Clone Name	rbags9h18
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, comp...	848	0.0
2	dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clon...	535	e-149
3	ref|XM_466485.1| Oryza sativa (japonica cultivar-group), mRNA	509	e-141
4	ref|XM_472843.1| Oryza sativa (japonica cultivar-group), predic...	313	4e-82
5	dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clon...	313	4e-82
6	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	192	1e-45
7	dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic D...	192	1e-45
8	dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic D...	192	1e-45
9	gb|AY103559.1| Zea mays PCO112591 mRNA sequence	163	9e-37
10	emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4,...	137	5e-29
11	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	137	5e-29
12	dbj|AB167080.1| Curculigo latifolia NAS-2 mRNA for neoculin acid...	92	3e-15
13	dbj|AB035569.1| Chara globularis cgrpl6 mRNA for 60S ribosomal p...	48	0.038
14	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	44	0.59
15	gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...	44	0.59
16	gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...	44	0.59
17	ref|XM_571207.1| Cryptococcus neoformans var. neoformans JEC21 s...	44	0.59
18	emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022...	44	0.59
19	emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...	44	0.59
20	emb|AJ011715.1|CPA011715 Cyanophora paradoxa mRNA for 60S riboso...	44	0.59
21	gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence	42	2.3
22	ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (...	42	2.3
23	gb|AC073073.2| Homo sapiens BAC clone RP11-251G23 from 7, comple...	42	2.3
24	gb|AC074397.7| Homo sapiens BAC clone RP11-598O8 from 7, complet...	42	2.3
25	gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthe...	42	2.3
26	gb|AC159883.2| Mus musculus BAC clone RP24-490A17 from chromosom...	42	2.3
27	gb|AC151614.2| Emiliania huxleyi clone JGIACCU-13K1, complete se...	42	2.3
28	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
29	dbj|AP003541.3| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
30	dbj|AP004737.3| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
31	gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome...	42	2.3
32	gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, comp...	40	9.2
33	gb|AC098742.4| Mus musculus BAC clone RP23-122N2 from 14, comple...	40	9.2
34	gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete se...	40	9.2
35	emb|AL590677.7| Human DNA sequence from clone RP11-214D15 on chr...	40	9.2
36	emb|AL355485.9| Human DNA sequence from clone RP11-240M20 on chr...	40	9.2
37	gb|AE005744.1| Caulobacter crescentus CB15 section 70 of 359 of ...	40	9.2
38	dbj|AK094601.1| Homo sapiens cDNA FLJ37282 fis, clone BRAMY2013216	40	9.2
39	gb|AC017063.8| Homo sapiens BAC clone RP11-354H17 from 4, comple...	40	9.2
40	gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Par...	40	9.2
41	gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, comple...	40	9.2
42	gb|AC097659.3| Homo sapiens BAC clone RP11-408C24 from 4, comple...	40	9.2
43	gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complet...	40	9.2
44	gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complet...	40	9.2
45	gb|AC026692.5| Homo sapiens chromosome 5 clone CTC-257L10, compl...	40	9.2
46	gb|AC035147.4| Homo sapiens chromosome 5 clone CTD-2309M13, comp...	40	9.2
47	gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome	40	9.2
48	gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete g...	40	9.2
49	gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	40	9.2
50	gb|AC068282.8| Homo sapiens BAC clone RP11-314L11 from 2, comple...	40	9.2
51	gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270...	40	9.2
52	gb|AC017006.4| Homo sapiens BAC clone RP11-110G2 from 2, complet...	40	9.2
53	gb|AE004558.1| Pseudomonas aeruginosa PAO1, section 119 of 529 o...	40	9.2
54	emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16	40	9.2
55	gb|AC154243.2| Mus musculus BAC clone RP24-173F3 from 14, comple...	40	9.2
56	ref|NM_210401.1| Eremothecium gossypii AER190Wp (AER190W), mRNA	40	9.2
57	gb|AC004047.1|AC004047 Homo sapiens chromosome 4 clone B150J4 ma...	40	9.2
58	gb|AC005394.1|AC005394 Homo sapiens chromosome 19, cosmid F8518,...	40	9.2
59	emb|AL354819.15| Human DNA sequence from clone RP11-7B3 on chrom...	40	9.2
60	gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromoso...	40	9.2
61	emb|AL365314.16| Mouse DNA sequence from clone RP23-106N23 on ch...	40	9.2

---

>gb|AY846820.1| Triticum aestivum ribosomal protein L6 mRNA, complete cds
          Length = 686

 Score =  848 bits (428), Expect = 0.0
 Identities = 522/552 (94%), Gaps = 1/552 (0%)
 Strand = Plus / Minus

                                                                       
Query: 119 taacttagaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaa 178
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 683 taacttaaaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaa 624

                                                                       
Query: 179 gataacttttaaggtctgggacagcatctatagccttgattaactcagtgtcaatgacct 238
           ||||| |||||||||||||||| ||||| ||||||||||| ||||||| |||||||||||
Sbjct: 623 gataatttttaaggtctgggacggcatcgatagccttgatcaactcagcgtcaatgacct 564

                                                                       
Query: 239 tctggtcatccttcttgaagtcgggcagattcttcgttgcctccttctccgactcaaaca 298
           |||||||||||||||||||||| |||| |||||| ||||||||||| ||||||||||| |
Sbjct: 563 tctggtcatccttcttgaagtctggcaaattcttggttgcctccttatccgactcaaata 504

                                                                       
Query: 299 gctcgccctcagacttctttgccctagtcttcttctccctagcaaagtacttgtcatcaa 358
           |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 503 gctcgccctcagtcttctttgccctagtcttcttctccctagcgaagtacttgtcatcaa 444

                                                                       
Query: 359 acttttgcatattaaccttggagatgtcgagccttgtggatgtggaaatgacataagcct 418
           |||| |||| ||||||||| |||||||||| | |||||||||||| |||||| |||||||
Sbjct: 443 acttctgcacattaaccttagagatgtcgacctttgtggatgtggcaatgacgtaagcct 384

                                                                       
Query: 419 ggttcactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagcaggc 478
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 383 ggttcactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagaaggc 324

