Clone Name	rbags9e01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full i...	607	e-170
2	emb|X00043.1|TAHI01 Wheat histone H4 gene	567	e-158
3	gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome...	525	e-146
4	gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome...	525	e-146
5	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	525	e-146
6	dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clon...	525	e-146
7	ref|XM_475383.1| Oryza sativa (japonica cultivar-group), predic...	519	e-144
8	gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome...	517	e-143
9	gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome...	517	e-143
10	dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clon...	517	e-143
11	ref|XM_475394.1| Oryza sativa (japonica cultivar-group), predic...	511	e-142
12	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	507	e-140
13	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	507	e-140
14	gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome...	507	e-140
15	dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clon...	507	e-140
16	emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4	505	e-140
17	ref|XM_473659.1| Oryza sativa (japonica cultivar-group), predic...	492	e-136
18	emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4,...	492	e-136
19	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	492	e-136
20	dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clon...	492	e-136
21	ref|NM_187563.1| Oryza sativa (japonica cultivar-group), predic...	488	e-134
22	gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence	488	e-134
23	ref|XM_467181.1| Oryza sativa (japonica cultivar-group), mRNA	480	e-132
24	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	480	e-132
25	dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic D...	480	e-132
26	dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic D...	480	e-132
27	gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), c...	480	e-132
28	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	478	e-131
29	dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic D...	478	e-131
30	dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clon...	478	e-131
31	gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds	474	e-130
32	ref|NM_190485.1| Oryza sativa (japonica cultivar-group), predic...	472	e-130
33	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	472	e-130
34	dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic D...	472	e-130
35	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	470	e-129
36	dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic D...	470	e-129
37	dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clon...	470	e-129
38	ref|NM_185758.1| Oryza sativa (japonica cultivar-group), mRNA	468	e-128
39	gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome...	464	e-127
40	dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic D...	464	e-127
41	ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone ...	458	e-125
42	gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 geno...	458	e-125
43	gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 geno...	458	e-125
44	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	458	e-125
45	dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clon...	458	e-125
46	dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clon...	458	e-125
47	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	458	e-125
48	emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene	442	e-121
49	gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence	434	e-118
50	gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), com...	420	e-114
51	gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds	420	e-114
52	gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H...	410	e-111
53	ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC4...	410	e-111
54	ref|NM_001037843.1| Gallus gallus similar to germinal histone H4...	410	e-111
55	gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds	410	e-111
56	ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal hi...	404	e-109
57	ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi...	404	e-109
58	emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4...	404	e-109
59	ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal hi...	402	e-109
60	gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds	402	e-109
61	ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal...	400	e-108
62	ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal...	400	e-108
63	ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal...	400	e-108
64	ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal...	400	e-108
65	emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes	398	e-108
66	ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal...	396	e-107
67	ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro...	394	e-106
68	ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal...	394	e-106
69	ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal...	391	e-105
70	gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 ...	389	e-105
71	gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complet...	389	e-105
72	ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal...	385	e-103
73	ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal...	379	e-102
74	ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal...	377	e-101
75	gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence	367	3e-98
