjct: 249 aacttgatgatagcatagtggtcaagcttgtt 218



to top

>ref|XM_983917.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L23a
           (LOC666448), mRNA
          Length = 548

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 308 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 249

                                           
Query: 395 tacttgaggatctggtattggtcaagcttgtt 426
            |||||| |||    || ||||||||||||||
Sbjct: 248 aacttgatgatagcatagtggtcaagcttgtt 217



to top

>gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome 6, complete sequence
          Length = 212166

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                              
Query: 347    gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
              ||||| |||||||| ||||||||||| || ||||||||||||| ||||
Sbjct: 178813 gtgtttttgtcctctatcttcttcatggctgactcggtggtcacaggg 178860



to top

>gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome 6, complete sequence
          Length = 212096

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 347    gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
              ||||| |||||||| ||||||||||| || ||||||||||||| ||||
Sbjct: 183841 gtgtttttgtcctctatcttcttcatggctgactcggtggtcacaggg 183794



to top

>emb|BX053332.1|CNS09DBC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 553 gaagacgagcgtgttgttgtcctcgatcttcttcat 588



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 381 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 421



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 440 gccttcttcttgccgtccgg 459



to top

>emb|BX071919.1|CNS09RNN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 546 gaagacgagcgtgttgttgtcctcgatcttcttcat 581



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 374 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 414



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 433 gccttcttcttgccgtccgg 452



to top

>emb|BX071918.1|CNS09RNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 799 gaagacgagcgtgttgttgtcctcgatcttcttcat 764



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 912 gccttcttcttgccgtccgg 893



to top

>emb|BX071899.1|CNS09RN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 389 gaagacgagcgtgttgttgtcctcgatcttcttcat 424



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 217 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 257



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 276 gccttcttcttgccgtccgg 295



to top

>emb|BX071898.1|CNS09RN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 872 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 813

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 812 gccttcttcttgccgtccgg 793



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 699 gaagacgagcgtgttgttgtcctcgatcttcttcat 664



to top

>emb|BX071572.1|CNS09RE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 844 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 785

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 784 gccttcttcttgccgtccgg 765



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 671 gaagacgagcgtgttgttgtcctcgatcttcttcat 636



to top

>emb|BX070849.1|CNS09QTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 729 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 670

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 669 gccttcttcttgccgtccgg 650



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 556 gaagacgagcgtgttgttgtcctcgatcttcttcat 521



to top

>emb|BX070057.1|CNS09Q7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 547 gaagacgagcgtgttgttgtcctcgatcttcttcat 582



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 375 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 415



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 434 gccttcttcttgccgtccgg 453



to top

>emb|BX060970.1|CNS09J7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 555 gaagacgagcgtgttgttgtcctcgatcttcttcat 590



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 383 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 423



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 442 gccttcttcttgccgtccgg 461



to top

>emb|BX060969.1|CNS09J7H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 831 gaagacgagcgtgttgttgtcctcgatcttcttcat 796



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 944 gccttcttcttgccgtccgg 925



to top

>emb|BX068513.1|CNS09P11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 535 gaagacgagcgtgttgttgtcctcgatcttcttcat 570



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 363 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 403



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 422 gccttcttcttgccgtccgg 441



to top

>emb|BX068512.1|CNS09P10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 985 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 926

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 925 gccttcttcttgccgtccgg 906



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 812 gaagacgagcgtgttgttgtcctcgatcttcttcat 777



to top

>emb|BX067321.1|CNS09O3X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 606 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 547

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 546 gccttcttcttgccgtccgg 527



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 433 gaagacgagcgtgttgttgtcctcgatcttcttcat 398



to top

>emb|BX067206.1|CNS09O0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 542 gaagacgagcgtgttgttgtcctcgatcttcttcat 577



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 370 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 410



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 429 gccttcttcttgccgtccgg 448



to top

>emb|BX066586.1|CNS09NJI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 547 gaagacgagcgtgttgttgtcctcgatcttcttcat 582



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 375 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 415



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 434 gccttcttcttgccgtccgg 453



to top

>emb|BX066585.1|CNS09NJH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 617 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 558

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 557 gccttcttcttgccgtccgg 538



