ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbags9h16 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 444 bits (224), Expect = e-121 Identities = 355/396 (89%), Gaps = 2/396 (0%) Strand = Plus / Minus Query: 259 tcagtactcggcggtggggagctgctcgtgcgggcgctggccgatgaagcagatgtcgta 318 |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||||| Sbjct: 759 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 700 Query: 319 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 378 || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| || Sbjct: 699 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 640 Query: 379 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 639 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 580 Query: 439 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 579 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 520 Query: 499 taccccgaggtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcc 558 || ||||||||||| |||||| ||||| || ||||||||||| ||||| ||||| | Sbjct: 519 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacac-ggtgtagacgaggc 461 Query: 559 cgaaggtcatgacgatctcgaacaccaaccgcgttccagacgccgacgccggcggagagc 618 |||||||||||||||||||||||||| |||||||||||| |||| ||||| || || ||| Sbjct: 460 cgaaggtcatgacgatctcgaacacc-accgcgttccaggcgcccacgcccgccgacagc 402 Query: 619 gagaaggcgcccacggcctcgccgccagtggcgatc 654 |||||||| |||||||| ||||||| || |||||| Sbjct: 401 gagaaggcacccacggcggcgccgcccgtcgcgatc 366
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 444 bits (224), Expect = e-121 Identities = 355/396 (89%), Gaps = 2/396 (0%) Strand = Plus / Plus Query: 259 tcagtactcggcggtggggagctgctcgtgcgggcgctggccgatgaagcagatgtcgta 318 |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||||| Sbjct: 43108668 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 43108727 Query: 319 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 378 || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| || Sbjct: 43108728 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 43108787 Query: 379 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 43108788 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 43108847 Query: 439 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 43108848 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 43108907 Query: 499 taccccgaggtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcc 558 || ||||||||||| |||||| ||||| || ||||||||||| ||||| ||||| | Sbjct: 43108908 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacac-ggtgtagacgaggc 43108966 Query: 559 cgaaggtcatgacgatctcgaacaccaaccgcgttccagacgccgacgccggcggagagc 618 |||||||||||||||||||||||||| |||||||||||| |||| ||||| || || ||| Sbjct: 43108967 cgaaggtcatgacgatctcgaacacc-accgcgttccaggcgcccacgcccgccgacagc 43109025 Query: 619 gagaaggcgcccacggcctcgccgccagtggcgatc 654 |||||||| |||||||| ||||||| || |||||| Sbjct: 43109026 gagaaggcacccacggcggcgccgcccgtcgcgatc 43109061 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 401 gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 460 |||||||||||| ||| ||||||||||| |||||| ||| |||||||| |||||| Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412 Query: 461 ttggcgccgacgatgaagccga 482 ||||||||||||| || ||||| Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||| |||||||||||||||||||||| Sbjct: 6644923 cggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 200 ttctcaatctctcatggcgat 220 ||||||||||||||||||||| Sbjct: 3810439 ttctcaatctctcatggcgat 3810419 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 588 cgcgttccagacgccgacgccggcg 612 |||||||||| |||||||||||||| Sbjct: 1669811 cgcgttccaggcgccgacgccggcg 1669787 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 323 agggcggcgatggcggcgccggcg 346 |||||||||||||||||| ||||| Sbjct: 3810342 agggcggcgatggcggcggcggcg 3810319
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 444 bits (224), Expect = e-121 Identities = 355/396 (89%), Gaps = 2/396 (0%) Strand = Plus / Plus Query: 259 tcagtactcggcggtggggagctgctcgtgcgggcgctggccgatgaagcagatgtcgta 318 |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||||| Sbjct: 105697 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 105756 Query: 319 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 378 || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| || Sbjct: 105757 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 105816 Query: 379 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 105817 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 105876 Query: 439 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 105877 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 105936 Query: 499 taccccgaggtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcc 558 || ||||||||||| |||||| ||||| || ||||||||||| ||||| ||||| | Sbjct: 105937 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacac-ggtgtagacgaggc 105995 Query: 559 cgaaggtcatgacgatctcgaacaccaaccgcgttccagacgccgacgccggcggagagc 618 |||||||||||||||||||||||||| |||||||||||| |||| ||||| || || ||| Sbjct: 105996 cgaaggtcatgacgatctcgaacacc-accgcgttccaggcgcccacgcccgccgacagc 106054 Query: 619 gagaaggcgcccacggcctcgccgccagtggcgatc 654 |||||||| |||||||| ||||||| || |||||| Sbjct: 106055 gagaaggcacccacggcggcgccgcccgtcgcgatc 106090
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 444 bits (224), Expect = e-121 Identities = 355/396 (89%), Gaps = 2/396 (0%) Strand = Plus / Minus Query: 259 tcagtactcggcggtggggagctgctcgtgcgggcgctggccgatgaagcagatgtcgta 318 |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||||| Sbjct: 783 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 724 Query: 319 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 378 || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| || Sbjct: 723 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 664 Query: 379 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 663 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 604 Query: 439 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 603 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 544 Query: 499 taccccgaggtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcc 558 || ||||||||||| |||||| ||||| || ||||||||||| ||||| ||||| | Sbjct: 543 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacac-ggtgtagacgaggc 485 Query: 559 cgaaggtcatgacgatctcgaacaccaaccgcgttccagacgccgacgccggcggagagc 618 |||||||||||||||||||||||||| |||||||||||| |||| ||||| || || ||| Sbjct: 484 cgaaggtcatgacgatctcgaacacc-accgcgttccaggcgcccacgcccgccgacagc 426 Query: 619 gagaaggcgcccacggcctcgccgccagtggcgatc 654 |||||||| |||||||| ||||||| || |||||| Sbjct: 425 gagaaggcacccacggcggcgccgcccgtcgcgatc 390
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 444 bits (224), Expect = e-121 Identities = 355/396 (89%), Gaps = 2/396 (0%) Strand = Plus / Minus Query: 259 tcagtactcggcggtggggagctgctcgtgcgggcgctggccgatgaagcagatgtcgta 318 |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||||| Sbjct: 832 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 773 Query: 319 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 378 || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| || Sbjct: 772 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 713 Query: 379 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 712 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 653 Query: 439 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 652 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 593 Query: 499 taccccgaggtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcc 558 || ||||||||||| |||||| ||||| || ||||||||||| ||||| ||||| | Sbjct: 592 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacac-ggtgtagacgaggc 534 Query: 559 cgaaggtcatgacgatctcgaacaccaaccgcgttccagacgccgacgccggcggagagc 618 |||||||||||||||||||||||||| |||||||||||| |||| ||||| || || ||| Sbjct: 533 cgaaggtcatgacgatctcgaacacc-accgcgttccaggcgcccacgcccgccgacagc 475 Query: 619 gagaaggcgcccacggcctcgccgccagtggcgatc 654 |||||||| |||||||| ||||||| || |||||| Sbjct: 474 gagaaggcacccacggcggcgccgcccgtcgcgatc 439
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 444 bits (224), Expect = e-121 Identities = 355/396 (89%), Gaps = 2/396 (0%) Strand = Plus / Minus Query: 259 tcagtactcggcggtggggagctgctcgtgcgggcgctggccgatgaagcagatgtcgta 318 |||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||||| Sbjct: 769 tcagtagtcggcggtgggcagctggtcgtgcgggcgctggccgatgaagatgatgtcgta 710 Query: 319 gacgagggcggcgatggcggcgccggcgaaggggccgagccagtacacccagtggttctc 378 || ||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| || Sbjct: 709 gatgagcgcggcgatggcggcgccgacgaaggggccgagccagtagacccagtggttgtc 650 Query: 379 ccagacgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 649 ccagactccggtgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtc 590 Query: 439 aaaggctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 589 gaaggcgccgccggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 530 Query: 499 taccccgaggtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcc 558 || ||||||||||| |||||| ||||| || ||||||||||| ||||| ||||| | Sbjct: 529 gacaccgaggtcgcccttcttgggatccaccgcggtggcgtacac-ggtgtagacgaggc 471 Query: 559 cgaaggtcatgacgatctcgaacaccaaccgcgttccagacgccgacgccggcggagagc 618 |||||||||||||||||||||||||| |||||||||||| |||| ||||| || || ||| Sbjct: 470 cgaaggtcatgacgatctcgaacacc-accgcgttccaggcgcccacgcccgccgacagc 412 Query: 619 gagaaggcgcccacggcctcgccgccagtggcgatc 654 |||||||| |||||||| ||||||| || |||||| Sbjct: 411 gagaaggcacccacggcggcgccgcccgtcgcgatc 376
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 383 bits (193), Expect = e-103 Identities = 333/377 (88%), Gaps = 2/377 (0%) Strand = Plus / Minus Query: 278 agctgctcgtgcgggcgctggccgatgaagcagatgtcgtagacgagggcggcgatggcg 337 ||||||| ||| |||||||| ||||||||| ||||||||||||||| || |||||||| Sbjct: 754 agctgctggtgtgggcgctgcccgatgaagatgatgtcgtagacgagcgccgcgatggcc 695 Query: 338 gcgccggcgaaggggccgagccagtacacccagtggttctcccagacgccgctgaccacg 397 ||||| |||| ||||||| ||||||||||||||||||||||||||||||| |||| ||| Sbjct: 694 gcgcccgcgagtgggccgacccagtacacccagtggttctcccagacgccggtgacgacg 635 Query: 398 gcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccagg 457 || ||||||||||||||||||||||||||||| |||||||| ||||| || || |||||| Sbjct: 634 gccgggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccccccgccagg 575 Query: 458 atgttggcgccgacgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgc 517 ||||||||||||||||||||||||||||||||||||||||| || ||||||||||| | Sbjct: 574 atgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttc 515 Query: 518 ttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 ||||||||||| |||||||||||||| ||||||||||| |||||||||||||| ||||| Sbjct: 514 ttggggtccacggccgtggcgtacac-cgtgtacacgaggccgaaggtcatgaccatctc 456 Query: 578 gaacaccaaccgcgttccagacgccgacgccggcggagagcgagaaggcgcccacggcct 637 | |||| || |||||| | |||||||||| || || |||||||||||||| | |||| Sbjct: 455 cagcacc-acggcgttcatggcgccgacgcccgccgacagcgagaaggcgccaagggccg 397 Query: 638 cgccgccagtggcgatc 654 ||||||| ||||||||| Sbjct: 396 cgccgcccgtggcgatc 380
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 333 bits (168), Expect = 4e-88 Identities = 313/361 (86%), Gaps = 2/361 (0%) Strand = Plus / Plus Query: 294 gctggccgatgaagcagatgtcgtagacgagggcggcgatggcggcgccggcgaaggggc 353 |||| ||||||||| ||||||||||||||| || |||||||| ||||| |||| |||| Sbjct: 273 gctgcccgatgaagatgatgtcgtagacgagcgccgcgatggccgcgcccgcgagtgggc 332 Query: 354 cgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggaga 413 ||| ||||||||||||||||||||||||||||||| |||| || || ||||||||||||| Sbjct: 333 cgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaaggaga 392 Query: 414 cggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacga 473 |||||| ||||||||| |||||||| ||||| |||||||||||||||||||||| Sbjct: 393 cggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccgacga 452 Query: 474 tgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccg 533 ||||||||||||||||||||||||| || ||||||||||| |||||||||||| |||| Sbjct: 453 tgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacggccg 512 Query: 534 tggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaacaccaaccgcgtt 593 |||||||||| ||||||||||| |||||||||||||| ||||| | |||| || ||||| Sbjct: 513 tggcgtacac-cgtgtacacgaggccgaaggtcatgaccatctccagcacc-acggcgtt 570 Query: 594 ccagacgccgacgccggcggagagcgagaaggcgcccacggcctcgccgccagtggcgat 653 | | |||||||||| || || |||||||||||||| | |||| ||||||| |||||||| Sbjct: 571 catggcgccgacgcccgccgacagcgagaaggcgccaatggccgcgccgcccgtggcgat 630 Query: 654 c 654 | Sbjct: 631 c 631