                                                                       
Query: 479 cggacttgagctgcttgaggaacacgacgcgcttccccatgtacctccccgcgagcagga 538
           |||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 323 cggactggagctgcttgaggaacaccacgcgctttcccatgtacctccccgcgagcagga 264

                                                                       
Query: 539 tcagcaccgtgccccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtg 598
           ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 263 tcagcaccgtg-cccggtgtgatggtcgacctgagcttggtgggatggggcttgcgtgtg 205

                                                                       
Query: 599 ctgaaggtgcgtggcttgacatcatcggcgggatagaacttgggctcggcgacggcggcc 658
           || | ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||
Sbjct: 204 ctcacggtgcgtggcttgacatcatcagcgggatagaacttgggctcggcgatggcggcc 145

                       
Query: 659 ggcttctcggcc 670
           ||||||||||||
Sbjct: 144 ggcttctcggcc 133

---

>dbj|AK072777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139B06, full
           insert sequence
          Length = 1030

 Score =  535 bits (270), Expect = e-149
 Identities = 506/582 (86%), Gaps = 2/582 (0%)
 Strand = Plus / Minus

                                                                       
Query: 82  aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141
           |||||||||| || |||| |||||||||||||||   |||||||||| ||||||||||| 
Sbjct: 770 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 712

                                                                       
Query: 142 ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201
           ||||||||||| |||||||| ||||||||||||||||||||   ||| ||||||||||||
Sbjct: 711 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 652

                                                                       
Query: 202 gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261
            | || ||||||||||| |||||||  || |   ||||||||||||||||||||||||||
Sbjct: 651 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 592

                                                                       
Query: 262 ggcagattcttcgttgcctccttctccgactcaaacagctcgccctcagacttctttgcc 321
           ||||||||||| |||||||||||||| | |||||| || || ||||| | |||||| |||
Sbjct: 591 ggcagattcttggttgcctccttctctgtctcaaaaagttcaccctcggtcttcttggcc 532

                                                                       
Query: 322 ctagtcttcttctccctagcaaagtacttgtcatcaaacttttgcatattaaccttggag 381
            | | |||||| ||||  ||||||||||||||||||||||| | ||  |||||    |||
Sbjct: 531 tttgccttcttgtcccgggcaaagtacttgtcatcaaacttatccaccttaacaccagag 472

                                                                       
Query: 382 atgtcgagccttgtggatgtggaaatgacataagcctggttcactctgcggattggcacg 441
           ||||| | | | |||||||||| |||||| || ||||||||||| | |||||| ||||| 
Sbjct: 471 atgtcaaccttcgtggatgtggcaatgacgtaggcctggttcacacggcggatgggcact 412

                                                                       
Query: 442 ccattgatcttgaaaggtccagtgatgaggagcaggccggacttgagctgcttgaggaac 501
           ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 411 ccattgatcttaaaaggtccggtgatgaggagcaggccggacttgagctgcttgaggaac 352

                                                                       
Query: 502 acgacgcgcttccccatgtacctccccgcgagcaggatcagcaccgtgccccggcgtgat 561
           |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 351 acgacgcgcttccccatgtacctcccggcgagcaggatcagcaccgt-ccccggcgtgat 293

                                                                       
Query: 562 ggtcgacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatc 621
           |||||||||||||||||| || | || |||||| ||||||  || ||| |||||||| ||
Sbjct: 292 ggtcgacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtc 233

                                                     
Query: 622 atcggcgggatagaacttgggctcggcgacggcggccggctt 663
            |||||||| |||||||||||||||||| ||||||| |||||
Sbjct: 232 gtcggcggggtagaacttgggctcggcggcggcggcgggctt 191

---

>ref|XM_466485.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 660

 Score =  509 bits (257), Expect = e-141
 Identities = 471/541 (87%), Gaps = 1/541 (0%)
 Strand = Plus / Minus

                                                                       
Query: 123 ttagaaggtcatctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagata 182
           |||||| ||||||||||| ||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 660 ttagaatgtcatctcatggggcttgtcgccgtccctgagagagaaccgggcaccaagata 601

                                                                       
Query: 183 acttttaaggtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctg 242
              ||| |||||||||||| | || ||||||||||| |||||||  || |   |||||||
Sbjct: 600 ggatttcaggtctgggacaacctcgatagccttgatcaactcagcatccacagccttctg 541

                                                                       
Query: 243 gtcatccttcttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctc 302
           |||||||||||||||||||||||||||||| |||||||||||||| | |||||| || ||
Sbjct: 540 gtcatccttcttgaagtcgggcagattcttggttgcctccttctctgtctcaaaaagttc 481

                                                                       
Query: 303 gccctcagacttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaactt 362
            ||||| | |||||| ||| | | |||||| ||||  |||||||||||||||||||||||
Sbjct: 480 accctcggtcttcttggcctttgccttcttgtcccgggcaaagtacttgtcatcaaactt 421

                                                                       
Query: 363 ttgcatattaaccttggagatgtcgagccttgtggatgtggaaatgacataagcctggtt 422
            | ||  |||||    |||||||| | | | |||||||||| |||||| || ||||||||
Sbjct: 420 atccaccttaacaccagagatgtcaaccttcgtggatgtggcaatgacgtaggcctggtt 361

                                                                       
Query: 423 cactctgcggattggcacgccattgatcttgaaaggtccagtgatgaggagcaggccgga 482
           ||| | |||||| ||||| ||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 360 cacacggcggatgggcactccattgatcttaaaaggtccggtgatgaggagcaggccgga 301

                                                                       
Query: 483 cttgagctgcttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcag 542
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 300 cttgagctgcttgaggaacacgacgcgcttccccatgtacctcccggcgagcaggatcag 241

                                                                       
Query: 543 caccgtgccccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgctga 602
           |||||| |||||||||||||||||||||||||||||| || | || |||||| |||||| 
Sbjct: 240 caccgt-ccccggcgtgatggtcgacctgagcttggtagggttggccttgcgggtgctgg 182