76	gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8	365	1e-97
77	gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence	359	7e-96
78	gb|AY105603.1| Zea mays PCO094685 mRNA sequence	359	7e-96
79	gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I...	357	3e-95
80	ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal...	353	4e-94
81	gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds	353	4e-94
82	emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his...	349	7e-93
83	emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr...	349	7e-93
84	gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist...	349	7e-93
85	gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, compl...	349	7e-93
86	gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I...	349	7e-93
87	gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I...	349	7e-93
88	ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA	347	3e-92
89	gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo...	341	2e-90
90	ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA	337	3e-89
91	gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA...	337	3e-89
92	gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA...	337	3e-89
93	gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co...	337	3e-89
94	emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr...	337	3e-89
95	gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC...	337	3e-89
96	dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKE...	337	3e-89
97	gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, compl...	337	3e-89
98	ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA	335	1e-88
99	dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-...	335	1e-88
100	gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, compl...	335	1e-88
101	emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr...	333	4e-88
102	emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr...	333	4e-88
103	dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length...	333	4e-88
104	gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	333	4e-88
105	gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, compl...	333	4e-88
106	gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, compl...	333	4e-88
107	ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA	333	4e-88
108	ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA	331	2e-87
109	gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, c...	327	2e-86
110	ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA	325	1e-85
111	gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, compl...	325	1e-85
112	gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, compl...	325	1e-85
113	emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA	321	1e-84
114	emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA	321	1e-84
115	ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA	319	6e-84
116	dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-...	317	2e-83
117	gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, compl...	317	2e-83
118	ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA	315	9e-83
119	gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408	313	4e-82
120	ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@...	313	4e-82
121	gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, comp...	313	4e-82
122	gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, comp...	313	4e-82
123	emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A...	313	4e-82
124	emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone	313	4e-82
125	emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone	313	4e-82
126	emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12)	313	4e-82
127	gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, ...	313	4e-82
128	gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA cl...	313	4e-82
129	ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA	311	1e-81
130	ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA	311	1e-81
131	dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-1932...	311	1e-81
132	ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (p...	309	6e-81
133	gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	307	2e-80
134	gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, comp...	307	2e-80
135	gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	307	2e-80
136	gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	307	2e-80
137	emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 o...	307	2e-80
138	emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblas...	307	2e-80
139	gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	307	2e-80
140	ref|NG_000827.2| Homo sapiens genomic histone family microcluste...	307	2e-80
141	ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA	307	2e-80
142	emb|X13236.1|MMHIS453 Mouse histone H4 gene	307	2e-80
143	dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds	307	2e-80
144	gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC...	303	3e-79
145	emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA	303	3e-79
146	emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom...	303	3e-79
147	gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC...	303	3e-79
148	ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA	303	3e-79
149	gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, compl...	303	3e-79
150	gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:818...	299	5e-78