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 192 bits (97), Expect = 1e-45 Identities = 197/229 (86%), Gaps = 1/229 (0%) Strand = Plus / Minus Query: 349 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 408 |||||||| |||||||||||| |||| | |||| | | |||||| | |||||||||||| Sbjct: 729 ggggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaa 670 Query: 409 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 468 |||||||||||||||||||||||||||| ||||| |||||| | |||||||||||||| Sbjct: 669 ggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgcc 610 Query: 469 gacgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccac 528 |||||||||||||||||||||||||||||| || ||| ||| ||||||||| || Sbjct: 609 gacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgac 550 Query: 529 agccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 || ||||||||||| |||||||| ||||||||||||||||||||||| Sbjct: 549 ggcggtggcgtacac-cgtgtacaccagcccgaaggtcatgacgatctc 502 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 814 agtagtcggtggtggggagctgctcgtg 787
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 192 bits (97), Expect = 1e-45 Identities = 197/229 (86%), Gaps = 1/229 (0%) Strand = Plus / Minus Query: 349 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 408 |||||||| |||||||||||| |||| | |||| | | |||||| | |||||||||||| Sbjct: 760 ggggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaa 701 Query: 409 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 468 |||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||| Sbjct: 700 ggagacggcggggttcatggacgcgccggagaaggcgccgcccaccaggatgttggcgcc 641 Query: 469 gacgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccac 528 ||||||||||||||||||||||||||||| || ||| ||| |||||||||||| Sbjct: 640 cacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtccac 581 Query: 529 agccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 580 ggccgtggcgtacac-cgtgtacaccagcccgaaggtcatcacgatctc 533 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Minus Query: 259 tcagtactcggcggtggggagctgctcgtg 288 |||||| |||| |||||||||||||||||| Sbjct: 847 tcagtagtcggtggtggggagctgctcgtg 818
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 168 bits (85), Expect = 1e-38 Identities = 194/229 (84%), Gaps = 1/229 (0%) Strand = Plus / Minus Query: 349 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 408 |||||||| |||||||||||| |||| |||| | | |||||| | |||||||||||| Sbjct: 667 ggggccgacccagtacacccactggtagccccactcccagctgacgagggcggggccgaa 608 Query: 409 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 468 ||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||||| || Sbjct: 607 ggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccc 548 Query: 469 gacgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccac 528 ||||||||||||||||||||||| ||||| || ||| ||| ||| |||||||| Sbjct: 547 cacgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccac 488 Query: 529 agccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||||||||||| |||||||| |||||||||||||| |||||||| Sbjct: 487 cgccgtggcgtacac-cgtgtacaccagcccgaaggtcatcacgatctc 440
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 167 bits (84), Expect = 6e-38 Identities = 199/236 (84%), Gaps = 1/236 (0%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 409 ||||||| |||||||||||||||||| | |||| | |||||| | | |||||||||| Sbjct: 744 gggccgacccagtacacccagtggttgttccaggaccagctgacgagcgaggggccgaag 685 Query: 410 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 469 || |||||||||||||||||||||||||| ||||| |||||| | |||||||||||||| Sbjct: 684 gacacggcggggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgccc 625 Query: 470 acgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccaca 529 ||||||||||||||||||||||| ||||| || ||| ||| ||||||||| || Sbjct: 624 acgatgaagccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgacc 565 Query: 530 gccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaacacca 585 || ||||||||||| |||||||| || ||||||||||| |||||||||| ||||| Sbjct: 564 gcggtggcgtacac-agtgtacaccagaccgaaggtcatcacgatctcgagcacca 510 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 833 agtagtcggtggtggggagctgctcgtg 806
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 163 bits (82), Expect = 9e-37 Identities = 164/190 (86%), Gaps = 1/190 (0%) Strand = Plus / Minus Query: 388 gctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctcc 447 |||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||| || Sbjct: 724 gctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgcc 665 Query: 448 gccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgattaccccgag 507 ||| |||||||||||||||| ||||||||||||||||||||||| ||||| || || Sbjct: 664 gcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggtgcccag 605 Query: 508 gtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtca 567 | ||| ||| |||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 604 gctgcccttcttcgggtccaccgccgtcgcgtacac-cgtgtacaccagcccgaaggtca 546 Query: 568 tgacgatctc 577 | |||||||| Sbjct: 545 tcacgatctc 536
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 155 bits (78), Expect = 2e-34 Identities = 163/190 (85%), Gaps = 1/190 (0%) Strand = Plus / Minus Query: 388 gctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctcc 447 |||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||| || Sbjct: 720 gctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaaggcgcc 661 Query: 448 gccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgattaccccgag 507 ||| ||||||||||||| || ||||||||||||||||| ||||| ||||| || || Sbjct: 660 gcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggtgcccag 601 Query: 508 gtcgccgcgcttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtca 567 | ||| ||| |||||||| |||||||||||||| |||||||| ||||||||||||| Sbjct: 600 gctgcccttcttcgggtccaccgccgtggcgtacac-cgtgtacaccagcccgaaggtca 542 Query: 568 tgacgatctc 577 | |||||||| Sbjct: 541 tcacgatctc 532
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 153 bits (77), Expect = 9e-34 Identities = 192/229 (83%), Gaps = 1/229 (0%) Strand = Plus / Minus Query: 349 ggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaa 408 |||||||| |||||||||||| |||| |||| | | |||||| | |||||||||||| Sbjct: 762 ggggccgacccagtacacccactggtagccccactcccagctgacgagggcggggccgaa 703 Query: 409 ggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgcc 468 ||| |||||||||||||||||||||||||| ||||| ||||| ||||||||||||| || Sbjct: 702 ggacacggcggggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccc 643 Query: 469 gacgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccac 528 ||||||||||||||||| ||||| ||||| || ||| ||| ||| |||||||| Sbjct: 642 cacgatgaagccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccac 583 Query: 529 agccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 ||||| |||||||| |||||||| |||||||||||||| |||||||| Sbjct: 582 cgccgtcgcgtacac-cgtgtacaccagcccgaaggtcatcacgatctc 535
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 657 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 598 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 597 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 538 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 537 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 478 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 477 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 439 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 751 agtagtcggtggtggggagctgctcgtg 724
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Plus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 2544825 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 2544884 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 2544885 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 2544944 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 2544945 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 2545004 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 2545005 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 2545043 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggcggcgccggcgaaggggcc 354 ||||||||||||||||||||| Sbjct: 36057600 ggcggcgccggcgaaggggcc 36057580 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||| | ||||||||||| Sbjct: 33259902 ggcggcgatggcgggggcggcgaagggg 33259929 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||||| |||||| |||| Sbjct: 15248524 ggcggcgatggcggcggcggcgaggggg 15248497 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 2544731 agtagtcggtggtggggagctgctcgtg 2544758
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 125269 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 125210 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 125209 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 125150 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 125149 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 125090 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 125089 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 125051 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 125363 agtagtcggtggtggggagctgctcgtg 125336
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Plus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 2544935 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 2544994 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 2544995 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 2545054 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 2545055 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 2545114 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 2545115 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 2545153 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggcggcgccggcgaaggggcc 354 ||||||||||||||||||||| Sbjct: 36147674 ggcggcgccggcgaaggggcc 36147654 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||| | ||||||||||| Sbjct: 33350412 ggcggcgatggcgggggcggcgaagggg 33350439 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||||| |||||| |||| Sbjct: 15243058 ggcggcgatggcggcggcggcgaggggg 15243031 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 2544841 agtagtcggtggtggggagctgctcgtg 2544868
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 735 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 676 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 675 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 616 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 615 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 556 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 555 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 517 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 829 agtagtcggtggtggggagctgctcgtg 802
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Plus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 234 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 293 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 294 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 353 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 354 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 413 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 414 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 452 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 182 agtagtcggtggtggggagctgctcgtg 209
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 744 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 685 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 684 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 625 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 624 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 565 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 564 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 526 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 838 agtagtcggtggtggggagctgctcgtg 811
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 746 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 687 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 686 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 627 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 626 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 567 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 566 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 528 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 840 agtagtcggtggtggggagctgctcgtg 813