                                                                       
Query: 603 aggtgcgtggcttgacatcatcggcgggatagaacttgggctcggcgacggcggccggct 662
            || ||| |||||||| || |||||||| |||||||||||||||||| ||||||| ||||
Sbjct: 181 gggcgcggggcttgacgtcgtcggcggggtagaacttgggctcggcggcggcggcgggct 122

            
Query: 663 t 663
           |
Sbjct: 121 t 121

---

>ref|XM_472843.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 669

 Score =  313 bits (158), Expect = 4e-82
 Identities = 435/526 (82%), Gaps = 1/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191
           |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| ||
Sbjct: 660 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 601

                                                                       
Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251
            || |||||||| || ||||| ||||| ||||| |  || |  || |||||||| |||||
Sbjct: 600 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 541

                                                                       
Query: 252 cttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctcgccctcaga 311
            ||||| || ||||| ||||| |||||||||||||| | |||||| || || ||||| | 
Sbjct: 540 tttgaactccggcaggttcttggttgcctccttctcagtctcaaaaagttcaccctcggt 481

                                                                       
Query: 312 cttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaacttttgcatatt 371
           |||||| ||| |   |||||| |||||||  |||||||||||||||||||| | || |||
Sbjct: 480 cttcttcgccttctgcttcttgtccctagagaagtacttgtcatcaaacttctccacatt 421

                                                                       
Query: 372 aaccttggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactctgcg 431
           |||    ||||| || | | ||||||| || | |||||| || | ||||||||| | |||
Sbjct: 420 aacaccagagatatcaacctttgtggacgtagcaatgacgtagggctggttcacacggcg 361

                                                                       
Query: 432 gattggcacgccattgatcttgaaaggtccagtgatgaggagcaggccggacttgagctg 491
           ||| || || ||||||||||| |||||||| |||| ||| ||||||||||| ||||||||
Sbjct: 360 gatcggaactccattgatcttaaaaggtccggtgacgagaagcaggccggatttgagctg 301

                                                                       
Query: 492 cttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcagcaccgtgcc 551
           |||||||||||||||||||||||||||| ||||||| ||||||||||||||||| || ||
Sbjct: 300 cttgaggaacacgacgcgcttccccatgaacctcccggcgagcaggatcagcactgt-cc 242

                                                                       
Query: 552 ccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtg 611
           | |||||||||| ||||||||||||||| || | ||||||||| ||||||     ||| |
Sbjct: 241 caggcgtgatggacgacctgagcttggtagggttgggcttgcgggtgctgggctggcggg 182

                                                         
Query: 612 gcttgacatcatcggcgggatagaacttgggctcggcgacggcggc 657
           ||||||| || |||||||| |||||||||||| ||||| |||||||
Sbjct: 181 gcttgacgtcgtcggcggggtagaacttgggcgcggcggcggcggc 136

---

>dbj|AK067896.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013123D20, full
           insert sequence
          Length = 933

 Score =  313 bits (158), Expect = 4e-82
 Identities = 435/526 (82%), Gaps = 1/526 (0%)
 Strand = Plus / Minus

                                                                       
Query: 132 catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191
           |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| ||
Sbjct: 714 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 655

                                                                       
Query: 192 gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251
            || |||||||| || ||||| ||||| ||||| |  || |  || |||||||| |||||
Sbjct: 654 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 595

                                                                       
Query: 252 cttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctcgccctcaga 311
            ||||| || ||||| ||||| |||||||||||||| | |||||| || || ||||| | 
Sbjct: 594 tttgaactccggcaggttcttggttgcctccttctcagtctcaaaaagttcaccctcggt 535

                                                                       
Query: 312 cttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaacttttgcatatt 371
           |||||| ||| |   |||||| |||||||  |||||||||||||||||||| | || |||
Sbjct: 534 cttcttcgccttctgcttcttgtccctagagaagtacttgtcatcaaacttctccacatt 475

                                                                       
Query: 372 aaccttggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactctgcg 431
           |||    ||||| || | | ||||||| || | |||||| || | ||||||||| | |||
Sbjct: 474 aacaccagagatatcaacctttgtggacgtagcaatgacgtagggctggttcacacggcg 415

                                                                       
Query: 432 gattggcacgccattgatcttgaaaggtccagtgatgaggagcaggccggacttgagctg 491
           ||| || || ||||||||||| |||||||| |||| ||| ||||||||||| ||||||||
Sbjct: 414 gatcggaactccattgatcttaaaaggtccggtgacgagaagcaggccggatttgagctg 355

                                                                       
Query: 492 cttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcagcaccgtgcc 551
           |||||||||||||||||||||||||||| ||||||| ||||||||||||||||| || ||
Sbjct: 354 cttgaggaacacgacgcgcttccccatgaacctcccggcgagcaggatcagcactgt-cc 296

                                                                       
Query: 552 ccggcgtgatggtcgacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtg 611
           | |||||||||| ||||||||||||||| || | ||||||||| ||||||     ||| |
Sbjct: 295 caggcgtgatggacgacctgagcttggtagggttgggcttgcgggtgctgggctggcggg 236

                                                         
Query: 612 gcttgacatcatcggcgggatagaacttgggctcggcgacggcggc 657
           ||||||| || |||||||| |||||||||||| ||||| |||||||
Sbjct: 235 gcttgacgtcgtcggcggggtagaacttgggcgcggcggcggcggc 190

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  192 bits (97), Expect = 1e-45
 Identities = 107/109 (98%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                            
Query: 463      gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22903064 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 22903123

                                                                 
Query: 523      ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571
                ||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 22903124 ctcccggcgagcaggatcagcaccgt-ccccggcgtgatggtcgacctg 22903171



 Score =  188 bits (95), Expect = 2e-44
 Identities = 174/199 (87%), Gaps = 1/199 (0%)
 Strand = Plus / Plus

                                                                            
Query: 82       aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141
                |||||||||| || |||| |||||||||||||||   |||||||||| ||||||||||| 
Sbjct: 22901753 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 22901811

                                                                            
Query: 142      ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201
                ||||||||||| |||||||| ||||||||||||||||||||   ||| ||||||||||||
Sbjct: 22901812 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 22901871