151	gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC...	299	5e-78
152	ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H...	297	2e-77
153	ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histo...	297	2e-77
154	ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal his...	297	2e-77
155	gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple...	297	2e-77
156	gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, comple...	297	2e-77
157	gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	297	2e-77
158	ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA	297	2e-77
159	ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA	295	9e-77
160	gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	295	9e-77
161	gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds	295	9e-77
162	dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIK...	295	9e-77
163	gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, compl...	295	9e-77
164	gb|AY389612.1| Hyacinthus orientalis unknown mRNA	289	5e-75
165	ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histo...	289	5e-75
166	gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA ...	289	5e-75
167	ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (His...	289	5e-75
168	gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA,...	289	5e-75
169	gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence	287	2e-74
170	dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA...	283	3e-73
171	emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4....	272	1e-69
172	emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA	272	1e-69
173	gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMA...	272	1e-69
174	emb|BX061454.1|CNS09JKY Single read from an extremity of a full-...	272	1e-69
175	emb|BX057867.1|CNS09GTB Single read from an extremity of a full-...	272	1e-69
176	emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-...	272	1e-69
177	emb|BX048034.1|CNS09986 Single read from an extremity of a full-...	272	1e-69
178	emb|BX037780.1|CNS091BC Single read from an extremity of a full-...	272	1e-69
179	emb|BX037779.1|CNS091BB Single read from an extremity of a full-...	272	1e-69
180	emb|BX020583.1|CNS08O1N Single read from an extremity of a full-...	272	1e-69
181	emb|BX009114.1|CNS08F72 Single read from an extremity of a full-...	272	1e-69
182	emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4	272	1e-69
183	ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA	272	1e-69
184	gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, comple...	272	1e-69
185	ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125 ...	272	1e-69
186	gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp...	272	1e-69
187	gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple...	272	1e-69
188	gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAG...	272	1e-69
189	ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (pr...	266	8e-68
190	emb|BX039313.1|CNS092HX Single read from an extremity of a full-...	264	3e-67
191	emb|BX032921.1|CNS08XKD Single read from an extremity of a full-...	264	3e-67
192	ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626 ...	264	3e-67
193	emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-...	262	1e-66
194	emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-...	262	1e-66
195	emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes	260	5e-66
196	gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	260	5e-66
197	ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA	260	5e-66
198	emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes ...	258	2e-65
199	emb|BX052400.1|CNS09CLG Single read from an extremity of a full-...	258	2e-65
200	emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-...	256	7e-65
201	emb|BX053099.1|CNS09D4V Single read from an extremity of a full-...	256	7e-65
202	emb|BX047092.1|CNS098I0 Single read from an extremity of a full-...	256	7e-65
203	emb|BX043671.1|CNS095UZ Single read from an extremity of a full-...	256	7e-65
204	emb|BX036322.1|CNS0906U Single read from an extremity of a full-...	256	7e-65
205	emb|BX054530.1|CNS09E8M Single read from an extremity of a full-...	254	3e-64
206	emb|BX047203.1|CNS098L3 Single read from an extremity of a full-...	252	1e-63
207	emb|BX053377.1|CNS09DCL Single read from an extremity of a full-...	250	5e-63
208	emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-...	250	5e-63
209	emb|X00091.1|HSHISH4 Human histone H4 gene	250	5e-63
210	emb|BX061455.1|CNS09JKZ Single read from an extremity of a full-...	248	2e-62
211	emb|BX041120.1|CNS093W4 Single read from an extremity of a full-...	246	7e-62
212	gb|AY104535.1| Zea mays PCO094675 mRNA sequence	246	7e-62
213	gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete...	244	3e-61
214	gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histon...	244	3e-61
215	ref|NG_001335.1| Homo sapiens genomic large histone family clust...	240	4e-60
216	ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA	240	4e-60
217	gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, comp...	240	4e-60
218	gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h...	240	4e-60
219	gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	240	4e-60
220	gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	240	4e-60
221	gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	240	4e-60
222	gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC...	240	4e-60
223	ref|XM_595302.1| PREDICTED: Bos taurus similar to germinal histo...	238	2e-59