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 270 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 211 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 210 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 151 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 150 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 91 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 90 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 52 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 364 agtagtcggtggtggggagctgctcgtg 337
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 151 bits (76), Expect = 3e-33 Identities = 185/220 (84%), Gaps = 1/220 (0%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||||||||| ||| ||||||| | |||||| | ||| ||||||||||||||||| Sbjct: 742 ccagtacacccactgggactcccaggaccagctgacgagggccgggccgaaggagacggc 683 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 ||||||||||| |||||||| || || |||||| | |||||||| |||||||||||||| Sbjct: 682 cgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaa 623 Query: 478 gccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagccgtggc 537 ||||||||||||||| ||||| |||||| ||| ||||||||| || || ||||| Sbjct: 622 gccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggc 563 Query: 538 gtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| ||||| ||||| |||||||||||||||||||| Sbjct: 562 gtacac-ggtgtagacgaggccgaaggtcatgacgatctc 524 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 836 agtagtcggtggtggggagctgctcgtg 809
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 131 bits (66), Expect = 3e-27 Identities = 162/190 (85%), Gaps = 3/190 (1%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccg-tcaaaggctccgccggc 453 |||||||||||||||||| ||||||||||||||| ||||| | || ||| |||| ||| Sbjct: 684 acggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgc-ggc 626 Query: 454 caggatgttggcgccgacgatgaagccgatggcgatgggcgcgattaccccgaggtcgcc 513 |||||||||||||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 625 gaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagcc 566 Query: 514 gcgcttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacga 573 ||||||||| | || ||||||||||| ||||| |||||| ||||||| ||||||| Sbjct: 565 cttcttggggtcggcggcggtggcgtacac-ggtgtagacgagcgcgaaggtgatgacga 507 Query: 574 tctcgaacac 583 |||||||||| Sbjct: 506 tctcgaacac 497
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 115 bits (58), Expect = 2e-22 Identities = 94/106 (88%) Strand = Plus / Minus Query: 393 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 452 |||||||||||||||||||| ||| ||||||||||| ||||| |||| ||| ||| Sbjct: 619 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 560 Query: 453 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 559 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 514 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttca 425 |||||| ||||||||| |||||||||||||| Sbjct: 278 acggcgaggccgaaggtgacggcggggttca 248 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 339 cgccggcgaaggggccgagccagtacacccagt 371 ||||| ||| |||||||| |||||||||||||| Sbjct: 673 cgccgacgagggggccgacccagtacacccagt 641
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 115 bits (58), Expect = 2e-22 Identities = 94/106 (88%) Strand = Plus / Minus Query: 393 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 452 |||||||||||||||||||| ||| ||||||||||| ||||| |||| ||| ||| Sbjct: 687 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 628 Query: 453 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 627 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 582 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttca 425 |||||| ||||||||| |||||||||||||| Sbjct: 346 acggcgaggccgaaggtgacggcggggttca 316 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 339 cgccggcgaaggggccgagccagtacacccagt 371 ||||| ||| |||||||| |||||||||||||| Sbjct: 741 cgccgacgagggggccgacccagtacacccagt 709
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 115 bits (58), Expect = 2e-22 Identities = 160/190 (84%), Gaps = 3/190 (1%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccg-tcaaaggctccgccggc 453 |||||||||||||||||| ||||||||||||||| ||||| | || ||| |||| ||| Sbjct: 841 acggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgc-ggc 783 Query: 454 caggatgttggcgccgacgatgaagccgatggcgatgggcgcgattaccccgaggtcgcc 513 |||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 782 gaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagcc 723 Query: 514 gcgcttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacga 573 ||||||||| | || ||||||||||| ||||| |||||| ||||||| ||||||| Sbjct: 722 cttcttggggtcggcggcggtggcgtacac-ggtgtagacgagcgcgaaggtgatgacga 664 Query: 574 tctcgaacac 583 ||||||||| Sbjct: 663 cctcgaacac 654
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 115 bits (58), Expect = 2e-22 Identities = 94/106 (88%) Strand = Plus / Minus Query: 393 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 452 |||||||||||||||||||| ||| ||||||||||| ||||| |||| ||| ||| Sbjct: 696 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 637 Query: 453 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 636 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 591 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttca 425 |||||| ||||||||| |||||||||||||| Sbjct: 355 acggcgaggccgaaggtgacggcggggttca 325 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 339 cgccggcgaaggggccgagccagtacacccagt 371 ||||| ||| |||||||| |||||||||||||| Sbjct: 750 cgccgacgagggggccgacccagtacacccagt 718
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 115 bits (58), Expect = 2e-22 Identities = 160/190 (84%), Gaps = 3/190 (1%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccg-tcaaaggctccgccggc 453 |||||||||||||||||| ||||||||||||||| ||||| | || ||| |||| ||| Sbjct: 840 acggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgc-ggc 782 Query: 454 caggatgttggcgccgacgatgaagccgatggcgatgggcgcgattaccccgaggtcgcc 513 |||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 781 gaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagcc 722 Query: 514 gcgcttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacga 573 ||||||||| | || ||||||||||| ||||| |||||| ||||||| ||||||| Sbjct: 721 cttcttggggtcggcggcggtggcgtacac-ggtgtagacgagcgcgaaggtgatgacga 663 Query: 574 tctcgaacac 583 ||||||||| Sbjct: 662 cctcgaacac 653
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 115 bits (58), Expect = 2e-22 Identities = 94/106 (88%) Strand = Plus / Minus Query: 393 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 452 |||||||||||||||||||| ||| ||||||||||| ||||| |||| ||| ||| Sbjct: 678 ccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcgg 619 Query: 453 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 618 ccaggatgttggcgccgacgatgaagccgatggccatgggcgcgat 573 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttca 425 |||||| ||||||||| |||||||||||||| Sbjct: 337 acggcgaggccgaaggtgacggcggggttca 307 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 339 cgccggcgaaggggccgagccagtacacccagt 371 ||||| ||| |||||||| |||||||||||||| Sbjct: 732 cgccgacgagggggccgacccagtacacccagt 700
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 109 bits (55), Expect = 1e-20 Identities = 85/95 (89%) Strand = Plus / Minus Query: 404 ccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttg 463 |||||||| || || |||||||| ||||| ||||| ||||| |||||||||||||||||| Sbjct: 607 ccgaaggacaccgccgggttcatcgacgccccgtcgaaggccccgccggccaggatgttg 548 Query: 464 gcgccgacgatgaagccgatggcgatgggcgcgat 498 || || |||||||||||||| |||||||||||||| Sbjct: 547 gcccccacgatgaagccgatcgcgatgggcgcgat 513 Score = 67.9 bits (34), Expect = 4e-08 Identities = 69/78 (88%), Gaps = 2/78 (2%) Strand = Plus / Minus Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaacaccaaccgcgt 592 ||||||||||| ||||| |||||||||||||||||||||||||||| ||| | ||||| Sbjct: 478 gtggcgtacacg-gtgtagacgagcccgaaggtcatgacgatctcgaggacc-agcgcgt 421 Query: 593 tccagacgccgacgccgg 610 ||||||||| ||| |||| Sbjct: 420 tccagacgctgaccccgg 403
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 13251014 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 13250955 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13250954 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 13250900 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 337 ggcgccggcgaaggggccgagccagtacacccagtggt 374 ||||||| ||||||||||||| ||||||||||||||| Sbjct: 1762730 ggcgccgatgaaggggccgagctagtacacccagtggt 1762693 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 28065834 ggcggcgatggcggcgccgg 28065853 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 28023111 ggcggcgatggcggcgccgg 28023092 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 466 gccgacgatgaagccgatggcgat 489 ||||| |||||||||||||||||| Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 12824 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 12765 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 12764 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 12710
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 168202 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 168143 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 168142 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 168088
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 714 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 655 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 654 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 600
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 716 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 657 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 656 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 602
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 594 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 535 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 534 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 480
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 717 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 658 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 657 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 603
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 715 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 656 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 655 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 601
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 717 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 658 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 657 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 603
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 101 bits (51), Expect = 3e-18 Identities = 99/115 (86%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || ||||||||||| ||||| |||| Sbjct: 715 cgccgctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaagg 656 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 655 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 601
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 93.7 bits (47), Expect = 7e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || |||||||||||| ||||| |||| Sbjct: 676 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagg 617 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | ||||||||||||||||||||||||||||||||||| || ||||| Sbjct: 616 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgat 562
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 93.7 bits (47), Expect = 7e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || |||||||||||| ||||| |||| Sbjct: 679 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagg 620 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| | | |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 619 ggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 565
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 93.7 bits (47), Expect = 7e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || |||||||||||| ||||| |||| Sbjct: 680 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaagg 621 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| | | |||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 620 ggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgat 566
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 93.7 bits (47), Expect = 7e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||| ||||||||| || ||||||||||| ||||| |||| Sbjct: 716 cgccgctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaagg 657 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| || | |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 656 ggccggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 602