                                                                            
Query: 202      gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261
                 | || ||||||||||| |||||||  || |   ||||||||||||||||||||||||||
Sbjct: 22901872 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 22901931

                                   
Query: 262      ggcagattcttcgttgcct 280
                ||||||||||| |||||||
Sbjct: 22901932 ggcagattcttggttgcct 22901950



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 150/184 (81%)
 Strand = Plus / Plus

                                                                            
Query: 278      cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337
                |||||||||| | |||||| || || ||||| | |||||| ||| | | |||||| ||||
Sbjct: 22902042 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 22902101

                                                                            
Query: 338      tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397
                  ||||||||||||||||||||||| | ||  |||||    |||||||| | | | ||||
Sbjct: 22902102 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 22902161

                                                                            
Query: 398      atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457
                |||||| |||||| || ||||||||||| | |||||| ||||| ||||||||||| ||||
Sbjct: 22902162 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 22902221

                    
Query: 458      gtcc 461
                ||||
Sbjct: 22902222 gtcc 22902225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                            
Query: 566      gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625
                |||||||||||||| || | || |||||| ||||||  || ||| |||||||| || |||
Sbjct: 22903263 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 22903322

                                                      
Query: 626      gcgggatagaacttgggctcggcgacggcggccggctt 663
                ||||| |||||||||||||||||| ||||||| |||||
Sbjct: 22903323 gcggggtagaacttgggctcggcggcggcggcgggctt 22903360

---

>dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0016G10
          Length = 143211

 Score =  192 bits (97), Expect = 1e-45
 Identities = 107/109 (98%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                         
Query: 463   gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22866 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 22925

                                                              
Query: 523   ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571
             ||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 22926 ctcccggcgagcaggatcagcaccgt-ccccggcgtgatggtcgacctg 22973



 Score =  188 bits (95), Expect = 2e-44
 Identities = 174/199 (87%), Gaps = 1/199 (0%)
 Strand = Plus / Plus

                                                                         
Query: 82    aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141
             |||||||||| || |||| |||||||||||||||   |||||||||| ||||||||||| 
Sbjct: 21555 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 21613

                                                                         
Query: 142   ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201
             ||||||||||| |||||||| ||||||||||||||||||||   ||| ||||||||||||
Sbjct: 21614 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 21673

                                                                         
Query: 202   gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261
              | || ||||||||||| |||||||  || |   ||||||||||||||||||||||||||
Sbjct: 21674 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 21733

                                
Query: 262   ggcagattcttcgttgcct 280
             ||||||||||| |||||||
Sbjct: 21734 ggcagattcttggttgcct 21752



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 150/184 (81%)
 Strand = Plus / Plus

                                                                         
Query: 278   cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337
             |||||||||| | |||||| || || ||||| | |||||| ||| | | |||||| ||||
Sbjct: 21844 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 21903

                                                                         
Query: 338   tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397
               ||||||||||||||||||||||| | ||  |||||    |||||||| | | | ||||
Sbjct: 21904 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 21963

                                                                         
Query: 398   atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457
             |||||| |||||| || ||||||||||| | |||||| ||||| ||||||||||| ||||
Sbjct: 21964 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 22023

                 
Query: 458   gtcc 461
             ||||
Sbjct: 22024 gtcc 22027



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                         
Query: 566   gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625
             |||||||||||||| || | || |||||| ||||||  || ||| |||||||| || |||
Sbjct: 23065 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 23124

                                                   
Query: 626   gcgggatagaacttgggctcggcgacggcggccggctt 663
             ||||| |||||||||||||||||| ||||||| |||||
Sbjct: 23125 gcggggtagaacttgggctcggcggcggcggcgggctt 23162

---

>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0006O15
          Length = 139723

 Score =  192 bits (97), Expect = 1e-45
 Identities = 107/109 (98%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                          
Query: 463    gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 136402 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 136461

                                                               
Query: 523    ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571
              ||||| |||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 136462 ctcccggcgagcaggatcagcaccgt-ccccggcgtgatggtcgacctg 136509



 Score =  188 bits (95), Expect = 2e-44
 Identities = 174/199 (87%), Gaps = 1/199 (0%)
 Strand = Plus / Plus

                                                                          
Query: 82     aaaaagactttccacagatcttgaaacttgtaccagataacttagaaggtcatctcatgc 141
              |||||||||| || |||| |||||||||||||||   |||||||||| ||||||||||| 
Sbjct: 135091 aaaaagactt-cctcagaacttgaaacttgtaccgactaacttagaatgtcatctcatgg 135149

                                                                          
Query: 142    ggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaaggtctgggaca 201
              ||||||||||| |||||||| ||||||||||||||||||||   ||| ||||||||||||
Sbjct: 135150 ggcttgtcgccgtccctgagagagaaccgggcaccaagataggatttcaggtctgggaca 135209

                                                                          
Query: 202    gcatctatagccttgattaactcagtgtcaatgaccttctggtcatccttcttgaagtcg 261
               | || ||||||||||| |||||||  || |   ||||||||||||||||||||||||||
Sbjct: 135210 acctcgatagccttgatcaactcagcatccacagccttctggtcatccttcttgaagtcg 135269

                                 
Query: 262    ggcagattcttcgttgcct 280
              ||||||||||| |||||||
Sbjct: 135270 ggcagattcttggttgcct 135288



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 150/184 (81%)
 Strand = Plus / Plus

                                                                          
Query: 278    cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337
              |||||||||| | |||||| || || ||||| | |||||| ||| | | |||||| ||||
Sbjct: 135380 cctccttctctgtctcaaaaagttcaccctcggtcttcttggcctttgccttcttgtccc 135439

                                                                          
Query: 338    tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397
                ||||||||||||||||||||||| | ||  |||||    |||||||| | | | ||||
Sbjct: 135440 gggcaaagtacttgtcatcaaacttatccaccttaacaccagagatgtcaaccttcgtgg 135499

                                                                          
Query: 398    atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457
              |||||| |||||| || ||||||||||| | |||||| ||||| ||||||||||| ||||
Sbjct: 135500 atgtggcaatgacgtaggcctggttcacacggcggatgggcactccattgatcttaaaag 135559