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 444 gaagacgagcgtgttgttgtcctcgatcttcttcat 409



to top

>emb|BX066443.1|CNS09NFJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 546 gaagacgagcgtgttgttgtcctcgatcttcttcat 581



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 374 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 414



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 433 gccttcttcttgccgtccgg 452



to top

>emb|BX066442.1|CNS09NFI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 935 gaagacgagcgtgttgttgtcctcgatcttcttcat 900



to top

>emb|BX062873.1|CNS09KOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 540 gaagacgagcgtgttgttgtcctcgatcttcttcat 575



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 368 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 408



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 427 gccttcttcttgccgtccgg 446



to top

>emb|BX060551.1|CNS09IVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 531 gaagacgagcgtgttgttgtcctcgatcttcttcat 566



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 359 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 399



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 418 gccttcttcttgccgtccgg 437



to top

>emb|BX060550.1|CNS09IVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 958 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 899

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 898 gccttcttcttgccgtccgg 879



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 785 gaagacgagcgtgttgttgtcctcgatcttcttcat 750



to top

>emb|BX059628.1|CNS09I68 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 551 gaagacgagcgtgttgttgtcctcgatcttcttcat 586



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 379 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 419



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 438 gccttcttcttgccgtccgg 457



to top

>emb|BX058866.1|CNS09HL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 541 gaagacgagcgtgttgttgtcctcgatcttcttcat 576



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 369 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 409



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 428 gccttcttcttgccgtccgg 447



to top

>emb|BX058865.1|CNS09HL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 867 gaagacgagcgtgttgttgtcctcgatcttcttcat 832



to top

>emb|BX054450.1|CNS09E6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 630

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 440 gaagacgagcgtgttgttgtcctcgatcttcttcat 475



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 268 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 308



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 327 gccttcttcttgccgtccgg 346



to top

>emb|BX053901.1|CNS09DR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 567 gaagacgagcgtgttgttgtcctcgatcttcttcat 602



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 395 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 435



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 454 gccttcttcttgccgtccgg 473



to top

>emb|BX053900.1|CNS09DR4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 892 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 833

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 832 gccttcttcttgccgtccgg 813



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 719 gaagacgagcgtgttgttgtcctcgatcttcttcat 684



to top

>emb|BX052734.1|CNS09CUQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 553 gaagacgagcgtgttgttgtcctcgatcttcttcat 588



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 381 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 421



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 440 gccttcttcttgccgtccgg 459



to top

>emb|BX052705.1|CNS09CTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 413 gaagacgagcgtgttgttgtcctcgatcttcttcat 448



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 241 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 281



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 300 gccttcttcttgccgtccgg 319



to top

>emb|BX051821.1|CNS09C5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 587

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 583 gaagacgagcgtgttgttgtcctcgatcttcttcat 548



to top

>emb|BX051339.1|CNS09BRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 550 gaagacgagcgtgttgttgtcctcgatcttcttcat 585



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 378 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 418



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 437 gccttcttcttgccgtccgg 456



to top

>emb|BX050056.1|CNS09ASC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 625 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 566

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 565 gccttcttcttgccgtccgg 546



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 452 gaagacgagcgtgttgttgtcctcgatcttcttcat 417



to top

>emb|BX049916.1|CNS09AOG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 472 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 413

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 412 gccttcttcttgccgtccgg 393



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 299 gaagacgagcgtgttgttgtcctcgatcttcttcat 264



to top

>emb|BX048611.1|CNS099O7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC23DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 551 gaagacgagcgtgttgttgtcctcgatcttcttcat 586



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 378 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 437

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 438 gccttcttcttgccgtccgg 457



to top

>emb|BX047300.1|CNS098NS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 488 gaagacgagcgtgttgttgtcctcgatcttcttcat 523



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 316 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 356



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 375 gccttcttcttgccgtccgg 394



to top

>emb|BX047299.1|CNS098NR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 736 gaagacgagcgtgttgttgtcctcgatcttcttcat 701



to top

>emb|BX047041.1|CNS098GL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 441

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 402 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 343

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 342 gccttcttcttgccgtccgg 323



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 229 gaagacgagcgtgttgttgtcctcgatcttcttcat 194



to top

>emb|BX045321.1|CNS0974T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 619