224	ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal...	238	2e-59
225	gb|DQ066258.1| Ixodes scapularis isolate ISN-L-157 hist1h4i prot...	238	2e-59
226	emb|CR542172.1| Homo sapiens full open reading frame cDNA clone ...	236	7e-59
227	ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (pre...	236	7e-59
228	gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140	234	3e-58
229	ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal ...	234	3e-58
230	ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA	234	3e-58
231	ref|XM_513765.1| PREDICTED: Pan troglodytes LOC457262 (LOC457262...	234	3e-58
232	gb|AC150544.3| Bos taurus BAC CH240-75C8 (Children's Hospital O...	234	3e-58
233	ref|NM_001034077.3| Homo sapiens histone H4/o (H4/o), mRNA	234	3e-58
234	gb|AF525682.1| Homo sapiens histone H4 (HIST2H4) gene, complete cds	234	3e-58
235	gb|BC112193.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1...	234	3e-58
236	emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch...	234	3e-58
237	emb|BX047204.1|CNS098L4 Single read from an extremity of a full-...	234	3e-58
238	ref|XM_942850.1| PREDICTED: Homo sapiens similar to germinal his...	234	3e-58
239	ref|XM_942844.1| PREDICTED: Homo sapiens similar to germinal his...	234	3e-58
240	ref|XM_942841.1| PREDICTED: Homo sapiens similar to germinal his...	234	3e-58
241	ref|XM_936503.1| PREDICTED: Homo sapiens similar to germinal his...	234	3e-58
242	gb|BC093969.1| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:...	234	3e-58
243	gb|BC108260.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:1...	234	3e-58
244	emb|BX061530.1|CNS09JN2 Single read from an extremity of a full-...	232	1e-57
245	emb|BX057868.1|CNS09GTC Single read from an extremity of a full-...	232	1e-57
246	emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone	232	1e-57
247	ref|NM_173880.2| Bos taurus histone H4 (H4), mRNA	232	1e-57
248	ref|XM_315129.2| Anopheles gambiae str. PEST ENSANGP00000015255 ...	232	1e-57
249	gb|AF001288.1|AF001288 Bos taurus histone H4.1 mRNA, complete cds	232	1e-57
250	ref|XM_604220.1| PREDICTED: Bos taurus similar to germinal histo...	230	4e-57
251	gb|AY450353.1| Bos grunniens histone H4.1 mRNA, partial cds	230	4e-57
252	ref|XM_950909.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)...	228	2e-56
253	ref|XM_328072.1| Neurospora crassa OR74A HISTONE H4 (NCU01634.1)...	228	2e-56
254	emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist...	228	2e-56
255	gb|AY890621.1| Synthetic construct Homo sapiens clone FLH141160....	228	2e-56
256	ref|XM_601250.2| PREDICTED: Bos taurus similar to germinal histo...	226	7e-56
257	emb|BX032922.1|CNS08XKE Single read from an extremity of a full-...	224	3e-55
258	dbj|AB197150.1| Fragaria x ananassa mRNA for histone H4, partial...	224	3e-55
259	gb|AY893103.1| Synthetic construct Homo sapiens clone FLH141156....	224	3e-55
260	gb|AY648850.1| Homo sapiens histone H4/o gene, complete cds	222	1e-54
261	ref|XM_602616.1| PREDICTED: Bos taurus similar to germinal histo...	222	1e-54
262	gb|AY128653.1| Homo sapiens clone HIST4H4 histone H4 gene, compl...	222	1e-54
263	gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rose...	222	1e-54
264	ref|NM_175054.2| Homo sapiens histone 4, H4 (HIST4H4), mRNA	222	1e-54
265	gb|BC020884.1| Homo sapiens histone 4, H4, mRNA (cDNA clone MGC:...	222	1e-54
266	emb|BX054531.1|CNS09E8N Single read from an extremity of a full-...	220	4e-54
267	emb|BX055407.1|CNS09EWZ Single read from an extremity of a full-...	216	6e-53
268	ref|XM_307600.2| Anopheles gambiae str. PEST ENSANGP00000016197 ...	216	6e-53
269	ref|NM_001016869.2| Xenopus tropicalis hypothetical protein LOC5...	214	2e-52
270	ref|XM_870205.1| PREDICTED: Bos taurus similar to germinal histo...	214	2e-52
271	emb|CR848633.2| Xenopus tropicalis finished cDNA, clone TGas006m08	214	2e-52
272	emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h...	212	1e-51
273	ref|XM_540284.1| PREDICTED: Canis familiaris similar to germinal...	208	2e-50
274	emb|BX039314.1|CNS092HY Single read from an extremity of a full-...	208	2e-50
275	emb|AJ626748.1| Oikopleura dioica mRNA for histone H4.2	208	2e-50
276	gb|AF007904.1|CVHIST2 Chaetopterus variopedatus histone H4 and h...	208	2e-50
277	gb|M16707.1|HUMHIS4 Human histone H4 gene, complete cds, clone F...	208	2e-50
278	emb|X13554.1|RNH4G Rat H4 gene for somatic histone H4	206	6e-50
279	ref|NM_003546.2| Homo sapiens histone 1, H4l (HIST1H4L), mRNA	204	2e-49
280	gb|AY128665.1| Homo sapiens clone HIST1H4L histone H4 gene, comp...	204	2e-49
281	emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 o...	204	2e-49
282	emb|X83548.1|HSHISTN4 H.sapiens gene for histone H4	204	2e-49
283	gb|BC069392.1| Homo sapiens histone 1, H4l, mRNA (cDNA clone MGC...	204	2e-49
284	ref|XM_605779.2| PREDICTED: Bos taurus similar to germinal histo...	202	1e-48
285	emb|BX057964.1|CNS09GW0 Single read from an extremity of a full-...	202	1e-48
286	ref|XM_527285.1| PREDICTED: Pan troglodytes similar to HIST1H3I ...	200	4e-48
287	dbj|AK133404.1| Mus musculus adult male testis cDNA, RIKEN full-...	200	4e-48
288	gb|J00986.1|XELHIS4L xenopus laevis h4 histone mrna	200	4e-48
289	emb|X00038.1|HSHIH4 Human H4 histone gene	200	4e-48
290	gb|BC078038.1| Xenopus laevis histone 1, H4l, mRNA (cDNA clone M...	198	1e-47
291	ref|XM_597168.2| PREDICTED: Bos taurus similar to germinal histo...	198	1e-47
292	ref|XM_869215.1| PREDICTED: Bos taurus similar to germinal histo...	198	1e-47