                  
Query: 458    gtcc 461
              ||||
Sbjct: 135560 gtcc 135563



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                          
Query: 566    gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625
              |||||||||||||| || | || |||||| ||||||  || ||| |||||||| || |||
Sbjct: 136601 gacctgagcttggtagggttggccttgcgggtgctgggggcgcggggcttgacgtcgtcg 136660

                                                    
Query: 626    gcgggatagaacttgggctcggcgacggcggccggctt 663
              ||||| |||||||||||||||||| ||||||| |||||
Sbjct: 136661 gcggggtagaacttgggctcggcggcggcggcgggctt 136698

---

>gb|AY103559.1| Zea mays PCO112591 mRNA sequence
          Length = 1361

 Score =  163 bits (82), Expect = 9e-37
 Identities = 200/238 (84%), Gaps = 1/238 (0%)
 Strand = Plus / Minus

                                                                       
Query: 405 aatgacataagcctggttcactctgcggattggcacgccattgatcttgaaaggtccagt 464
           ||||||||| | ||||||||| | |||||| || || ||||||||||||||||| |||| 
Sbjct: 782 aatgacataggtctggttcacacggcggatcggtactccattgatcttgaaaggcccaga 723

                                                                       
Query: 465 gatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtacct 524
           ||| ||||||||||| ||||||||||||||||| ||||| || | |||||||||| | | 
Sbjct: 722 gataaggagcaggccagacttgagctgcttgagaaacaccactctcttccccatgaagcg 663

                                                                       
Query: 525 ccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctgagcttggtgggat 584
           ||| ||||| |||||||||||||| ||| ||||||||| |||||||||||||||| || |
Sbjct: 662 ccctgcgaggaggatcagcaccgt-cccaggcgtgatgctcgacctgagcttggtaggct 604

                                                                     
Query: 585 ggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcggcgggatagaacttggg 642
             |||||||| ||||||     ||| |||||||| || ||||| || |||||||||||
Sbjct: 603 taggcttgcgggtgctgggaacgcggggcttgacgtcgtcggcagggtagaacttggg 546



 Score =  133 bits (67), Expect = 8e-28
 Identities = 190/231 (82%)
 Strand = Plus / Minus

                                                                        
Query: 132  catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191
            ||||||||| |||||||| ||||||||||| ||||||||||| ||||||||  |||| ||
Sbjct: 1055 catctcatggggcttgtcaccatccctgagagagaaccgggcgccaagataggttttcag 996

                                                                        
Query: 192  gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251
             ||  ||||||| || ||||||||||| |   |||  || |   ||||||||||||||||
Sbjct: 995  ctccaggacagcctcgatagccttgatcagagcagaatccacagccttctggtcatcctt 936

                                                                        
Query: 252  cttgaagtcgggcagattcttcgttgcctccttctccgactcaaacagctcgccctcaga 311
            ||||||||| |||||   ||| | ||||||||| || | |||||| ||||||||||| | 
Sbjct: 935  cttgaagtcaggcagtgacttggatgcctccttttctgtctcaaaaagctcgccctcggt 876

                                                               
Query: 312  cttctttgccctagtcttcttctccctagcaaagtacttgtcatcaaactt 362
            ||||||  || |   |||||||||||| |||||||||||||||||||||||
Sbjct: 875  cttcttcaccttctgcttcttctccctggcaaagtacttgtcatcaaactt 825

---

>emb|AL606447.3|OSJN00011 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23,
             complete sequence
          Length = 130273

 Score =  137 bits (69), Expect = 5e-29
 Identities = 100/109 (91%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                         
Query: 463   gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522
             |||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||
Sbjct: 80536 gtgacgagaagcaggccggatttgagctgcttgaggaacacgacgcgcttccccatgaac 80595

                                                              
Query: 523   ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571
             ||||| ||||||||||||||||| || ||| |||||||||| |||||||
Sbjct: 80596 ctcccggcgagcaggatcagcactgt-cccaggcgtgatggacgacctg 80643



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                         
Query: 132   catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191
             |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| ||
Sbjct: 79067 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 79126

                                                                         
Query: 192   gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251
              || |||||||| || ||||| ||||| ||||| |  || |  || |||||||| |||||
Sbjct: 79127 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 79186

                                          
Query: 252   cttgaagtcgggcagattcttcgttgcct 280
              ||||| || ||||| ||||| |||||||
Sbjct: 79187 tttgaactccggcaggttcttggttgcct 79215



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                         
Query: 566   gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625
             |||||||||||||| || | ||||||||| ||||||     ||| |||||||| || |||
Sbjct: 80735 gacctgagcttggtagggttgggcttgcgggtgctgggctggcggggcttgacgtcgtcg 80794

                                             
Query: 626   gcgggatagaacttgggctcggcgacggcggc 657
             ||||| |||||||||||| ||||| |||||||
Sbjct: 80795 gcggggtagaacttgggcgcggcggcggcggc 80826



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 146/184 (79%)
 Strand = Plus / Plus

                                                                         
Query: 278   cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337
             |||||||||| | |||||| || || ||||| | |||||| ||| |   |||||| ||||
Sbjct: 79304 cctccttctcagtctcaaaaagttcaccctcggtcttcttcgccttctgcttcttgtccc 79363

                                                                         
Query: 338   tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397
             |||  |||||||||||||||||||| | || ||||||    ||||| || | | ||||||
Sbjct: 79364 tagagaagtacttgtcatcaaacttctccacattaacaccagagatatcaacctttgtgg 79423

                                                                         
Query: 398   atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457
             | || | |||||| || | ||||||||| | |||||| || || ||||||||||| ||||
Sbjct: 79424 acgtagcaatgacgtagggctggttcacacggcggatcggaactccattgatcttaaaag 79483

                 
Query: 458   gtcc 461
             ||||
Sbjct: 79484 gtcc 79487

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  137 bits (69), Expect = 5e-29
 Identities = 100/109 (91%), Gaps = 1/109 (0%)
 Strand = Plus / Plus