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 575 gaagacgagcgtgttgttgtcctcgatcttcttcat 540



to top

>emb|BX045193.1|CNS09719 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 195 gaagacgagcgtgttgttgtcctcgatcttcttcat 230



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 82  gccttcttcttgccgtccgg 101



to top

>emb|BX045140.1|CNS096ZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC19AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 656 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 597

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 596 gccttcttcttgccgtccgg 577



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 483 gaagacgagcgtgttgttgtcctcgatcttcttcat 448



to top

>emb|BX044621.1|CNS096LD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 618 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 559

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 558 gccttcttcttgccgtccgg 539



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 445 gaagacgagcgtgttgttgtcctcgatcttcttcat 410



to top

>emb|BX042669.1|CNS09535 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 556 gaagacgagcgtgttgttgtcctcgatcttcttcat 591



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 384 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 424



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 443 gccttcttcttgccgtccgg 462



to top

>emb|BX041906.1|CNS094HY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 556 gaagacgagcgtgttgttgtcctcgatcttcttcat 591



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 384 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 424



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 443 gccttcttcttgccgtccgg 462



to top

>emb|BX040647.1|CNS093IZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 608 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 549

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 548 gccttcttcttgccgtccgg 529



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 435 gaagacgagcgtgttgttgtcctcgatcttcttcat 400



to top

>emb|BX040287.1|CNS0938Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 823

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 386 gaagacgagcgtgttgttgtcctcgatcttcttcat 421



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 214 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 254



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 273 gccttcttcttgccgtccgg 292



to top

>emb|BX039799.1|CNS092VF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 372 gaagacgagcgtgttgttgtcctcgatcttcttcat 407



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 200 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 240



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 259 gccttcttcttgccgtccgg 278



to top

>emb|BX039798.1|CNS092VE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 300 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 241

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 240 gccttcttcttgccgtccgg 221



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 127 gaagacgagcgtgttgttgtcctcgatcttcttcat 92



to top

>emb|BX033324.1|CNS08XVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 582 gaagacgagcgtgttgttgtcctcgatcttcttcat 617



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 469 gccttcttcttgccgtccgg 488



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 164 atgatgccgatcttgttggc 183
           ||||||||||||||||||||
Sbjct: 410 atgatgccgatcttgttggc 429



to top

>emb|BX033323.1|CNS08XVJ Single read from an extremity of a full-length cDNA clone made from
            Anopheles gambiae total adult females. 5-PRIME end of
            clone FK0AAA49DA06 of strain 6-9 of Anopheles gambiae
            (African malaria mosquito)
          Length = 1061

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 164  atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
            |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 1008 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 949

                                
Query: 224  gccttcttcttgccgtccgg 243
            ||||||||||||||||||||
Sbjct: 948  gccttcttcttgccgtccgg 929



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 835 gaagacgagcgtgttgttgtcctcgatcttcttcat 800



to top

>emb|BX033172.1|CNS08XRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 719

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 538 gaagacgagcgtgttgttgtcctcgatcttcttcat 573



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 425 gccttcttcttgccgtccgg 444



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 164 atgatgccgatcttgttggc 183
           ||||||||||||||||||||
Sbjct: 366 atgatgccgatcttgttggc 385



to top

>emb|BX022463.1|CNS08PHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 545 gaagacgagcgtgttgttgtcctcgatcttcttcat 580



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 373 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 413



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 432 gccttcttcttgccgtccgg 451



to top

>emb|BX022462.1|CNS08PHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 852

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 821 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 762

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 761 gccttcttcttgccgtccgg 742



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 647 gaagacgagcgtgttgttgtcctcgatcttcttcat 612



to top

>emb|BX022320.1|CNS08PDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 826 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 767

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 766 gccttcttcttgccgtccgg 747



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 653 gaagacgagcgtgttgttgtcctcgatcttcttcat 618



to top

>emb|BX026874.1|CNS08SWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 503 gaagacgagcgtgttgttgtcctcgatcttcttcat 468



to top

>emb|BX026580.1|CNS08SO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 706

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 526 gaagacgagcgtgttgttgtcctcgatcttcttcat 561



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 354 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 394