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 93.7 bits (47), Expect = 7e-16 Identities = 98/115 (85%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg 443 |||||||| | |||||||||||||||||| || |||||||||||| ||||| ||||| Sbjct: 682 cgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggaaaagg 623 Query: 444 ctccgccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||| | | ||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 622 ggccggccacgaggatgttggcgccgacaatgaagccgatggcgatgggggcgat 568
>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein, complete cds Length = 1122 Score = 93.7 bits (47), Expect = 7e-16 Identities = 118/142 (83%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaaggagacggc 417 |||||| |||||||||||||||||| | ||| |||| || || ||||| || ||||| Sbjct: 731 ccagtagacccagtggttctcccagctccagctcaccaacgccggcccgaangaaacggc 672 Query: 418 ggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaa 477 |||||||||||||| |||||||| || || || |||| ||||||||||| |||||||| Sbjct: 671 cgggttcatggacgctccgtcaaaagccccacccgccaaaatgttggcgccaacgatgaa 612 Query: 478 gccgatggcgatgggcgcgatt 499 || || ||||||||||||||| Sbjct: 611 accaatcgcgatgggcgcgatt 590
>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI) mRNA, complete cds Length = 1035 Score = 89.7 bits (45), Expect = 1e-14 Identities = 186/229 (81%), Gaps = 3/229 (1%) Strand = Plus / Minus Query: 353 ccgagccagtacacccagtggttctccca-gacgccgctgaccacggcggggccgaagga 411 ||||||||||| ||||||||||| | ||| ||| | |||||| || || ||||||||||| Sbjct: 735 ccgagccagtagacccagtggttgttccatgac-cagctgacaacagcagggccgaagga 677 Query: 412 gacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgac 471 || || ||||||||||| || ||||||||||| || || |||| |||||||||| | || Sbjct: 676 cactgcagggttcatggatgcaccgtcaaaggcaccaccagccaagatgttggcggccac 617 Query: 472 gatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagc 531 |||| |||||||| | ||| || || | ||||| ||| || ||||||||| ||||| Sbjct: 616 aatgagaccgatggccaagggggcaatgatcccgatgtcacccttcttggggtcaacagc 557 Query: 532 cgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| || |||||||||||||| || |||||||| Sbjct: 556 agtggcgtagac-ggtgtagacaagcccgaaggtcatcacaatctcgaa 509
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 614 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 555 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 554 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 511 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Minus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 488 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 433
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Plus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 26627252 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 26627311 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 26627312 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 26627355 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 26627378 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 26627433 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgagggcggcgatggcggcg 340 |||||||||||||||||||| Sbjct: 2927635 cgagggcggcgatggcggcg 2927616
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Plus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 169633 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 169692 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 169693 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 169736 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 169759 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 169814
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Plus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 61413 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 61472 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 61473 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 61516 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 61539 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 61594
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 687 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 628 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 627 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 584 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Minus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 561 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 506
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 489 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 430 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 429 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 386 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Minus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 363 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 308
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 87.7 bits (44), Expect = 4e-14 Identities = 89/104 (85%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggcc 454 |||||||||||||||||| || ||||||||||| ||||| || | ||| |||| Sbjct: 250582 acggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcg 250523 Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 250522 aggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 250479 Score = 81.8 bits (41), Expect = 3e-12 Identities = 47/49 (95%) Strand = Plus / Plus Query: 450 cggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 332121 cggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgat 332169 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Plus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 332192 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 332247 Score = 42.1 bits (21), Expect = 2.3 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Minus Query: 521 gggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctc 577 |||||| | |||||||||||||| |||||||| ||| |||| || ||||||||||| Sbjct: 250456 gggtccgccgccgtggcgtacacc-gtgtacaccagcgcgaacgtgatgacgatctc 250401
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 79.8 bits (40), Expect = 1e-11 Identities = 90/104 (86%), Gaps = 2/104 (1%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg-ctccgccggc 453 ||||| |||||||||||| ||| ||||||||||| |||| ||||| | |||||| | Sbjct: 617 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccg-c 559 Query: 454 caggatgttggcgccgacgatgaagccgatggcgatgggcgcga 497 |||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 558 caggatgttggcaccgacgatgaagccgatggccatgggcgcga 515
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 79.8 bits (40), Expect = 1e-11 Identities = 90/104 (86%), Gaps = 2/104 (1%) Strand = Plus / Plus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg-ctccgccggc 453 ||||| |||||||||||| ||| ||||||||||| |||| ||||| | |||||| | Sbjct: 92562 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccg-c 92620 Query: 454 caggatgttggcgccgacgatgaagccgatggcgatgggcgcga 497 |||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 92621 caggatgttggcaccgacgatgaagccgatggccatgggcgcga 92664
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 79.8 bits (40), Expect = 1e-11 Identities = 90/104 (86%), Gaps = 2/104 (1%) Strand = Plus / Plus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtcaaagg-ctccgccggc 453 ||||| |||||||||||| ||| ||||||||||| |||| ||||| | |||||| | Sbjct: 27568586 acggccgggccgaaggagcgggcagggttcatggaactgccgctaaagggccccgccg-c 27568644 Query: 454 caggatgttggcgccgacgatgaagccgatggcgatgggcgcga 497 |||||||||||| |||||||||||||||||||| |||||||||| Sbjct: 27568645 caggatgttggcaccgacgatgaagccgatggccatgggcgcga 27568688 Score = 54.0 bits (27), Expect = 6e-04 Identities = 43/47 (91%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcga 579 ||||||||||| ||||||||||||||||| |||||||||| ||||| Sbjct: 26354639 gtggcgtacacg-gtgtacacgagcccgaacgtcatgacgacctcga 26354594 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 419 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 478 |||||||||| ||||||||| || | || ||||| |||||||| ||||| ||| ||| Sbjct: 26354750 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 26354691 Query: 479 ccgatggcgatgggcgc 495 |||||||||| |||||| Sbjct: 26354690 ccgatggcgaggggcgc 26354674
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 79.8 bits (40), Expect = 1e-11 Identities = 137/168 (81%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| |||||| || ||||| ||||| |||||||| || || ||| Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| |||| ||||||||| || || Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 368 gtggcgtagac-ggtgtagacgagcccgaaggtcatcacgatctcgaa 322
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 75.8 bits (38), Expect = 2e-10 Identities = 89/106 (83%) Strand = Plus / Minus Query: 393 ccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccgg 452 ||||||| || ||||||||| || ||||||||||| ||||| |||| ||| ||| Sbjct: 44845 ccacggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcgg 44786 Query: 453 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 | ||||||||||||||||||||||||||||| || ||||||||||| Sbjct: 44785 cgaggatgttggcgccgacgatgaagccgatcgccatgggcgcgat 44740
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 854 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 807 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Minus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 732 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 683
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 26109 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 26156 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Plus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 26231 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 26280
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 18187019 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 18186972 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Minus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 18186897 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 18186848 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 319 gacgagggcggcgatggcggcgccg 343 ||||||||||||||||| ||||||| Sbjct: 14249963 gacgagggcggcgatggtggcgccg 14249987
>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full insert sequence Length = 1200 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 863 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 816 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Minus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 741 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 692
>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast intrinsic protein, complete cds Length = 1178 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 846 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 799 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Minus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 724 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 675
>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full insert sequence Length = 1787 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 140 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 187 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Plus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 262 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 311
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 71.9 bits (36), Expect = 3e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||||||||||||||||||||||||||| Sbjct: 18196272 cggcgaggccggcgccgacgaaggggccgagccagtacacccagtggt 18196225 Score = 44.1 bits (22), Expect = 0.57 Identities = 43/50 (86%) Strand = Plus / Minus Query: 449 ccggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||| || ||||||||||||| || |||||||| ||||| |||||||| Sbjct: 18196150 ccggcgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgat 18196101 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 319 gacgagggcggcgatggcggcgccg 343 ||||||||||||||||| ||||||| Sbjct: 14258205 gacgagggcggcgatggtggcgccg 14258229
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 69.9 bits (35), Expect = 1e-08 Identities = 104/127 (81%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 409 ||||||| |||||| ||||||||||| |||| | ||| || ||| ||| ||||||||| Sbjct: 813 gggccgatccagtagacccagtggtttgtccagtccccggtggccagggccgggccgaag 754 Query: 410 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 469 ||| || |||||||||||||||||| ||| |||||||| ||| ||||||||||| Sbjct: 753 gagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccg 694 Query: 470 acgatga 476 ||||||| Sbjct: 693 acgatga 687