293	ref|XM_322297.1| Neurospora crassa OR74A hypothetical protein ( ...	198	1e-47
294	ref|XM_951504.1| Neurospora crassa OR74A hypothetical protein ( ...	198	1e-47
295	ref|XM_595652.2| PREDICTED: Bos taurus similar to germinal histo...	198	1e-47
296	ref|XM_578415.1| PREDICTED: Rattus norvegicus similar to germina...	198	1e-47
297	ref|XM_575704.1| PREDICTED: Rattus norvegicus similar to germina...	198	1e-47
298	emb|X58895.1|UCHISTO U.caupo gene for H2A, H2B, H3, and H4 histones	196	6e-47
299	ref|XM_703205.1| PREDICTED: Danio rerio similar to germinal hist...	196	6e-47
300	ref|NM_214550.1| Strongylocentrotus purpuratus late histone gene...	196	6e-47
301	emb|X06641.1|SPH4L2 Strongylocentrotus purpuratus late histone g...	196	6e-47
302	emb|BX060420.1|CNS09IS8 Single read from an extremity of a full-...	194	2e-46
303	emb|X77806.1|PSHISTH4 P.salina histone H4 gene	194	2e-46
304	emb|Z46226.1|HTHISH4 H.tubulosa gene encoding histone H4	194	2e-46
305	emb|X06639.1|SPH4L1 Strongylocentrotus purpuratus late histone g...	194	2e-46
306	gb|BT015217.1| Drosophila melanogaster RE42129 full insert cDNA	192	9e-46
307	emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A...	192	9e-46
308	emb|AJ626751.1| Oikopleura dioica mRNA for histone H4.5	192	9e-46
309	emb|AJ626750.1| Oikopleura dioica mRNA for histone H4.4	192	9e-46
310	ref|NM_169593.1| Drosophila melanogaster Histone H4 replacement ...	192	9e-46
311	ref|NM_169592.1| Drosophila melanogaster Histone H4 replacement ...	192	9e-46
312	ref|NM_079628.2| Drosophila melanogaster Histone H4 replacement ...	192	9e-46
313	ref|NM_214551.1| Strongylocentrotus purpuratus late histone gene...	192	9e-46
314	gb|BT001842.1| Drosophila melanogaster RH52884 full insert cDNA	192	9e-46
315	emb|X04652.1|MMHISH4S Mouse histone H4 gene 3' region with signa...	192	9e-46
316	gb|J00985.1|XELHIS4B Xenopus borealis h4 histone mRNA	192	9e-46
317	gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene...	192	9e-46
318	ref|XM_865919.1| PREDICTED: Bos taurus similar to germinal histo...	190	4e-45
319	emb|BX036319.1|CNS0906R Single read from an extremity of a full-...	190	4e-45
320	emb|X00224.1|XLHIS4 Xenopus laevis H4 histone gene and flanking ...	190	4e-45
321	emb|X97438.1|DMHISH4 D.melanogaster mRNA for histone H4	190	4e-45
322	emb|BX045468.1|CNS0978W Single read from an extremity of a full-...	188	1e-44
323	ref|XM_681121.1| PREDICTED: Danio rerio similar to germinal hist...	188	1e-44
324	gb|AF297469.1|AF297469 Schistosoma mansoni strain LE histone H4 ...	188	1e-44
325	emb|BX066857.1|CNS09NR1 Single read from an extremity of a full-...	186	6e-44
326	gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H...	186	6e-44
327	emb|AJ494855.1|ODI494855 Oikopleura dioica partial mRNA for hist...	184	2e-43
328	dbj|AK016178.1| Mus musculus adult male testis cDNA, RIKEN full-...	184	2e-43
329	ref|XM_871414.1| PREDICTED: Bos taurus similar to germinal histo...	182	9e-43
330	ref|XM_385667.1| Gibberella zeae PH-1 chromosome 3 H4_NEUCR Hist...	182	9e-43
331	gb|J00987.1|XELHIS4LB x.laevis histone gene h4 and flanks	182	9e-43
332	emb|X54078.1|TNHISTH4 T.nilotica gene for histone H4	180	3e-42
333	dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026	180	3e-42
334	ref|XM_608100.2| PREDICTED: Bos taurus similar to germinal histo...	178	1e-41
335	ref|XM_609250.2| PREDICTED: Bos taurus similar to germinal histo...	178	1e-41
336	emb|BX047093.1|CNS098I1 Single read from an extremity of a full-...	178	1e-41
337	gb|AY675260.1| Gallus gallus histone H4 gene, partial cds	178	1e-41
338	emb|AJ626749.1| Oikopleura dioica mRNA for histone H4.3	176	5e-41
339	ref|XM_702708.1| PREDICTED: Danio rerio similar to germinal hist...	176	5e-41
340	ref|XM_680087.1| PREDICTED: Danio rerio similar to germinal hist...	176	5e-41
341	emb|BX069194.1|CNS09PJY Single read from an extremity of a full-...	174	2e-40
342	emb|X52393.1|TCH3H4 Tigriopus californicus DNA for histone H3 an...	174	2e-40
343	gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co...	174	2e-40
344	ref|XM_527602.1| PREDICTED: Pan troglodytes similar to germinal ...	172	8e-40
345	ref|XM_653246.1| Aspergillus nidulans FGSC A4 histone H4 (AN0734...	172	8e-40
346	ref|NM_003540.3| Homo sapiens histone 1, H4f (HIST1H4F), mRNA	172	8e-40
347	gb|AY128659.1| Homo sapiens clone HIST1H4F histone H4 gene, comp...	172	8e-40
348	emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 o...	172	8e-40
349	gb|BC093765.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC...	172	8e-40
350	gb|BC093763.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC...	172	8e-40
351	gb|M60749.1|HUMHISAD Human histone H4 (H4) gene, complete cds	172	8e-40
352	gb|BC069288.1| Homo sapiens histone 1, H4f, mRNA (cDNA clone MGC...	172	8e-40
353	ref|XM_600437.2| PREDICTED: Bos taurus similar to germinal histo...	170	3e-39
354	ref|NM_003539.3| Homo sapiens histone 1, H4d (HIST1H4D), mRNA	170	3e-39
355	ref|XM_569504.1| Cryptococcus neoformans var. neoformans JEC21 h...	170	3e-39
356	gb|AY128657.1| Homo sapiens clone HIST1H4D histone H4 gene, comp...	170	3e-39
357	emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chro...	170	3e-39
358	emb|X60482.1|HSH4BHIS H.sapiens H4/b gene for H4 histone	170	3e-39
359	gb|AF361948.1| Eimeria tenella histone 4 (H4) gene, complete cds	168	1e-38
360	ref|XM_369778.1| Magnaporthe grisea 70-15 hypothetical protein (...	167	5e-38
361	ref|XM_594900.2| PREDICTED: Bos taurus similar to germinal histo...	167	5e-38
362	emb|BX043672.1|CNS095V0 Single read from an extremity of a full-...	167	5e-38