                                                                            
Query: 463      gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgcttccccatgtac 522
                |||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||
Sbjct: 23637855 gtgacgagaagcaggccggatttgagctgcttgaggaacacgacgcgcttccccatgaac 23637914

                                                                 
Query: 523      ctccccgcgagcaggatcagcaccgtgccccggcgtgatggtcgacctg 571
                ||||| ||||||||||||||||| || ||| |||||||||| |||||||
Sbjct: 23637915 ctcccggcgagcaggatcagcactgt-cccaggcgtgatggacgacctg 23637962



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 121/149 (81%)
 Strand = Plus / Plus

                                                                            
Query: 132      catctcatgcggcttgtcgccatccctgagggagaaccgggcaccaagataacttttaag 191
                |||||| || ||||||||||| |||||||| || ||||| |||||||| ||| |||| ||
Sbjct: 23636386 catctcgtggggcttgtcgccgtccctgagagaaaaccgcgcaccaaggtaagttttcag 23636445

                                                                            
Query: 192      gtctgggacagcatctatagccttgattaactcagtgtcaatgaccttctggtcatcctt 251
                 || |||||||| || ||||| ||||| ||||| |  || |  || |||||||| |||||
Sbjct: 23636446 atccgggacagcttcaatagctttgatcaactcggcatccacaactttctggtcctcctt 23636505

                                             
Query: 252      cttgaagtcgggcagattcttcgttgcct 280
                 ||||| || ||||| ||||| |||||||
Sbjct: 23636506 tttgaactccggcaggttcttggttgcct 23636534



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                            
Query: 566      gacctgagcttggtgggatggggcttgcgtgtgctgaaggtgcgtggcttgacatcatcg 625
                |||||||||||||| || | ||||||||| ||||||     ||| |||||||| || |||
Sbjct: 23638054 gacctgagcttggtagggttgggcttgcgggtgctgggctggcggggcttgacgtcgtcg 23638113

                                                
Query: 626      gcgggatagaacttgggctcggcgacggcggc 657
                ||||| |||||||||||| ||||| |||||||
Sbjct: 23638114 gcggggtagaacttgggcgcggcggcggcggc 23638145



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 146/184 (79%)
 Strand = Plus / Plus

                                                                            
Query: 278      cctccttctccgactcaaacagctcgccctcagacttctttgccctagtcttcttctccc 337
                |||||||||| | |||||| || || ||||| | |||||| ||| |   |||||| ||||
Sbjct: 23636623 cctccttctcagtctcaaaaagttcaccctcggtcttcttcgccttctgcttcttgtccc 23636682

                                                                            
Query: 338      tagcaaagtacttgtcatcaaacttttgcatattaaccttggagatgtcgagccttgtgg 397
                |||  |||||||||||||||||||| | || ||||||    ||||| || | | ||||||
Sbjct: 23636683 tagagaagtacttgtcatcaaacttctccacattaacaccagagatatcaacctttgtgg 23636742

                                                                            
Query: 398      atgtggaaatgacataagcctggttcactctgcggattggcacgccattgatcttgaaag 457
                | || | |||||| || | ||||||||| | |||||| || || ||||||||||| ||||
Sbjct: 23636743 acgtagcaatgacgtagggctggttcacacggcggatcggaactccattgatcttaaaag 23636802

                    
Query: 458      gtcc 461
                ||||
Sbjct: 23636803 gtcc 23636806

---

>dbj|AB167080.1| Curculigo latifolia NAS-2 mRNA for neoculin acid subunit, complete
           cds
          Length = 655

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 92/106 (86%), Gaps = 1/106 (0%)
 Strand = Plus / Plus

                                                                       
Query: 487 agctgcttgaggaacacgacgcgcttccccatgtacctccccgcgagcaggatcagcacc 546
           |||||||| ||||| ||||| | |||||||||| ||||||| ||||| ||||||||||||
Sbjct: 1   agctgcttcaggaaaacgaccctcttccccatgaacctcccggcgagaaggatcagcacc 60

                                                         
Query: 547 gtgccccggcgtgatggtcgacctgagcttggtgggatggggcttg 592
           || |||||| || ||| ||| ||||||||||||||| | |||||||
Sbjct: 61  gt-ccccggagtaatgctcggcctgagcttggtgggcttgggcttg 105

---

>dbj|AB035569.1| Chara globularis cgrpl6 mRNA for 60S ribosomal protein L6 CgRPL6,
           partial cds
          Length = 609

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 477 gccggacttgagctgcttgaggaacacgacgcgctt 512
           |||||||| ||||||||||||||| || ||||||||
Sbjct: 228 gccggactcgagctgcttgaggaataccacgcgctt 193

---

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 378    ggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactc 427
              ||||||||||| | | ||||| |||| ||||||||| |||||| ||||||
Sbjct: 868847 ggagatgtcgaccttggtggaagtggcaatgacataggcctggctcactc 868798

---

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 641    ggctcggcgacggcggccggct 662
              ||||||||||||||||||||||
Sbjct: 546189 ggctcggcgacggcggccggct 546210

---

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 641     ggctcggcgacggcggccggct 662
               ||||||||||||||||||||||
Sbjct: 3228900 ggctcggcgacggcggccggct 3228879

---

>ref|XM_571207.1| Cryptococcus neoformans var. neoformans JEC21 structural
           constituent of ribosome (CNE03060) partial mRNA
          Length = 764

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 378 ggagatgtcgagccttgtggatgtggaaatgacataagcctggttcactc 427
           ||||||||||| | | ||||| |||| ||||||||| |||||| ||||||
Sbjct: 475 ggagatgtcgaccttggtggaagtggcaatgacataggcctggctcactc 426

---

>emb|AL121581.41|HS1022E24 Human DNA sequence from clone RP5-1022E24 on chromosome 20 Contains the
              3' end of the OPRL1 gene for opiate receptor-like 1
              protein, the GPR8 gene encoding a G protein-coupled
              receptor, the KIAA0835 gene encoding a protein similar to
              the myelin transcription factor 1 (MYT1), a novel gene, 7
              CpG islands, ESTs, STSs and GSSs, complete sequence
          Length = 179888