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 69.9 bits (35), Expect = 1e-08 Identities = 38/39 (97%) Strand = Plus / Minus Query: 457 gatgttggcgccgacgatgaagccgatggcgatgggcgc 495 |||||||||||||||||||||||||||||| |||||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgc 283
>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water channel AT3G26520 (TIP2) mRNA, complete cds Length = 1201 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 600 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 554
>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 762 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 488 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 442
>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1061 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 550 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 504
>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1066 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 555 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 509
>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic protein mRNA, complete cds Length = 1072 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 562 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 516
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 63.9 bits (32), Expect = 6e-07 Identities = 65/76 (85%) Strand = Plus / Minus Query: 398 gcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccagg 457 ||||||||||||||| ||||||||||||||||||||| |||| |||||||| || Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649 Query: 458 atgttggcgccgacga 473 | |||||||||||||| Sbjct: 648 acgttggcgccgacga 633
>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1010 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 538 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 492
>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1020 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 536 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 490
>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 536 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 490
>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1054 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 527 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 481
>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 545 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 499
>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 359 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 313
>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1012 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 536 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 490
>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16 Length = 82646 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Plus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 15638 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 15684
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 63.9 bits (32), Expect = 6e-07 Identities = 135/168 (80%), Gaps = 1/168 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || || Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498 Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 497 gtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 451
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcat 426 |||||||||| |||||||||||||||||| |||||||||||| Sbjct: 628 cgccgctgacgacggcggggccgaaggagcgggcggggttcat 586
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 61.9 bits (31), Expect = 2e-06 Identities = 40/43 (93%) Strand = Plus / Minus Query: 384 cgccgctgaccacggcggggccgaaggagacggcggggttcat 426 |||||||||| |||||||||||||||||| |||||||||||| Sbjct: 670 cgccgctgacgacggcggggccgaaggagcgggcggggttcat 628
>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA, complete cds Length = 1255 Score = 61.9 bits (31), Expect = 2e-06 Identities = 103/127 (81%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 409 ||||||| |||||| ||||||||||| |||||| ||| || ||| |||||| |||||| Sbjct: 812 gggccgatccagtagacccagtggttggtccagaccccggtggccatggcgggaccgaag 753 Query: 410 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 469 || || |||||||||||||||||| ||| |||||||| ||| ||||||||||| Sbjct: 752 gaccgcgccgggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccg 693 Query: 470 acgatga 476 || |||| Sbjct: 692 actatga 686
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 61.9 bits (31), Expect = 2e-06 Identities = 182/231 (78%), Gaps = 1/231 (0%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 409 ||||||| |||||| ||||||||||| | |||| | ||||| | ||| || ||||| Sbjct: 719 gggccgacccagtagacccagtggttgttccaggtccaactgactagggctggaccgaat 660 Query: 410 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 469 || ||||| ||||||||||| || ||| |||||||| ||| ||| ||||||||| || Sbjct: 659 gacacggccgggttcatggatgcaccggtgaaggctcctccgaccaagatgttggctcca 600 Query: 470 acgatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccaca 529 |||||||| || ||||| || || || || | ||||||| ||| | |||| |||| | Sbjct: 599 acgatgaaaccaatggcaattggggcaatgattccgaggttgcctctcttgtggtcgatg 540 Query: 530 gccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||||||||| ||||| || || ||||||||||| || |||||||| Sbjct: 539 gccgtggcgtacacg-gtgtagaccaggccgaaggtcatcacaatctcgaa 490
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 401 gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 460 |||||||||||| ||| ||||||||||| |||||| ||| |||||||| |||||| Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549 Query: 461 ttggcgccgacgatgaagccga 482 ||||||||||||| || ||||| Sbjct: 548 ttggcgccgacgacgaggccga 527
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 401 gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 460 |||||||||||| ||| ||||||||||| |||||| ||| |||||||| |||||| Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842 Query: 461 ttggcgccgacgatgaagccga 482 ||||||||||||| || ||||| Sbjct: 98841 ttggcgccgacgacgaggccga 98820
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 401 gggccgaaggagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatg 460 |||||||||||| ||| ||||||||||| |||||| ||| |||||||| |||||| Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552 Query: 461 ttggcgccgacgatgaagccga 482 ||||||||||||| || ||||| Sbjct: 551 ttggcgccgacgacgaggccga 530
>ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA Length = 576 Score = 58.0 bits (29), Expect = 4e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 346 gaaggggccgagccagtacacccagtggt 374 ||||||||||||||||||||||||||||| Sbjct: 492 gaaggggccgagccagtacacccagtggt 464
>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1099 Score = 58.0 bits (29), Expect = 4e-05 Identities = 51/57 (89%), Gaps = 1/57 (1%) Strand = Plus / Minus Query: 545 tgtgtacacgagcccgaaggtcatgacgatctcgaacaccaaccgcgttccagacgc 601 |||||||||||| |||||||||||||| |||||||| | ||| ||||||||| |||| Sbjct: 572 tgtgtacacgaggccgaaggtcatgactatctcgaa-aacaaacgcgttccatacgc 517 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctccca 381 |||||||||||||||||||||||| Sbjct: 758 ccagtacacccagtggttctccca 735 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 gcggtggggagctgctcgtg 288 |||||||||||||||||||| Sbjct: 847 gcggtggggagctgctcgtg 828
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 58.0 bits (29), Expect = 4e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 346 gaaggggccgagccagtacacccagtggt 374 ||||||||||||||||||||||||||||| Sbjct: 25641797 gaaggggccgagccagtacacccagtggt 25641825 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 15355781 gcgatggcggcgccgacgaacgggccgacccag 15355749
>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZE09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 573 Score = 58.0 bits (29), Expect = 4e-05 Identities = 135/169 (79%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 ||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || ||| Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124 Query: 473 atgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagcc 532 ||||| || |||||||| || |||||| ||||| ||| ||||||||| || | | Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgggc 64 Query: 533 -gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 63 tgtggcgtagacgggtgtagacgagcccgaaggtcatcacgatctcgaa 15
>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0594D10 Length = 143200 Score = 58.0 bits (29), Expect = 4e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 346 gaaggggccgagccagtacacccagtggt 374 ||||||||||||||||||||||||||||| Sbjct: 95770 gaaggggccgagccagtacacccagtggt 95798
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 58.0 bits (29), Expect = 4e-05 Identities = 54/61 (88%), Gaps = 1/61 (1%) Strand = Plus / Minus Query: 517 cttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatct 576 ||||||||| || || ||||||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 583 cttggggtcaacggcggtggcgtacacg-gtgtagacgaggccgaaggtcatgacgatct 525 Query: 577 c 577 | Sbjct: 524 c 524 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 674 agtagtcggtggtggggagctgctcgtg 647
>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence Length = 1054 Score = 58.0 bits (29), Expect = 4e-05 Identities = 135/169 (79%), Gaps = 1/169 (0%) Strand = Plus / Minus Query: 412 gacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgac 471 |||||| ||||||||||| || ||| || ||||| ||||| |||||||| || || || Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620 Query: 472 gatgaagccgatggcgatgggcgcgattaccccgaggtcgccgcgcttggggtccacagc 531 |||||| || ||||| || || |||||| ||||| ||| ||||||||| || || Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560 Query: 532 cgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaa 580 |||||||| || ||||| ||||||||||||||||| ||||||||||| Sbjct: 559 tgtggcgtaaacg-gtgtagacgagcccgaaggtcatcacgatctcgaa 512
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 58.0 bits (29), Expect = 4e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 457 gatgttggcgccgacgatgaagccgatggcgat 489 |||||||||||||||||| |||||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgat 289
>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA Length = 969 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||| |||||||||||||||||||||| Sbjct: 880 cggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833
>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 931 Score = 56.0 bits (28), Expect = 2e-04 Identities = 56/64 (87%), Gaps = 1/64 (1%) Strand = Plus / Minus Query: 517 cttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatct 576 ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||| Sbjct: 540 cttggggtcaacggctgtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatct 482 Query: 577 cgaa 580 |||| Sbjct: 481 cgaa 478
>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 56.0 bits (28), Expect = 2e-04 Identities = 56/64 (87%), Gaps = 1/64 (1%) Strand = Plus / Minus Query: 517 cttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatct 576 ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||| Sbjct: 544 cttggggtcaacggctgtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatct 486 Query: 577 cgaa 580 |||| Sbjct: 485 cgaa 482
>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 921 Score = 56.0 bits (28), Expect = 2e-04 Identities = 56/64 (87%), Gaps = 1/64 (1%) Strand = Plus / Minus Query: 517 cttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatct 576 ||||||||| || || |||||||| || ||||| ||||||||||||||||| ||||||| Sbjct: 552 cttggggtcaacggctgtggcgtagacg-gtgtagacgagcccgaaggtcatcacgatct 494 Query: 577 cgaa 580 |||| Sbjct: 493 cgaa 490
>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0483F08 Length = 148985 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||| | |||||||| |||||| |||||||||||||||||||||| Sbjct: 125094 cggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 54.0 bits (27), Expect = 6e-04 Identities = 43/47 (91%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcga 579 ||||||||||| ||||||||||||||||| |||||||||| ||||| Sbjct: 506 gtggcgtacacg-gtgtacacgagcccgaacgtcatgacgacctcga 461 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 419 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 478 |||||||||| ||||||||| || | || ||||| |||||||| ||||| ||| ||| Sbjct: 617 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 558 Query: 479 ccgatggcgatgggcgc 495 |||||||||| |||||| Sbjct: 557 ccgatggcgaggggcgc 541