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 413 gccttcttcttgccgtccgg 432



to top

>emb|BX022838.1|CNS08PSA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 534 gaagacgagcgtgttgttgtcctcgatcttcttcat 569



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 362 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 402



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 421 gccttcttcttgccgtccgg 440



to top

>emb|BX025008.1|CNS08RGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 539 gaagacgagcgtgttgttgtcctcgatcttcttcat 574



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 67/80 (83%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | |||| |  ||| || 
Sbjct: 367 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgtca-ccgcacgtac 425

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 426 gccttcttcttgccgtccgg 445



to top

>emb|BX023269.1|CNS08Q49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 600 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 541

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 540 gccttcttcttgccgtccgg 521



 Score = 48.1 bits (24), Expect = 0.029
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 337 gaagacaagggtgttgttgtcctcgatcttct 368
           |||||| || ||||||||||||||||||||||
Sbjct: 427 gaagacgagcgtgttgttgtcctcgatcttct 396



to top

>emb|BX023034.1|CNS08PXQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 531 gaagacgagcgtgttgttgtcctcgatcttcttcat 566



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 359 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 399



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 418 gccttcttcttgccgtccgg 437



to top

>emb|BX021957.1|CNS08P3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 329

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 238 gaagacgagcgtgttgttgtcctcgatcttcttcat 273



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 66  atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 106



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 125 gccttcttcttgccgtccgg 144



to top

>emb|BX021487.1|CNS08OQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 570 gaagacgagcgtgttgttgtcctcgatcttcttcat 605



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 398 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 438



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 457 gccttcttcttgccgtccgg 476



to top

>emb|BX020862.1|CNS08O9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 375 gaagacgagcgtgttgttgtcctcgatcttcttcat 410



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 203 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 243



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 262 gccttcttcttgccgtccgg 281



to top

>emb|BX019000.1|CNS08MTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 545 gaagacgagcgtgttgttgtcctcgatcttcttcat 580



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 373 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 413



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 432 gccttcttcttgccgtccgg 451



to top

>emb|BX017300.1|CNS08LIG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 302

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 255 gaagacgagcgtgttgttgtcctcgatcttcttcat 220



to top

>emb|BX016716.1|CNS08L28 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 557 gaagacgagcgtgttgttgtcctcgatcttcttcat 592



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 385 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 425



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 444 gccttcttcttgccgtccgg 463



to top

>emb|BX016715.1|CNS08L27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 991 gaagacgagcgtgttgttgtcctcgatcttcttcat 956



to top

>emb|BX016430.1|CNS08KUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 852 gaagacgagcgtgttgttgtcctcgatcttcttcat 817



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 965 gccttcttcttgccgtccgg 946



to top

>emb|BX015793.1|CNS08KCL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 614 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 555

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 554 gccttcttcttgccgtccgg 535



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||  ||||||||||||||
Sbjct: 441 gaagacgagcgtgttgttgtaatcgatcttcttcat 406



to top

>emb|BX015752.1|CNS08KBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 543 gaagacgagcgtgttgttgtcctcgatcttcttcat 578



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 371 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 411



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 430 gccttcttcttgccgtccgg 449



to top

>emb|BX014341.1|CNS08J89 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 549 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 436 gccttcttcttgccgtccgg 455



to top

>emb|BX014340.1|CNS08J88 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 865 gaagacgagcgtgttgttgtcctcgatcttcttcat 830



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 978 gccttcttcttgccgtccgg 959



to top

>emb|BX011071.1|CNS08GPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 877 gaagacgagcgtgttgttgtcctcgatcttcttcat 842



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 990 gccttcttcttgccgtccgg 971



to top

>emb|BX010970.1|CNS08GMM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 549 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 436 gccttcttcttgccgtccgg 455



to top

>emb|BX010969.1|CNS08GML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 888 gaagacgagcgtgttgttgtcctcgatcttcttcat 853



to top

>emb|BX010291.1|CNS08G3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 543 gaagacgagcgtgttgttgtcctcgatcttcttcat 578



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 369 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 409



to top

>emb|BX010257.1|CNS08G2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 566

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 214 gaagacgagcgtgttgttgtcctcgatcttcttcat 249



to top

>emb|BX010256.1|CNS08G2S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 731 gaagacgagcgtgttgttgtcctcgatcttcttcat 696