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 227    tgtcaatgaccttctggtcatccttc 252
              |||||||||||||||||||| |||||
Sbjct: 127616 tgtcaatgaccttctggtcagccttc 127641

---

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 641     ggctcggcgacggcggccggct 662
               ||||||||||||||||||||||
Sbjct: 2958765 ggctcggcgacggcggccggct 2958744

---

>emb|AJ011715.1|CPA011715 Cyanophora paradoxa mRNA for 60S ribosomal protein L6 (YL 16 like)
          Length = 806

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 463 gtgatgaggagcaggccggacttgagctgcttgaggaacacgacgcgctt 512
           |||| |||||| ||||| |||  ||||||||| ||||| |||||||||||
Sbjct: 361 gtgacgaggaggaggcccgacgcgagctgcttcaggaagacgacgcgctt 312

---

>gb|CP000150.1| Burkholderia sp. 383 chromosome 3, complete sequence
          Length = 1395069

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 525     ccccgcgagcaggatcagcac 545
               |||||||||||||||||||||
Sbjct: 1275949 ccccgcgagcaggatcagcac 1275969

---

>ref|XM_363819.1| Magnaporthe grisea 70-15 hypothetical protein (MG01745.4) partial
           mRNA
          Length = 1389

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 336 cctagcaaagtacttgtcatc 356
           |||||||||||||||||||||
Sbjct: 798 cctagcaaagtacttgtcatc 778

---

>gb|AC073073.2| Homo sapiens BAC clone RP11-251G23 from 7, complete sequence
          Length = 114414

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 222   ctcagtgtcaatgaccttctg 242
             |||||||||||||||||||||
Sbjct: 94051 ctcagtgtcaatgaccttctg 94071

---

>gb|AC074397.7| Homo sapiens BAC clone RP11-598O8 from 7, complete sequence
          Length = 114576

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 358   aacttttgcatattaaccttg 378
             |||||||||||||||||||||
Sbjct: 52941 aacttttgcatattaaccttg 52921

---

>gb|DQ351275.1| Streptomyces sp. NRRL 30748 meridamycin biosynthetic gene cluster and
             flanking regions
          Length = 116831

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 460   ccagtgatgaggagcaggccg 480
             |||||||||||||||||||||
Sbjct: 39372 ccagtgatgaggagcaggccg 39352

---

>gb|AC159883.2| Mus musculus BAC clone RP24-490A17 from chromosome 9, complete sequence
          Length = 140400

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 397   gatgtggaaatgacataagcc 417
             |||||||||||||||||||||
Sbjct: 31574 gatgtggaaatgacataagcc 31594

---

>gb|AC151614.2| Emiliania huxleyi clone JGIACCU-13K1, complete sequence
          Length = 42022

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 638   ttgggctcggcgacggcggccggct 662
             ||||||||||||| |||||||||||
Sbjct: 28962 ttgggctcggcgagggcggccggct 28938

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 316      tttgccctagtcttcttctccctag 340
                |||||||| ||||||||||||||||
Sbjct: 24939950 tttgcccttgtcttcttctccctag 24939926

---

>dbj|AP003541.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0530H05
          Length = 145952

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 316   tttgccctagtcttcttctccctag 340
             |||||||| ||||||||||||||||
Sbjct: 34505 tttgcccttgtcttcttctccctag 34481

---

>dbj|AP004737.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0072A21
          Length = 158287

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 316    tttgccctagtcttcttctccctag 340
              |||||||| ||||||||||||||||
Sbjct: 151033 tttgcccttgtcttcttctccctag 151009

---

>gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome 9, complete sequence
          Length = 190832

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 397    gatgtggaaatgacataagcc 417
              |||||||||||||||||||||
Sbjct: 178331 gatgtggaaatgacataagcc 178351

---

>gb|AC022675.7| Mus musculus chromosome 1, clone RP23-59N15, complete sequence
          Length = 181063

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 304    ccctcagacttctttgccct 323
              ||||||||||||||||||||
Sbjct: 146509 ccctcagacttctttgccct 146528

---

>gb|AC098742.4| Mus musculus BAC clone RP23-122N2 from 14, complete sequence
          Length = 218683

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 324    agtcttcttctccctagcaa 343
              ||||||||||||||||||||
Sbjct: 217214 agtcttcttctccctagcaa 217195

---

>gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete sequence
          Length = 113744

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 343   aagtacttgtcatcaaactt 362
             ||||||||||||||||||||
Sbjct: 68034 aagtacttgtcatcaaactt 68015

---

>emb|AL590677.7| Human DNA sequence from clone RP11-214D15 on chromosome 10 Contains the
              5' end of the gene for a novel protein (FLJ40283), a novel
              gene and two CpG islands, complete sequence
          Length = 127714

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 359    acttttgcatattaaccttg 378
              ||||||||||||||||||||
Sbjct: 110712 acttttgcatattaaccttg 110693

---

>emb|AL355485.9| Human DNA sequence from clone RP11-240M20 on chromosome 13, complete
              sequence
          Length = 149684

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 359    acttttgcatattaaccttg 378
              ||||||||||||||||||||
Sbjct: 114492 acttttgcatattaaccttg 114473

---

>gb|AE005744.1| Caulobacter crescentus CB15 section 70 of 359 of the complete genome
          Length = 11532

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 646  ggcgacggcggccggcttctcggc 669
            |||| |||||||||||||||||||
Sbjct: 7720 ggcggcggcggccggcttctcggc 7697

---

>dbj|AK094601.1| Homo sapiens cDNA FLJ37282 fis, clone BRAMY2013216
          Length = 2669

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 359  acttttgcatattaaccttg 378
            ||||||||||||||||||||
Sbjct: 2530 acttttgcatattaaccttg 2549

---

>gb|AC017063.8| Homo sapiens BAC clone RP11-354H17 from 4, complete sequence
          Length = 193092

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      aaatatttaacaggtagaaataaa 25
              |||||| |||||||||||||||||
Sbjct: 147063 aaatatgtaacaggtagaaataaa 147040

---

>gb|AC004671.1| Homo sapiens 12p13.3 PAC RPCI3-340I3 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 141266