363	emb|X91511.1|DPINH41 D.pini mRNA for histone H4, isoforme 1	165	2e-37
364	gb|AY062172.1| Neurospora crassa histone H4 (hh4-2) gene, comple...	165	2e-37
365	emb|Z61847.1|HS59H5F H.sapiens CpG island DNA genomic Mse1 fragm...	165	2e-37
366	ref|XM_568101.1| Cryptococcus neoformans var. neoformans JEC21 h...	163	8e-37
367	emb|X03017.1|XLHISH1 Xenopus laevis histone gene cluster Xlh1 wi...	163	8e-37
368	ref|XM_701706.1| PREDICTED: Danio rerio similar to germinal hist...	163	8e-37
369	ref|XM_677902.1| PREDICTED: Danio rerio similar to germinal hist...	163	8e-37
370	gb|M21286.1|XELHX1H1 X.laevis histone H1B, H2A, H2B, and H4 gene...	163	8e-37
371	emb|X55549.1|ANH4GENE A.nidulans gene for core histone H4.1	161	3e-36
372	ref|XM_684085.1| PREDICTED: Danio rerio similar to germinal hist...	161	3e-36
373	ref|XM_688078.1| PREDICTED: Danio rerio similar to germinal hist...	161	3e-36
374	gb|AC084502.1|CBRG14F21 Caenorhabditis briggsae cosmid G14F21, c...	161	3e-36
375	gb|AY675269.1| Marmota monax histone H4 gene, partial cds	161	3e-36
376	gb|AY675261.1| Coturnix japonica histone H4 gene, partial cds	161	3e-36
377	emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ...	161	3e-36
378	gb|U12630.1|ENU12630 Emericella nidulans R153 core histone H3 (H...	161	3e-36
379	ref|XM_654938.1| Aspergillus nidulans FGSC A4 histone H4.2 (AN24...	159	1e-35
380	gb|DQ445629.1| Giardia intestinalis strain WP clone 1267 histone...	159	1e-35
381	emb|BX052401.1|CNS09CLH Single read from an extremity of a full-...	157	5e-35
382	emb|X55550.1|ANH4GE A.nidulans gene for core histone H4.2	157	5e-35
383	emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ...	157	5e-35
384	emb|X01611.1|NCHISH4 Neurospora crassa DNA for histone H4	157	5e-35
385	emb|AL670001.1|NCB14H13 Neurospora crassa DNA linkage group II B...	157	5e-35
386	emb|AL670543.1|NCB7K22 Neurospora crassa DNA linkage group II BA...	157	5e-35
387	gb|AY062173.1| Neurospora crassa histone H3 (hh3) and histone H4...	157	5e-35
388	gb|U12631.1|ENU12631 Emericella nidulans R153 core histone H4.2 ...	157	5e-35
389	ref|XM_750626.1| Aspergillus fumigatus Af293 histone H4 (Afu2g13...	155	2e-34
390	emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene	155	2e-34
391	ref|XM_684447.1| PREDICTED: Danio rerio similar to germinal hist...	155	2e-34
392	ref|XM_687122.1| PREDICTED: Danio rerio similar to germinal hist...	155	2e-34
393	gb|AY559151.1| Truncatellina cylindrica histone H3 and histone H...	153	8e-34
394	ref|XM_753764.1| Ustilago maydis 521 histone H4 (UM02710.1) part...	153	8e-34
395	gb|AY936210.1| Rattus norvegicus pro-histogranin mRNA, complete cds	153	8e-34
396	gb|AY675263.1| Felis catus histone H4 gene, partial cds	153	8e-34
397	dbj|AB050889.1| Citrus jambhiri mRNA for histone H4, partial cds	153	8e-34
398	emb|X54115.1|SSH4H3 S.stimpsoni histone genes H4 and H3	151	3e-33
399	emb|X54113.1|POH4H3 P.ochraceus histone genes H4 and H3	151	3e-33
400	gb|AY559154.1| Columella edentula isolate 15 histone H3 and hist...	149	1e-32
401	emb|X54114.1|PHH4H3 P.helianthoides histone genes H4 and H3	147	5e-32
402	emb|X15142.1|PPHISH41 Physarum polycephalum H41 gene for histone...	147	5e-32
403	emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ...	147	5e-32
404	emb|X00449.1|PPHI01 Physarum polycephalum histone H4 gene	147	5e-32
405	ref|XM_682981.1| PREDICTED: Danio rerio similar to germinal hist...	147	5e-32
406	ref|XM_687827.1| PREDICTED: Danio rerio similar to germinal hist...	147	5e-32
407	ref|XM_578442.1| PREDICTED: Rattus norvegicus similar to germina...	147	5e-32
408	ref|NM_214548.1| Strongylocentrotus purpuratus late embryonic hi...	147	5e-32
409	dbj|AB033943.1| Aspergillus oryzae mRNA for histone H4, complete...	147	5e-32
410	gb|AY389648.1| Hyacinthus orientalis histone H4 mRNA, complete cds	145	2e-31
411	gb|AC084589.1|CBRG41K24 Caenorhabditis briggsae cosmid G41K24, c...	145	2e-31
412	gb|AY675265.1| Canis familiaris histone H4 gene, partial cds	145	2e-31
413	gb|AY675264.1| Vulpes zerda histone H4 gene, partial cds	145	2e-31
414	emb|X54112.1|PBH4H3 P.brevispinus histone genes H4 and H3	143	8e-31
415	ref|XM_518290.1| PREDICTED: Pan troglodytes similar to germinal ...	141	3e-30
416	gb|AY559153.1| Columella edentula isolate 48 histone H3 and hist...	141	3e-30
417	emb|X97436.1|DHHISH4 D.hydei mRNA for histone H4	141	3e-30
418	gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence	139	1e-29
419	ref|XM_688557.1| PREDICTED: Danio rerio similar to germinal hist...	139	1e-29
420	ref|NM_074633.1| Caenorhabditis elegans HIStone family member (h...	139	1e-29
421	ref|NM_072799.2| Caenorhabditis elegans HIStone family member (h...	139	1e-29
422	emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, comple...	139	1e-29
423	ref|XM_601239.2| PREDICTED: Bos taurus similar to germinal histo...	137	5e-29
424	emb|X97437.1|DMH4R D.melanogaster H4r gene	137	5e-29
425	gb|AC007809.8|AC007809 Drosophila melanogaster, chromosome 3R, r...	137	5e-29
426	emb|AJ314735.1|CSP314735 Colletotrichum sp. partial H4 gene, exo...	137	5e-29
427	emb|AJ314731.1|CAC314731 Colletotrichum acutatum partial H4 gene...	137	5e-29
428	gb|AE003705.3| Drosophila melanogaster chromosome 3R, section 43...	137	5e-29
429	ref|XM_527254.1| PREDICTED: Pan troglodytes similar to HIST2H3C ...	135	2e-28
430	ref|NM_003544.2| Homo sapiens histone 1, H4b (HIST1H4B), mRNA	135	2e-28
431	ref|XM_747655.1| Aspergillus fumigatus Af293 histone H4 (Afu1g13...	135	2e-28