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 844 gccttcttcttgccgtccgg 825



to top

>emb|BX009853.1|CNS08FRL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 628 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 569

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 568 gccttcttcttgccgtccgg 549



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 455 gaagacgagcgtgttgttgtcctcgatcttcttcat 420



to top

>emb|BX009843.1|CNS08FRB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 628 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 569

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 568 gccttcttcttgccgtccgg 549



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 455 gaagacgagcgtgttgttgtcctcgatcttcttcat 420



to top

>emb|BX009817.1|CNS08FQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 944 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 885

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 884 gccttcttcttgccgtccgg 865



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 771 gaagacgagcgtgttgttgtcctcgatcttcttcat 736



to top

>emb|BX008690.1|CNS08EVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 659 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 600

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 599 gccttcttcttgccgtccgg 580



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 486 gaagacgagcgtgttgttgtcctcgatcttcttcat 451



to top

>emb|BX007724.1|CNS08E4G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 549 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 436 gccttcttcttgccgtccgg 455



to top

>emb|BX007723.1|CNS08E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 997 gaagacgagcgtgttgttgtcctcgatcttcttcat 962



to top

>emb|BX006872.1|CNS08DGS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 550 gaagacgagcgtgttgttgtcctcgatcttcttcat 585



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 377 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 417



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 437 gccttcttcttgccgtccgg 456



to top

>emb|BX006131.1|CNS08CW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 513 gaagacgagcgtgttgttgtcctcgatcttcttcat 548



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtc 204
           |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 341 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtc 381



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 400 gccttcttcttgccgtccgg 419



to top

>emb|BX006130.1|CNS08CW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 792 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 733

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 732 gccttcttcttgccgtccgg 713



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 619 gaagacgagcgtgttgttgtcctcgatcttcttcat 584



to top

>gb|AY972825.1| Anopheles stephensi ribosomal protein L23a mRNA, complete cds
          Length = 1535

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 337  gaagacaagggtgttgttgtcctcgatcttcttcat 372
            |||||| || ||||||||||||||||||||||||||
Sbjct: 1001 gaagacgagcgtgttgttgtcctcgatcttcttcat 966



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                          
Query: 159  cttatatgatgccgatcttgttggccacgtcaagagcatcatagtc 204
            |||| |||||||||||||||||||| | ||| || ||||| |||||
Sbjct: 1179 cttagatgatgccgatcttgttggcaatgtccagcgcatcgtagtc 1134



to top

>gb|AC174742.8| Mus musculus  BAC RP24-258O12 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 163118

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 71833 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 71774

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 71773 aacttgatgatagcatagtggtcaagcttgtt 71742



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 49489 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 49548

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 49549 aacttgatgatagcatagtggtcaagcttgtt 49580



to top

>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold
          Length = 1888123

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
              ||||| ||||| |||||||||||||| || |||||||| || |||||| |||||||
Sbjct: 828501 atgaacacaagcgtgttgttgtcctctattttcttcatggctgactcgatggtcaa 828556



to top

>ref|XM_316082.2| Anopheles gambiae str. PEST ENSANGP00000024740
           (ENSANGG00000010065), partial mRNA
          Length = 912

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 164 atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
           |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 866 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 807

                               
Query: 224 gccttcttcttgccgtccgg 243
           ||||||||||||||||||||
Sbjct: 806 gccttcttcttgccgtccgg 787



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 337 gaagacaagggtgttgttgtcctcgatcttcttcat 372
           |||||| || ||||||||||||||||||||||||||
Sbjct: 693 gaagacgagcgtgttgttgtcctcgatcttcttcat 658



to top

>ref|XM_316083.2| Anopheles gambiae str. PEST ENSANGP00000012554 (ENSANGG00000010065),
            mRNA
          Length = 1567

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 164  atgatgccgatcttgttggccacgtcaagagcatcatagtctggtgtcagcttcacatag 223
            |||||||||||||||||||| | ||| || ||||| |||||  | || |||  ||| || 
Sbjct: 1187 atgatgccgatcttgttggcaatgtcgagcgcatcgtagtcgcgcgttagccgcacgtac 1128