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 342   aaagtacttgtcatcaaact 361
             ||||||||||||||||||||
Sbjct: 99726 aaagtacttgtcatcaaact 99707

---

>gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, complete sequence
          Length = 167001

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   acttttgcatattaaccttg 378
             ||||||||||||||||||||
Sbjct: 50763 acttttgcatattaaccttg 50782

---

>gb|AC097659.3| Homo sapiens BAC clone RP11-408C24 from 4, complete sequence
          Length = 131944

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 93    ccacagatcttgaaacttgt 112
             ||||||||||||||||||||
Sbjct: 10651 ccacagatcttgaaacttgt 10670

---

>gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complete sequence
          Length = 176467

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   acttttgcatattaaccttg 378
             ||||||||||||||||||||
Sbjct: 81321 acttttgcatattaaccttg 81340

---

>gb|AC069200.6| Homo sapiens BAC clone RP11-177J6 from 4, complete sequence
          Length = 148930

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 359    acttttgcatattaaccttg 378
              ||||||||||||||||||||
Sbjct: 146643 acttttgcatattaaccttg 146662

---

>gb|AC026692.5| Homo sapiens chromosome 5 clone CTC-257L10, complete sequence
          Length = 139377

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 359    acttttgcatattaaccttg 378
              ||||||||||||||||||||
Sbjct: 125269 acttttgcatattaaccttg 125250

---

>gb|AC035147.4| Homo sapiens chromosome 5 clone CTD-2309M13, complete sequence
          Length = 104940

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   acttttgcatattaaccttg 378
             ||||||||||||||||||||
Sbjct: 41370 acttttgcatattaaccttg 41389

---

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 651     cggcggccggcttctcggcc 670
               ||||||||||||||||||||
Sbjct: 4104242 cggcggccggcttctcggcc 4104223

---

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 268     ttcttcgttgcctccttctc 287
               ||||||||||||||||||||
Sbjct: 3692721 ttcttcgttgcctccttctc 3692702

---

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 433    attggcacgccattgatctt 452
              ||||||||||||||||||||
Sbjct: 995834 attggcacgccattgatctt 995815

---

>gb|AC068282.8| Homo sapiens BAC clone RP11-314L11 from 2, complete sequence
          Length = 205342

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 359    acttttgcatattaaccttg 378
              ||||||||||||||||||||
Sbjct: 125957 acttttgcatattaaccttg 125976

---

>gb|AC044787.6|AC044787 Homo sapiens chromosome 15 clone CTD-2270N23 map 15q21, complete
             sequence
          Length = 148147

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 359   acttttgcatattaaccttg 378
             ||||||||||||||||||||
Sbjct: 96958 acttttgcatattaaccttg 96939

---

>gb|AC017006.4| Homo sapiens BAC clone RP11-110G2 from 2, complete sequence
          Length = 191953

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   acttttgcatattaaccttg 378
             ||||||||||||||||||||
Sbjct: 85108 acttttgcatattaaccttg 85127

---

>gb|AE004558.1| Pseudomonas aeruginosa PAO1, section 119 of 529 of the complete
            genome
          Length = 9917

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 553  cggcgtgatggtcgacctga 572
            ||||||||||||||||||||
Sbjct: 5781 cggcgtgatggtcgacctga 5762

---

>emb|X69378.1|MCYL16 M.crystallinum mRNA for ribosomal protein YL16
          Length = 1015

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 343 aagtacttgtcatcaaactt 362
           ||||||||||||||||||||
Sbjct: 541 aagtacttgtcatcaaactt 522

---

>gb|AC154243.2| Mus musculus BAC clone RP24-173F3 from 14, complete sequence
          Length = 152254

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   agtcttcttctccctagcaa 343
             ||||||||||||||||||||
Sbjct: 68001 agtcttcttctccctagcaa 67982

---

>ref|NM_210401.1| Eremothecium gossypii AER190Wp (AER190W), mRNA
          Length = 3036

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 433  attggcacgccattgatctt 452
            ||||||||||||||||||||
Sbjct: 1301 attggcacgccattgatctt 1282

---

>gb|AC004047.1|AC004047 Homo sapiens chromosome 4 clone B150J4 map 4q25, complete sequence
          Length = 134649

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 359   acttttgcatattaaccttg 378
             ||||||||||||||||||||
Sbjct: 59996 acttttgcatattaaccttg 60015

---

>gb|AC005394.1|AC005394 Homo sapiens chromosome 19, cosmid F8518, complete sequence
          Length = 44935

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 359  acttttgcatattaaccttg 378
            ||||||||||||||||||||
Sbjct: 1571 acttttgcatattaaccttg 1590

---

>emb|AL354819.15| Human DNA sequence from clone RP11-7B3 on chromosome 13 Contains the 3'
              end of the gene for a novel calx-beta domain containing
              protein similar to sea urchin ECM3, a novel gene, a
              phospholipase A2 group XII (PLA2G12) pseudogene and a novel
              KIAA0565 KIAA1074 and breast cancer antigen NY-BR-1
              containing pseudogene, complete sequence
          Length = 153149

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 359    acttttgcatattaaccttg 378
              ||||||||||||||||||||
Sbjct: 124129 acttttgcatattaaccttg 124110

---

>gb|AC161427.4| Gallus gallus BAC clone CH261-60M14 from chromosome ul, complete sequence
          Length = 174770

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    accttctggtcatccttctt 254
              ||||||||||||||||||||
Sbjct: 148480 accttctggtcatccttctt 148499

---

>emb|AL365314.16| Mouse DNA sequence from clone RP23-106N23 on chromosome 1, complete
             sequence
          Length = 182054

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 304   ccctcagacttctttgccct 323
             ||||||||||||||||||||
Sbjct: 74893 ccctcagacttctttgccct 74874


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,487,260
Number of Sequences: 3902068
Number of extensions: 5487260
Number of successful extensions: 95445
Number of sequences better than 10.0: 61
Number of HSP's better than 10.0 without gapping: 61
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94747
Number of HSP's gapped (non-prelim): 671
length of query: 670
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 647
effective length of database: 17,143,297,704
effective search space: 11091713614488
effective search space used: 11091713614488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---