432	gb|AY128655.1| Homo sapiens clone HIST1H4B histone H4 gene, comp...	135	2e-28
433	emb|X67081.1|HSH4HIST H.sapiens histone H4 gene	135	2e-28
434	gb|BC069467.1| Homo sapiens histone 1, H4b, mRNA (cDNA clone MGC...	135	2e-28
435	dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012	133	7e-28
436	gb|AC084653.1|CBRG45O14 Caenorhabditis briggsae cosmid G45O14, c...	133	7e-28
437	gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete seq...	131	3e-27
438	gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence	131	3e-27
439	emb|Y09953.1|AGHISTH4 A.gambiae H4 gene, partial	131	3e-27
440	emb|CR542187.1| Homo sapiens full open reading frame cDNA clone ...	131	3e-27
441	ref|XM_687940.1| PREDICTED: Danio rerio similar to germinal hist...	131	3e-27
442	ref|NM_072897.1| Caenorhabditis elegans HIStone family member (h...	131	3e-27
443	ref|NM_072890.1| Caenorhabditis elegans HIStone family member (h...	131	3e-27
444	ref|NM_072874.1| Caenorhabditis elegans HIStone family member (h...	131	3e-27
445	gb|BC095254.1| Danio rerio cDNA clone IMAGE:7224490	131	3e-27
446	dbj|AB183301.1| Lactuca sativa LetH4 mRNA for histone H4, partia...	131	3e-27
447	ref|XM_683555.1| PREDICTED: Danio rerio similar to germinal hist...	129	1e-26
448	emb|AJ314734.1|CSP314734 Colletotrichum sp. partial H4 gene, exo...	129	1e-26
449	emb|AJ314733.1|CSP314733 Colletotrichum sp. partial H4 gene, exo...	129	1e-26
450	emb|AJ314727.1|CSP314727 Colletotrichum sp. partial H4 gene, exo...	129	1e-26
451	emb|AJ314724.1|CSP314724 Colletotrichum sp. partial H4 gene, exo...	129	1e-26
452	emb|AJ314723.1|CAC314723 Colletotrichum acutatum partial H4 gene...	129	1e-26
453	gb|BC056868.1| Homo sapiens cDNA clone IMAGE:5194861	127	5e-26
454	gb|BC012587.1| Homo sapiens histone 1, H4e, mRNA (cDNA clone MGC...	127	5e-26
455	gb|BC010926.1| Homo sapiens histone 1, H4h, mRNA (cDNA clone MGC...	127	5e-26
456	ref|NM_003543.3| Homo sapiens histone 1, H4h (HIST1H4H), mRNA	127	5e-26
457	gb|AY128661.1| Homo sapiens clone HIST1H4H histone H4 gene, comp...	127	5e-26
458	gb|AY128658.1| Homo sapiens clone HIST1H4E histone H4 gene, comp...	127	5e-26
459	emb|AL021917.4|HS45P21 Human DNA sequence from clone RP1-45P21 o...	127	5e-26
460	emb|Z80787.1|HSH4J H.sapiens H4/j gene	127	5e-26
461	emb|X60487.1|HSH4HHIS H.sapiens H4/h gene for H4 histone	127	5e-26
462	emb|CR858191.1| Pongo pygmaeus mRNA; cDNA DKFZp469B0137 (from cl...	127	5e-26
463	emb|CR542169.1| Homo sapiens full open reading frame cDNA clone ...	127	5e-26
464	dbj|AB105185.1| Drosophila sechellia H4, H2A, H2B, H1 genes for ...	127	5e-26
465	dbj|AB105184.1| Drosophila sechellia H4, H2A, H2B, H1 genes for ...	127	5e-26
466	dbj|AB105182.1| Drosophila mauritiana H4, H2A, H2B, H1 genes for...	127	5e-26
467	gb|BC050615.1| Homo sapiens histone 1, H4e, mRNA (cDNA clone MGC...	127	5e-26
468	dbj|AB055959.1| Drosophila simulans H4, H2A, H2B, H1 genes for h...	127	5e-26
469	ref|NM_003545.3| Homo sapiens histone 1, H4e (HIST1H4E), mRNA	125	2e-25
470	gb|AY559152.1| Columella edentula isolate 1 histone H3 and histo...	125	2e-25
471	emb|CR542180.1| Homo sapiens full open reading frame cDNA clone ...	125	2e-25
472	gb|AY675274.1| Lonchura domestica histone H4 gene, partial cds	125	2e-25
473	gb|AY675279.1| Suricata suricatta histone H4 gene, partial cds	125	2e-25
474	ref|XM_871249.1| PREDICTED: Bos taurus similar to germinal histo...	123	7e-25
475	ref|XM_607251.2| PREDICTED: Bos taurus similar to germinal histo...	123	7e-25
476	ref|XM_368084.1| Magnaporthe grisea 70-15 chromosome VI hypothet...	123	7e-25
477	gb|AY559170.1| Vallonia excentrica isolate 23 histone H3 and his...	123	7e-25
478	gb|AY559169.1| Vallonia excentrica isolate 17 histone H3 and his...	123	7e-25
479	gb|AY559168.1| Vallonia pulchella isolate 9 histone H3 and histo...	123	7e-25
480	gb|AY559167.1| Vallonia pulchella isolate 55 histone H3 and hist...	123	7e-25
481	gb|AY559166.1| Vallonia enniensis histone H3 and histone H4 gene...	123	7e-25
482	gb|AY559155.1| Pupilla muscorum histone H3 and histone H4 genes,...	123	7e-25
483	ref|XM_384465.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	123	7e-25
484	emb|AJ646896.1| Ustilago maydis h4 gene for histone 4, exons 1-2	123	7e-25
485	emb|AJ494848.1|ODI494848 Oikopleura dioica H3.1 gene, H4.1 gene,...	123	7e-25
486	ref|XM_693883.1| PREDICTED: Danio rerio similar to germinal hist...	123	7e-25
487	ref|XM_683785.1| PREDICTED: Danio rerio similar to germinal hist...	123	7e-25
488	dbj|AB105181.1| Drosophila orena H4, H2A, H2B, H1 genes for hist...	123	7e-25
489	dbj|AB073634.1| Drosophila erecta H4, H2A, H2B, H1 genes for his...	123	7e-25
490	emb|AJ132597.1|DME132597 Drosophila melanogaster H4r gene,3'-fla...	123	7e-25
491	ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a...	121	3e-24
492	gb|AY559165.1| Vallonia costata histone H3 and histone H4 genes,...	121	3e-24
493	ref|XM_702905.1| PREDICTED: Danio rerio similar to germinal hist...	121	3e-24
494	ref|XM_680378.1| PREDICTED: Danio rerio similar to germinal hist...	121	3e-24
495	emb|AJ314730.1|CAC314730 Colletotrichum acutatum partial H4 gene...	121	3e-24
496	emb|AJ314729.1|CAC314729 Colletotrichum acutatum partial H4 gene...	121	3e-24
497	emb|AJ314725.1|CSP314725 Colletotrichum sp. partial H4 gene, exo...	121	3e-24
498	gb|J00189.1|HUMHIS4A2 human histone gene h4a segment 2	121	3e-24
499	dbj|AB226301.1| Aspergillus oryzae cDNA, contig sequence: AoEST3163	119	1e-23
500	ref|XM_871144.1| PREDICTED: Bos taurus similar to germinal histo...	117	4e-23