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 54.0 bits (27), Expect = 6e-04 Identities = 43/47 (91%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcga 579 ||||||||||| ||||||||||||||||| |||||||||| ||||| Sbjct: 131216 gtggcgtacacg-gtgtacacgagcccgaacgtcatgacgacctcga 131171 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 419 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 478 |||||||||| ||||||||| || | || ||||| |||||||| ||||| ||| ||| Sbjct: 131327 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 131268 Query: 479 ccgatggcgatgggcgc 495 |||||||||| |||||| Sbjct: 131267 ccgatggcgaggggcgc 131251
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 54.0 bits (27), Expect = 6e-04 Identities = 45/51 (88%) Strand = Plus / Minus Query: 385 gccgctgaccacggcggggccgaaggagacggcggggttcatggacgcgcc 435 ||||||||| ||||| |||||||| ||| ||| ||||||||||||||||| Sbjct: 712 gccgctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662
>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 628 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 546 gtgtacacgagcccgaaggtcatgacgatctcgaa 580 ||||| ||||||||||||||||| ||||||||||| Sbjct: 90 gtgtagacgagcccgaaggtcattacgatctcgaa 56
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 54.0 bits (27), Expect = 6e-04 Identities = 43/47 (91%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcga 579 ||||||||||| ||||||||||||||||| |||||||||| ||||| Sbjct: 572 gtggcgtacacg-gtgtacacgagcccgaacgtcatgacgacctcga 527 Score = 50.1 bits (25), Expect = 0.009 Identities = 64/77 (83%) Strand = Plus / Minus Query: 419 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 478 |||||||||| ||||||||| || | || ||||| |||||||| ||||| ||| ||| Sbjct: 683 gggttcatggccgcgccgtcgaacgggcccccggcgaggatgttcgcgcccgcgaccaag 624 Query: 479 ccgatggcgatgggcgc 495 |||||||||| |||||| Sbjct: 623 ccgatggcgaggggcgc 607
>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2) mRNA, complete cds Length = 1035 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 546 gtgtacacgagcccgaaggtcatgacgatctcgaa 580 ||||| ||||||||||||||||| ||||||||||| Sbjct: 529 gtgtagacgagcccgaaggtcatcacgatctcgaa 495
>gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) mRNA, complete cds Length = 1064 Score = 54.0 bits (27), Expect = 6e-04 Identities = 114/143 (79%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 409 |||||||||||||| ||||||||| | ||||| | |||||| || || ||||| || Sbjct: 763 gggccgagccagtagacccagtggctgtcccatgtccagctgacgacagcagggccaaaa 704 Query: 410 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 469 || ||||| ||||||||||| || || || || || || ||||| | ||||||||| || Sbjct: 703 gacacggctgggttcatggatgcaccatcgaatgcgccaccggctaagatgttggcacca 644 Query: 470 acgatgaagccgatggcgatggg 492 || |||||||| ||||| ||||| Sbjct: 643 acaatgaagccaatggcaatggg 621
>gb|AF488413.1| Oryza sativa chromosome 6 BAC 134P10, complete sequence Length = 136866 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 337 ggcgccggcgaaggggccgagccagtacacccagtggt 374 ||||||| ||||||||||||| ||||||||||||||| Sbjct: 82946 ggcgccgatgaaggggccgagctagtacacccagtggt 82909
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 545 tgtgtacacgagcccgaaggtcatgacgatctcgaacaccaa 586 |||||| || |||||||||||||| ||||||||||| ||||| Sbjct: 510 tgtgtaaactagcccgaaggtcatcacgatctcgaaaaccaa 469 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 258 ttcagtactcggcggtggggagctgctcgtg 288 ||||||| ||||||||||||||||| ||||| Sbjct: 793 ttcagtagtcggcggtggggagctgttcgtg 763
>dbj|AP002542.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0679C08 Length = 156266 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 337 ggcgccggcgaaggggccgagccagtacacccagtggt 374 ||||||| ||||||||||||| ||||||||||||||| Sbjct: 87879 ggcgccgatgaaggggccgagctagtacacccagtggt 87842
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 52.0 bits (26), Expect = 0.002 Identities = 60/70 (85%), Gaps = 1/70 (1%) Strand = Plus / Minus Query: 517 cttggggtccacagccgtggcgtacacttgtgtacacgagcccgaaggtcatgacgatct 576 ||||||||| || || |||||||| ||| |||||||| | ||||||||||| ||||||| Sbjct: 606 cttggggtcaacggcagtggcgtagact-gtgtacaccaaaccgaaggtcatcacgatct 548 Query: 577 cgaacaccaa 586 | |||||||| Sbjct: 547 ccaacaccaa 538
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 457 gatgttggcgccgacgatgaagccgatggc 486 |||||||||||||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 457 gatgttggcgccgacgatgaagccgatggc 486 |||||||||||||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic protein Length = 1168 Score = 50.1 bits (25), Expect = 0.009 Identities = 55/65 (84%) Strand = Plus / Minus Query: 419 gggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacgatgaag 478 ||||||||||| || ||||| ||||| ||||||||||| || ||||| || || ||||| Sbjct: 708 gggttcatggaagccccgtcgaaggcaccgccggccagaatattggcacccactatgaaa 649 Query: 479 ccgat 483 ||||| Sbjct: 648 ccgat 644
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 450 cggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||||| |||||||||||| ||||||||||| || || ||||| ||||| Sbjct: 639 cggccaagatgttggcgcccacgatgaagccaatagcaatgggagcgat 591
>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA, partial cds Length = 408 Score = 50.1 bits (25), Expect = 0.009 Identities = 49/57 (85%) Strand = Plus / Minus Query: 388 gctgaccacggcggggccgaaggagacggcggggttcatggacgcgccgtcaaaggc 444 |||||| || ||||| ||||||||||| || ||||||||||| || || |||||||| Sbjct: 390 gctgacgacagcgggtccgaaggagactgccgggttcatggatgcaccatcaaaggc 334
>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1062 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 552 acgagcccgaaggtcatgacgatctcgaa 580 ||||||||||||||||| ||||||||||| Sbjct: 518 acgagcccgaaggtcatcacgatctcgaa 490
>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1, complete cds Length = 1067 Score = 50.1 bits (25), Expect = 0.009 Identities = 118/149 (79%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccagacgccgctgaccacggcggggccgaag 409 ||||||| |||||| ||||||||||| |||||| | ||| ||||| || || || || Sbjct: 738 gggccgacccagtagacccagtggttgtcccaggtccagctcaccacagcaggcccaaat 679 Query: 410 gagacggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccg 469 || || || ||||||||||| || || |||||||| || || || || |||||||| || Sbjct: 678 gaaacagccgggttcatggatgccccatcaaaggccccaccagcaagaatgttggctccc 619 Query: 470 acgatgaagccgatggcgatgggcgcgat 498 || ||||| || ||||| ||||| ||||| Sbjct: 618 acaatgaaaccaatggcaatgggagcgat 590 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 261 agtactcggcggtggggagctgctcgtg 288 |||| |||| |||||||||||||||||| Sbjct: 824 agtaatcggtggtggggagctgctcgtg 797
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.009 Identities = 25/25 (100%) Strand = Plus / Minus Query: 464 gcgccgacgatgaagccgatggcga 488 ||||||||||||||||||||||||| Sbjct: 314 gcgccgacgatgaagccgatggcga 290
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 461 ttggcgccgacgatgaagccgatggcgat 489 |||||||||||||| |||||||||||||| Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 48.1 bits (24), Expect = 0.037 Identities = 39/44 (88%) Strand = Plus / Minus Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||| || || ||||||||||||||||| || ||||| Sbjct: 595 aggatgttggcaccaactatgaagccgatggcgattggagcgat 552
>gb|AY626938.1| Sparus aurata aquaporin 1-like mRNA, complete cds Length = 1015 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 356 agccagtacacccagtggttctcc 379 |||||||||||||||||||||||| Sbjct: 646 agccagtacacccagtggttctcc 623
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 48.1 bits (24), Expect = 0.037 Identities = 39/44 (88%) Strand = Plus / Minus Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||| || || ||||||||||||||||| || ||||| Sbjct: 557 aggatgttggcaccaactatgaagccgatggcgattggagcgat 514
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 48.1 bits (24), Expect = 0.037 Identities = 39/44 (88%) Strand = Plus / Minus Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||| || || ||||||||||||||||| || ||||| Sbjct: 585 aggatgttggcaccaactatgaagccgatggcgattggagcgat 542
>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds Length = 175 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 358 ccagtacacccagtggttctccca 381 |||||||||||||||||||||||| Sbjct: 164 ccagtacacccagtggttctccca 141 Score = 46.1 bits (23), Expect = 0.14 Identities = 71/87 (81%) Strand = Plus / Minus Query: 413 acggcggggttcatggacgcgccgtcaaaggctccgccggccaggatgttggcgccgacg 472 |||||||||||||| || || ||||| || || || || |||| | |||||| || || Sbjct: 109 acggcggggttcattgaggctccgtcgaaagcccctcccgccaaaacgttggcacccaca 50 Query: 473 atgaagccgatggcgatgggcgcgatt 499 ||||| ||||||||||| ||||||||| Sbjct: 49 atgaaaccgatggcgattggcgcgatt 23
>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA, complete cds Length = 1045 Score = 48.1 bits (24), Expect = 0.037 Identities = 78/96 (81%) Strand = Plus / Minus Query: 341 ccggcgaaggggccgagccagtacacccagtggttctcccagacgccgctgaccacggcg 400 ||||||| ||||| | ||||||||||||||||| | ||||||||| | | |||||| Sbjct: 770 ccggcgagcgggccaacccagtacacccagtggtgcgtccagacgcccgaggcgacggcg 711 Query: 401 gggccgaaggagacggcggggttcatggacgcgccg 436 || |||||||| ||| ||||||||||| |||||| Sbjct: 710 ggcccgaaggacctggccgggttcatggaggcgccg 675
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 48.1 bits (24), Expect = 0.037 Identities = 39/44 (88%) Strand = Plus / Plus Query: 455 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 ||||||||||| || || ||||||||||||||||| || ||||| Sbjct: 8649 aggatgttggcaccaactatgaagccgatggcgattggagcgat 8692
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 48.1 bits (24), Expect = 0.037 Identities = 33/36 (91%) Strand = Plus / Minus Query: 462 tggcgccgacgatgaagccgatggcgatgggcgcga 497 |||||||||||||||||||| || ||||||| |||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 gcgccgacgatgaagccgatg 484 ||||||||||||||||||||| Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 450 cggccaggatgttggcgccgacgatgaagccgatggcgatggg 492 |||||| ||||||||| || || |||||||||||||| ||||| Sbjct: 599 cggccaagatgttggcaccaacaatgaagccgatggcaatggg 557
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 396 cggcggggccgaaggagacggcg 418 ||||||||||||||||||||||| Sbjct: 8461222 cggcggggccgaaggagacggcg 8461200 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 397 ggcggggccgaaggagacggcg 418 |||||||||||||||||||||| Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 319 gacgagggcggcgatggcggcgccggcg 346 ||||| |||||||||||||||| ||||| Sbjct: 17580352 gacgacggcggcgatggcggcggcggcg 17580379
>gb|AF326504.1|AF326504 Zea mays tonoplast membrane integral protein ZmTIP3-1 mRNA, complete cds Length = 989 Score = 46.1 bits (23), Expect = 0.14 Identities = 35/39 (89%) Strand = Plus / Minus Query: 336 cggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||||| ||| ||||| ||||||||||||||||||| Sbjct: 744 cggcgccgaggaaagggcccagccagtacacccagtggt 706
>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZB01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 676 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 546 gtgtacacgagcccgaaggtcatgacgatctcgaa 580 ||||| |||||||||| |||||| ||||||||||| Sbjct: 145 gtgtagacgagcccgagggtcatcacgatctcgaa 111
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 321 cgagggcggcgatggcggcgccggcga 347 |||| |||||||||||||||||||||| Sbjct: 292613 cgagcgcggcgatggcggcgccggcga 292587
>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds Length = 316 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 450 cggccaggatgttggcgccgacgatgaagccgatggcgatggg 492 |||||| ||||||||| || || |||||||||||||| ||||| Sbjct: 296 cggccaagatgttggcaccaacaatgaagccgatggcaatggg 254
>gb|AY104541.1| Zea mays PCO074685 mRNA sequence Length = 633 Score = 46.1 bits (23), Expect = 0.14 Identities = 35/39 (89%) Strand = Plus / Plus Query: 336 cggcgccggcgaaggggccgagccagtacacccagtggt 374 |||||||| ||| ||||| ||||||||||||||||||| Sbjct: 354 cggcgccgaggaaagggcccagccagtacacccagtggt 392
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 396 cggcggggccgaaggagacggcg 418 ||||||||||||||||||||||| Sbjct: 8461105 cggcggggccgaaggagacggcg 8461083 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 397 ggcggggccgaaggagacggcg 418 |||||||||||||||||||||| Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 319 gacgagggcggcgatggcggcgccggcg 346 ||||| |||||||||||||||| ||||| Sbjct: 17534723 gacgacggcggcgatggcggcggcggcg 17534750