                                
Query: 224  gccttcttcttgccgtccgg 243
            ||||||||||||||||||||
Sbjct: 1127 gccttcttcttgccgtccgg 1108



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 337  gaagacaagggtgttgttgtcctcgatcttcttcat 372
            |||||| || ||||||||||||||||||||||||||
Sbjct: 1014 gaagacgagcgtgttgttgtcctcgatcttcttcat 979



to top

>gb|AC172027.4| Mus musculus  BAC RP24-219P17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 185679

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                          
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 121968 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 121909

                                              
Query: 395    tacttgaggatctggtattggtcaagcttgtt 426
               |||||| |||    || ||||||||||||||
Sbjct: 121908 aacttgatgatagcatagtggtcaagcttgtt 121877



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 99607 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 99666

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 99667 aacttgatgatagcatagtggtcaagcttgtt 99698



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                         
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 65268 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 65327

                                             
Query: 395   tacttgaggatctggtattggtcaagcttgtt 426
              |||||| |||    || ||||||||||||||
Sbjct: 65328 aacttgatgatagcatagtggtcaagcttgtt 65359



to top

>gb|AC171183.6| Mus musculus  BAC RP24-545B2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 211697

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                          
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 118130 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 118189

                                              
Query: 395    tacttgaggatctggtattggtcaagcttgtt 426
               |||||| |||    || ||||||||||||||
Sbjct: 118190 aacttgatgatagcatagtggtcaagcttgtt 118221



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                        
Query: 335  atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtcaaaggg 394
            ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||  |||
Sbjct: 7368 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtcagtggg 7309

                                            
Query: 395  tacttgaggatctggtattggtcaagcttgtt 426
             |||||| |||    || ||||||||||||||
Sbjct: 7308 aacttgatgatagcatagtggtcaagcttgtt 7277



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 140703 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 140649



to top

>emb|AL672193.10| Mouse DNA sequence from clone RP23-443O18 on chromosome X, complete
            sequence
          Length = 210236

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 347  gtgttgttgtcctcgatcttcttcattgcagactcggtggtcaa 390
            ||||||||||||||||| |||||||| || ||||| ||||||||
Sbjct: 9341 gtgttgttgtcctcgatattcttcatggctgactcagtggtcaa 9384



to top

>gb|AC123752.8| Mus musculus chromosome 1, clone RP24-194N4, complete sequence
          Length = 223110

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 175284 atgaatacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 175230



to top

>gb|BC086883.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone MGC:107550
           IMAGE:6756980), complete cds
          Length = 550

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 312 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 258



to top

>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence
          Length = 200560

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                    
Query: 335   atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
             ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 43004 atgaacacaagagtgttgttgtcctctattttcttcatggctgactcagtggtca 42950



to top

>gb|BC026656.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone
           IMAGE:4988735), partial cds
          Length = 611

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 294 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 240



to top

>gb|BC029892.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone MGC:36820
           IMAGE:4163533), complete cds
          Length = 531

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 296 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 242



to top

>gb|BC016558.1| Mus musculus ribosomal protein L23a, mRNA (cDNA clone
           IMAGE:3586350), partial cds
          Length = 513

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 335 atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
           ||||| ||||| |||||||||||||| || |||||||| || ||||| |||||||
Sbjct: 276 atgaacacaagagtgttgttgtcctctattttcttcatggctgactccgtggtca 222



to top

>gb|AC103405.14| Mus musculus chromosome 19, clone RP23-98J4, complete sequence
          Length = 227074

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 335    atgaagacaagggtgttgttgtcctcgatcttcttcattgcagactcggtggtca 389
              ||||| ||||| ||| |||||||||| ||| ||||||| || |||||||||||||
Sbjct: 142181 atgaacacaagcgtggtgttgtcctctatcgtcttcatggctgactcggtggtca 142127


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,270,312
Number of Sequences: 3902068
Number of extensions: 4270312
Number of successful extensions: 80814
Number of sequences better than 10.0: 463
Number of HSP's better than 10.0 without gapping: 464
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79289
Number of HSP's gapped (non-prelim): 1448
length of query: 519
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 496
effective length of database: 17,143,297,704
effective search space: 8503075661184
effective search space used: 8503075661184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top