>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 146444 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 396 cggcggggccgaaggagacggcg 418 ||||||||||||||||||||||| Sbjct: 67885 cggcggggccgaaggagacggcg 67863 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 397 ggcggggccgaaggagacggcg 418 |||||||||||||||||||||| Sbjct: 80400 ggcggggccgaaggagacggcg 80379
>gb|DQ237285.1| Panax ginseng tonoplast intrinsic protein (TIP1) mRNA, complete cds Length = 940 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Minus Query: 546 gtgtacacgagcccgaaggtcatgacgatctcgaacac 583 ||||| || ||||| ||||||||||| ||||||||||| Sbjct: 528 gtgtaaaccagcccaaaggtcatgacaatctcgaacac 491
>gb|BT017952.1| Zea mays clone EL01N0522D02.c mRNA sequence Length = 502 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccggcgaagg 350 |||||||| ||||||||||||||||| Sbjct: 156 ggcggcgagggcggcgccggcgaagg 131
>gb|AC136491.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0062E06, complete sequence Length = 158842 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaagggg 352 ||||| |||||||||||||||||||| Sbjct: 105361 cggcggtggcggcgccggcgaagggg 105386
>emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P3 on chromosome 10 Contains a novel gene, the 5' end of the TCF8 gene for transcription factor 8 (represses interleukin 2 expression) (BZP,ZEB,ZEB1,AREB6,ZFHEP,NIL-2A,ZFHX1A,NIL-2-A), a pseudogene similar to part of serine palmitoyltransferase, long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1, SPT1, SPTI) and two CpG islands, complete sequence Length = 187517 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 110 cacacacagtttaccctgaatt 131 |||||||||||||||||||||| Sbjct: 184855 cacacacagtttaccctgaatt 184834
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 44.1 bits (22), Expect = 0.57 Identities = 40/46 (86%) Strand = Plus / Minus Query: 453 ccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||| |||||||| ||||||||||| ||||| || ||||| ||||| Sbjct: 585 ccagaatgttggcaccgacgatgaatccgatcgcaatgggagcgat 540
>emb|BX572595.1| Rhodopseudomonas palustris CGA009 complete genome; segment 3/16 Length = 349260 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 326 gcggcgatggcggcgccggcga 347 |||||||||||||||||||||| Sbjct: 189463 gcggcgatggcggcgccggcga 189484
>emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete genome; segment 4/29 Length = 298450 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 319 gacgagggcggcgatggcggcgccggcgaa 348 |||||||||||||| ||||||| ||||||| Sbjct: 98340 gacgagggcggcgacggcggcgacggcgaa 98369 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 324 gggcggcgatggcggcgccggcga 347 |||||||||||||||| ||||||| Sbjct: 26201 gggcggcgatggcggcaccggcga 26224
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 558 ccgaaggtcatgacgatctcgaacac 583 ||||||||||| |||||||||||||| Sbjct: 537 ccgaaggtcatcacgatctcgaacac 512
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 558 ccgaaggtcatgacgatctcgaacac 583 ||||||||||| |||||||||||||| Sbjct: 225 ccgaaggtcatcacgatctcgaacac 200
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaagggg 352 ||||| |||||||||||||||||||| Sbjct: 17815710 cggcggtggcggcgccggcgaagggg 17815735 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaa 348 |||||||||||||||| ||||||| Sbjct: 11934523 ggcggcgatggcggcggcggcgaa 11934546
>gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete sequence Length = 198084 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 110 cacacacagtttaccctgaatt 131 |||||||||||||||||||||| Sbjct: 67269 cacacacagtttaccctgaatt 67248
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 324 gggcggcgatggcggcgccggc 345 |||||||||||||||||||||| Sbjct: 870643 gggcggcgatggcggcgccggc 870664
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 469 gacgatgaagccgatggcgatgggcg 494 ||||||| |||||||||||||||||| Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139
>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA, partial cds Length = 529 Score = 44.1 bits (22), Expect = 0.57 Identities = 47/54 (87%), Gaps = 1/54 (1%) Strand = Plus / Minus Query: 533 gtggcgtacacttgtgtacacgagcccgaaggtcatgacgatctcgaacaccaa 586 |||||||||||| |||||||| | ||||||||||| ||||| ||||| ||||| Sbjct: 144 gtggcgtacact-gtgtacaccaatccgaaggtcatcacgatttcgaaaaccaa 92
>gb|AY108015.1| Zea mays PCO111497 mRNA sequence Length = 495 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccggcgaagg 350 |||||||| ||||||||||||||||| Sbjct: 150 ggcggcgagggcggcgccggcgaagg 125
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcgaagggg 352 ||||| |||||||||||||||||||| Sbjct: 17910026 cggcggtggcggcgccggcgaagggg 17910051 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaa 348 |||||||||||||||| ||||||| Sbjct: 12012930 ggcggcgatggcggcggcggcgaa 12012953
>ref|XM_550009.1| Oryza sativa (japonica cultivar-group), mRNA Length = 523 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 588 cgcgttccagacgccgacgccggcg 612 |||||||||| |||||||||||||| Sbjct: 187 cgcgttccaggcgccgacgccggcg 211
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 596 agacgccgacgccggcggaga 616 ||||||||||||||||||||| Sbjct: 3421687 agacgccgacgccggcggaga 3421707
>ref|NM_196526.1| Oryza sativa (japonica cultivar-group) putative submergence induced protein 2 (OSJNBa0006I13.13), mRNA Length = 1155 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 319 gacgagggcggcgatggcggcgccg 343 ||||||||||||||||| ||||||| Sbjct: 666 gacgagggcggcgatggtggcgccg 642
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 907 gcgatggcggcgccgacgaacgggccgacccag 875
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 909 gcgatggcggcgccgacgaacgggccgacccag 877
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 910 gcgatggcggcgccgacgaacgggccgacccag 878
>ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA Length = 843 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggcggcgccggcgaaggggcc 354 ||||||||||||||||||||| Sbjct: 756 ggcggcgccggcgaaggggcc 736
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 289 cgggcgctggccgatgaagcagatg 313 |||||||| |||||||||||||||| Sbjct: 2468789 cgggcgctcgccgatgaagcagatg 2468813
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 457 gatgttggcgccgacgatgaagccg 481 ||||||| ||||||||||||||||| Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 289 cgggcgctggccgatgaagcagatg 313 |||||||| |||||||||||||||| Sbjct: 3717221 cgggcgctcgccgatgaagcagatg 3717197
>gb|BT012976.1| Lycopersicon esculentum clone 114187R, mRNA sequence Length = 972 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 350 gggccgagccagtacacccagtggttctcccag 382 ||||||||||| || ||||||||||| |||||| Sbjct: 719 gggccgagccaatagacccagtggttgtcccag 687
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 447 cgccggccaggatgttggcgc 467 ||||||||||||||||||||| Sbjct: 926947 cgccggccaggatgttggcgc 926927 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 2915284 ggcggcgatggcggcgccgg 2915265 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 1997572 ggcggcgatggcggcgccgg 1997591
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 397 ggcggggccgaaggagacggcggggttcatgga 429 |||||||||||||||| ||| ||||||||||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 397 ggcggggccgaaggagacggcggggttcatgga 429 |||||||||||||||| ||| ||||||||||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541
>gb|AC124174.4| Mus musculus BAC clone RP23-181O22 from chromosome 3, complete sequence Length = 197553 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 acacccagtggttctcccaga 383 ||||||||||||||||||||| Sbjct: 157776 acacccagtggttctcccaga 157796
>gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genomic sequence, complete sequence Length = 164179 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggcggcgccggcgaaggggcc 354 ||||||||||||||||||||| Sbjct: 119111 ggcggcgccggcgaaggggcc 119091
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 457 gatgttggcgccgacgatgaagccg 481 ||||| ||||||||||||||||||| Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 457 gatgttggcgccgacgatgaagccg 481 ||||| ||||||||||||||||||| Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 289 cgggcgctggccgatgaagcagatg 313 |||||||| |||||||||||||||| Sbjct: 3457527 cgggcgctcgccgatgaagcagatg 3457503
>dbj|AK147805.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270047M03 product:similar to Putative RNA methyltransferase [Homo sapiens], full insert sequence Length = 1417 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 331 gatggcggcgccggcgaaggg 351 ||||||||||||||||||||| Sbjct: 18 gatggcggcgccggcgaaggg 38
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome Length = 3544738 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 gcatggatgatcagaagagat 244 ||||||||||||||||||||| Sbjct: 1664674 gcatggatgatcagaagagat 1664654
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 473 gcgatggcggcgccgacgaacgggccgacccag 441
>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome 10, complete sequence Length = 142737 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 319 gacgagggcggcgatggcggcgccg 343 ||||||||||||||||| ||||||| Sbjct: 122036 gacgagggcggcgatggtggcgccg 122060
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 62780 gcgatggcggcgccgacgaacgggccgacccag 62748
>dbj|AP002526.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0504H10 Length = 143515 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 588 cgcgttccagacgccgacgccggcg 612 |||||||||| |||||||||||||| Sbjct: 12154 cgcgttccaggcgccgacgccggcg 12130
>dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0089K24 Length = 154137 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 200 ttctcaatctctcatggcgat 220 ||||||||||||||||||||| Sbjct: 83981 ttctcaatctctcatggcgat 83961 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 323 agggcggcgatggcggcgccggcg 346 |||||||||||||||||| ||||| Sbjct: 83884 agggcggcgatggcggcggcggcg 83861
>dbj|AP002538.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0408F06 Length = 137462 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 588 cgcgttccagacgccgacgccggcg 612 |||||||||| |||||||||||||| Sbjct: 107042 cgcgttccaggcgccgacgccggcg 107018
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 907 gcgatggcggcgccgacgaacgggccgacccag 875
>ref|XM_314890.2| Anopheles gambiae str. PEST ENSANGP00000012326 (ENSANGG00000009837), partial mRNA Length = 1641 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 353 ccgagccagtacacccagtggttctccca 381 |||| |||||||||||||||||| ||||| Sbjct: 752 ccgacccagtacacccagtggttgtccca 724
>dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-154-B04, full insert sequence Length = 1099 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 ggcggcgccggcgaaggggcc 354 ||||||||||||||||||||| Sbjct: 844 ggcggcgccggcgaaggggcc 824
>dbj|AK107910.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-G05, full insert sequence Length = 523 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 588 cgcgttccagacgccgacgccggcg 612 |||||||||| |||||||||||||| Sbjct: 187 cgcgttccaggcgccgacgccggcg 211
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 501 gcgatggcggcgccgacgaacgggccgacccag 469
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 907 gcgatggcggcgccgacgaacgggccgacccag 875
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 909 gcgatggcggcgccgacgaacgggccgacccag 877
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 910 gcgatggcggcgccgacgaacgggccgacccag 878
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 329 gcgatggcggcgccggcgaaggggccgagccag 361 ||||||||||||||| |||| ||||||| |||| Sbjct: 897 gcgatggcggcgccgacgaacgggccgacccag 865
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggc 345 ||||||||||||||||||||| Sbjct: 3194246 ggcggcgatggcggcgccggc 3194266
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence Length = 3809201 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 289 cgggcgctggccgatgaagcagatg 313 |||||||| |||||||||||||||| Sbjct: 1405319 cgggcgctcgccgatgaagcagatg 1405343
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 42.1 bits (21), Expect = 2.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 450 cggccaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 498 |||| ||||||||||| |||||||||| || ||||||| ||| ||||| Sbjct: 603 cggctaggatgttggcaccgacgatgagaccaatggcgaggggagcgat 555
>ref|XM_550294.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1011 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 323 agggcggcgatggcggcgccggcg 346 |||||||||||||||||| ||||| Sbjct: 959 agggcggcgatggcggcggcggcg 982
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 tgtcgtagacgagggcggcg 331 |||||||||||||||||||| Sbjct: 1078647 tgtcgtagacgagggcggcg 1078628
>ref|XM_480022.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1572 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 1356 ggcggcgatggcggcgccgg 1337
>ref|XM_469996.1| Oryza sativa (japonica cultivar-group), mRNA Length = 588 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||| | ||||||||||| Sbjct: 48 ggcggcgatggcgggggcggcgaagggg 75
>ref|XM_450702.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1563 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 1479 cggcgatggcggcgccggcg 1498
>gb|AC168309.2| Mus musculus chromosome 1, clone wi1-2866I16, complete sequence Length = 40737 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 175 gatgacacgatgacacttgcttgatttc 202 ||||||| ||||||| |||||||||||| Sbjct: 2691 gatgacatgatgacaattgcttgatttc 2664
>gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0046A04, complete sequence Length = 141001 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaa 348 |||||||||||||||| ||||||| Sbjct: 136250 ggcggcgatggcggcggcggcgaa 136273
>gb|DQ195081.1| Oryza sativa (indica cultivar-group) putative leucine-rich repeat receptor-like kinase gene cluster, complete sequence; ternary complex factor MIP1-like gene, complete cds; putative membrane-associated protein and gag-pol precursor, pseudogenes, complete sequence; and unknown genes Length = 94077 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgagggcggcgatggcggcg 340 |||||||||||||||||||| Sbjct: 48532 cgagggcggcgatggcggcg 48551
>gb|AC103551.7| Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete sequence Length = 137709 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||||| |||||| |||| Sbjct: 88824 ggcggcgatggcggcggcggcgaggggg 88851
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 3793448 cggcgatggcggcgccggcg 3793467 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 1489653 cggcgatggcggcgccggcg 1489634 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 625314 cggcgatggcggcgccggcg 625333
>ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (MG08844.4) partial cds Length = 702 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 323 agggcggcgatggcggcgccggcgaagg 350 ||||||||||||||| ||| |||||||| Sbjct: 59 agggcggcgatggcgccgcgggcgaagg 86
>gb|AY657998.1| Synthetic construct Peudomonas aeruginosa clone FLH046392.01F PA3436 gene, partial cds Length = 558 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 625 gcgcccacggcctcgccgcc 644 |||||||||||||||||||| Sbjct: 278 gcgcccacggcctcgccgcc 297
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 458 atgttggcgccgacgatgaagccgatgg 485 |||| |||||||| |||||||||||||| Sbjct: 3114875 atgtaggcgccgaagatgaagccgatgg 3114848
>gb|AC145376.3| Pan troglodytes BAC clone RP43-59A12 from 7, complete sequence Length = 221727 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 gatgacacgatgacacttgc 194 |||||||||||||||||||| Sbjct: 108005 gatgacacgatgacacttgc 107986
>ref|XM_656638.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4126.2), mRNA Length = 1515 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 691 cggcgatggcggcgccggcg 672
>gb|AY756174.4| Oryza rufipogon putative leucine-rich repeat receptor-like kinases and ternary complex factor MIP1-like genes, complete cds; retrotransposon putative membrane-associated protein and gag-pol precursor, pseudogenes, complete sequence; and unknown genes Length = 102522 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 cgagggcggcgatggcggcg 340 |||||||||||||||||||| Sbjct: 56943 cgagggcggcgatggcggcg 56962
>gb|AC102374.7| Mus musculus chromosome 1, clone RP23-278G2, complete sequence Length = 170448 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 175 gatgacacgatgacacttgcttgatttc 202 ||||||| ||||||| |||||||||||| Sbjct: 25899 gatgacatgatgacaattgcttgatttc 25926
>gb|AC135563.5| Oryza sativa chromosome 3 BAC OSJNBb0015I02 genomic sequence, complete sequence Length = 122815 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 |||||||||||||| | ||||||||||| Sbjct: 16418 ggcggcgatggcgggggcggcgaagggg 16445
>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551), mRNA Length = 1556 Score = 40.1 bits (20), Expect = 8.9 Identities = 35/40 (87%) Strand = Plus / Minus Query: 390 tgaccacggcggggccgaaggagacggcggggttcatgga 429 ||||||| ||||||||||| ||| ||| ||||||||||| Sbjct: 802 tgaccactgcggggccgaaagagcgggccgggttcatgga 763
>ref|XM_386515.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06339.1) partial mRNA Length = 1497 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 gcatggatgatcagaagaga 243 |||||||||||||||||||| Sbjct: 773 gcatggatgatcagaagaga 792
>emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete chromosome; segment 8/12 Length = 294800 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 478 gccgatggcgatgggcgcga 497 |||||||||||||||||||| Sbjct: 252331 gccgatggcgatgggcgcga 252350
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 gggcggcgatggcggcgccg 343 |||||||||||||||||||| Sbjct: 734071 gggcggcgatggcggcgccg 734052
>emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chromosome 1 Contains a ribosomal protein S15 (RPS15) pseudogene, three novel genes (LOC388753), the 3' end of the TARBP1 gene for TAR (HIV) RNA binding protein 1 and a CpG island, complete sequence Length = 92628 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 86 acaagagattattcctgactgact 109 ||||||| |||||||||||||||| Sbjct: 68131 acaagagcttattcctgactgact 68108
>gb|AC090498.4| Homo sapiens chromosome 7 clone RP11-84E17, complete sequence Length = 188036 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 gatgacacgatgacacttgc 194 |||||||||||||||||||| Sbjct: 67930 gatgacacgatgacacttgc 67911
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 321 cgagggcggcgatggcggcgccgg 344 |||| ||||||||||||||||||| Sbjct: 446204 cgagcgcggcgatggcggcgccgg 446227
>gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 109471 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 172 actgatgacacgatgacact 191 |||||||||||||||||||| Sbjct: 67496 actgatgacacgatgacact 67515
>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii Length = 2037969 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 226 atggatgatcagaagagatt 245 |||||||||||||||||||| Sbjct: 1044394 atggatgatcagaagagatt 1044413
>emb|BX842582.1| Mycobacterium tuberculosis H37Rv complete genome; segment 11/13 Length = 349563 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 334910 cggcgatggcggcgccggcg 334929
>emb|BX842576.1| Mycobacterium tuberculosis H37Rv complete genome; segment 5/13 Length = 348264 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 105396 cggcgatggcggcgccggcg 105377
>emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome; segment 2/13 Length = 342416 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 281956 cggcgatggcggcgccggcg 281975
>emb|BX572608.1| Rhodopseudomonas palustris CGA009 complete genome; segment 16/16 Length = 227214 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 446 ccgccggccaggatgttggc 465 |||||||||||||||||||| Sbjct: 85688 ccgccggccaggatgttggc 85707
>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14 Length = 316050 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 3841 cggcgatggcggcgccggcg 3860
>emb|BX248335.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 2/14 Length = 324050 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 282106 cggcgatggcggcgccggcg 282125
>emb|BX248338.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 5/14 Length = 299450 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 171874 cggcgatggcggcgccggcg 171855
>emb|AL954726.31| Zebrafish DNA sequence from clone CH211-274A9 in linkage group 23, complete sequence Length = 164507 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 tttgtacaaacattaatctt 42 |||||||||||||||||||| Sbjct: 115044 tttgtacaaacattaatctt 115063
>gb|AC010068.8| Drosophila melanogaster 3L BAC RP98-15K24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178607 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 cgatggcggcgccggcgaag 349 |||||||||||||||||||| Sbjct: 152620 cgatggcggcgccggcgaag 152601
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 453 ccaggatgttggcgccgacg 472 |||||||||||||||||||| Sbjct: 4466178 ccaggatgttggcgccgacg 4466159
>gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167026 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 cgatggcggcgccggcgaag 349 |||||||||||||||||||| Sbjct: 1301 cgatggcggcgccggcgaag 1282
>gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of the complete genome Length = 11136 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 465 cgccgacgatgaagccgatg 484 |||||||||||||||||||| Sbjct: 8892 cgccgacgatgaagccgatg 8873
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 cgagggcggcgatggcggcg 340 |||||||||||||||||||| Sbjct: 2205798 cgagggcggcgatggcggcg 2205779
>ref|NM_141113.2| Drosophila melanogaster CG7442-RA (CG7442), mRNA Length = 2085 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 330 cgatggcggcgccggcgaag 349 |||||||||||||||||||| Sbjct: 1815 cgatggcggcgccggcgaag 1796
>gb|AY027524.1| Frankia sp. CpI1 plasmid pFQ12, complete plasmid sequence Length = 22437 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 8376 cggcgatggcggcgccggcg 8357
>gb|AC160030.4| Mus musculus 10 BAC RP24-311K18 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 162351 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 2 attgctaggacagacagcag 21 |||||||||||||||||||| Sbjct: 21479 attgctaggacagacagcag 21460
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 cggcgatggcggcgccggcg 346 |||||||||||||||||||| Sbjct: 12313580 cggcgatggcggcgccggcg 12313599
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 2262773 ggcggcgatggcggcgccgg 2262792
>gb|AY899214.1| Streptomyces aizunensis strain NRRL B-11277 glycosyltransferase, polyketide synthase type Is, acyl transferase, membrane protein, ABC transporter, sugar dehydratase/epimerase, sugar epimerase, sugar nucleotidyltransferase, sugar dehydratase/epimerase, thioesterase, acyl CoA ligase, amine oxidase, phosphopantetheinyl transferase, transcriptional regulator, carboxylase/carboxyltransferase, amidinohydrolase, amide synthetase, 5-aminolevulinate synthase, and acyl CoA ligase genes, complete cds; and unknown gene Length = 161719 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 626 cgcccacggcctcgccgcca 645 |||||||||||||||||||| Sbjct: 114936 cgcccacggcctcgccgcca 114955
>gb|BC093081.1| Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 42, transcript variant 1, mRNA (cDNA clone MGC:111493 IMAGE:30407786), complete cds Length = 3990 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccggcgaagggg 352 ||||||| |||||||| ||||||||||| Sbjct: 14 ggcggcggtggcggcggcggcgaagggg 41
>gb|AE004764.1| Pseudomonas aeruginosa PAO1, section 325 of 529 of the complete genome Length = 10425 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 625 gcgcccacggcctcgccgcc 644 |||||||||||||||||||| Sbjct: 8285 gcgcccacggcctcgccgcc 8304
>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane protein 1 mRNA, complete cds Length = 1162 Score = 40.1 bits (20), Expect = 8.9 Identities = 38/44 (86%) Strand = Plus / Minus Query: 395 acggcggggccgaaggagacggcggggttcatggacgcgccgtc 438 ||||| || ||||| || ||||||||||||||||| || ||||| Sbjct: 679 acggctggtccgaatgacacggcggggttcatggatgctccgtc 636
>dbj|AP004797.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0547F09 Length = 140615 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 110653 ggcggcgatggcggcgccgg 110672 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggcggcgatggcggcgccgg 344 |||||||||||||||||||| Sbjct: 67930 ggcggcgatggcggcgccgg 67911
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 462 tggcgccgacgatgaagccg 481 |||||||||||||||||||| Sbjct: 4875529 tggcgccgacgatgaagccg 4875548
>dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0460H04 Length = 166490 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 466 gccgacgatgaagccgatggcgat 489 ||||| |||||||||||||||||| Sbjct: 107970 gccgaggatgaagccgatggcgat 107947 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,893,271 Number of Sequences: 3902068 Number of extensions: 4893271 Number of successful extensions: 121010 Number of sequences better than 10.0: 265 Number of HSP's better than 10.0 without gapping: 280 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 114453 Number of HSP's gapped (non-prelim): 6481 length of query: 654 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 631 effective length of database: 17,143,297,704 effective search space: 10817420851224 effective search space used: 10817420851224 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