---

>gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full insert mRNA sequence
          Length = 1768

 Score =  607 bits (306), Expect = e-170
 Identities = 330/338 (97%)
 Strand = Plus / Minus

                                                                        
Query: 229  cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1601 cctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 1542

                                                                        
Query: 289  tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1541 tggccgtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 1482

                                                                        
Query: 349  tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1481 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 1422

                                                                        
Query: 409  tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
            |||||||||| || || |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1421 tcacgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttgt 1362

                                                                        
Query: 469  cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1361 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 1302

                                                  
Query: 529  cgcgcccggacatggctgacgatctcgacctgtgagcg 566
            |||| ||||||||||||||||||||||| ||| |||||
Sbjct: 1301 cgcggccggacatggctgacgatctcgagctgcgagcg 1264

---

>emb|X00043.1|TAHI01 Wheat histone H4 gene
          Length = 1200

 Score =  567 bits (286), Expect = e-158
 Identities = 325/338 (96%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1046 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 987

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 986  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcatcgcggatgacgttc 927

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 926  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 867

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            |||||||| || || ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 866  acgccgccccgccgcgccagccgccggatcgccggcttggtgatgccctggatgttatcg 807

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || || |||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 806  cggaggaccttccggtggcgcttggcgccgcccttgcctaggcccttgcctcccttgccg 747

                                                  
Query: 531  cgcccggacatggctgacgatctcgacctgtgagcgag 568
            |||||||||||||| ||||||||||| ||| |||||||
Sbjct: 746  cgcccggacatggccgacgatctcgagctgcgagcgag 709

---

>gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1280_A04,
            complete sequence
          Length = 88553

 Score =  525 bits (265), Expect = e-146
 Identities = 301/313 (96%)
 Strand = Plus / Plus

                                                                        
Query: 232  agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4260 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 4319

                                                                        
Query: 292  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 4379

                                                                        
Query: 352  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 4380 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 4439

                                                                        
Query: 412  cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
            ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 4440 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 4499

                                                                        
Query: 472  gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
            | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4500 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 4559

                         
Query: 532  gcccggacatggc 544
            |||| ||||||||
Sbjct: 4560 gccccgacatggc 4572



 Score =  131 bits (66), Expect = 3e-27
 Identities = 144/170 (84%)
 Strand = Plus / Plus

                                                                         
Query: 246   tagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 305
             |||| ||||||||||||  |||||||||| || ||||| ||||||||  |||| ||||||
Sbjct: 11298 tagatggtgcggccctgaagcttgagcgcatatacgacatccatggccatgacagtcttg 11357

                                                                         
Query: 306   cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 365
             ||| | || |||||||||||||| | ||| |||| |||||| |||| ||||||||||| |
Sbjct: 11358 cggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttgaggaagatctcg 11417

                                                               
Query: 366   agcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgcc 415
             |||||||| || ||||| | |||||| | ||| |||||||||||||||||
Sbjct: 11418 agcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacgcc 11467

---

>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02,
             complete sequence
          Length = 93826

 Score =  525 bits (265), Expect = e-146
 Identities = 301/313 (96%)
 Strand = Plus / Plus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86772 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 86831

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 86832 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 86891

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 86892 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 86951

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 86952 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 87011

                                                                         
Query: 472   gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
             | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 87012 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 87071

                          
Query: 532   gcccggacatggc 544
             |||| ||||||||
Sbjct: 87072 gccccgacatggc 87084

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  525 bits (265), Expect = e-146
 Identities = 301/313 (96%)
 Strand = Plus / Plus

                                                                            
Query: 232      agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591722 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 22591781

                                                                            
Query: 292      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591782 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 22591841

                                                                            
Query: 352      cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 22591842 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 22591901

                                                                            
Query: 412      cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
                ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 22591902 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 22591961

                                                                            
Query: 472      gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
                | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22591962 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 22592021

                             
Query: 532      gcccggacatggc 544
                |||| ||||||||
Sbjct: 22592022 gccccgacatggc 22592034



 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Minus

                                                                            
Query: 232      agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758369 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 22758310

                                                                            
Query: 292      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758309 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 22758250

                                                                            
Query: 352      cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
                |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 22758249 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 22758190

                                                                            
Query: 412      cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
                ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 22758189 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 22758130

                                                                            
Query: 472      gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
                | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22758129 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 22758070

                             
Query: 532      gcccggacatggc 544
                |||| ||||||||
Sbjct: 22758069 gccccgacatggc 22758057



 Score =  131 bits (66), Expect = 3e-27
 Identities = 144/170 (84%)
 Strand = Plus / Plus

                                                                            
Query: 246      tagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttg 305
                |||| ||||||||||||  |||||||||| || ||||| ||||||||  |||| ||||||
Sbjct: 22598760 tagatggtgcggccctgaagcttgagcgcatatacgacatccatggccatgacagtcttg 22598819

                                                                            
Query: 306      cggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttg 365
                ||| | || |||||||||||||| | ||| |||| |||||| |||| ||||||||||| |
Sbjct: 22598820 cggtgagcatgctcggtgtaggtaatggcatcgcagatgacattcttgaggaagatctcg 22598879

                                                                  
Query: 366      agcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgcc 415
                |||||||| || ||||| | |||||| | ||| |||||||||||||||||
Sbjct: 22598880 agcacgccacgagtctctttgtagatcaaccctgagatgcgcttcacgcc 22598929

---

>dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C11, full
           insert sequence
          Length = 588

 Score =  525 bits (265), Expect = e-146
 Identities = 301/313 (96%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 414 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 355

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 354 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 295

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 294 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 235

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 234 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 175

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 174 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 115

                        
Query: 532 gcccggacatggc 544
           |||| ||||||||
Sbjct: 114 gccccgacatggc 102

---

>ref|XM_475383.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  519 bits (262), Expect = e-144
 Identities = 298/310 (96%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 70  ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 11

                     
Query: 532 gcccggacat 541
           |||| |||||
Sbjct: 10  gccccgacat 1

---

>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009E21,
              complete sequence
          Length = 153214

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Minus

                                                                          
Query: 232    agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113568 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 113509

                                                                          
Query: 292    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113508 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 113449

                                                                          
Query: 352    cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
              |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 113448 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 113389

                                                                          
Query: 412    cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
              ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 113388 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 113329

                                                                          
Query: 472    gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
              | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113328 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 113269

                           
Query: 532    gcccggacatggc 544
              |||| ||||||||
Sbjct: 113268 gccccgacatggc 113256

---

>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08,
             complete sequence
          Length = 141535

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Minus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67819 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 67760

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67759 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 67700

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 67699 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 67640

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 67639 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 67580

                                                                         
Query: 472   gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
             | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67579 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 67520

                          
Query: 532   gcccggacatggc 544
             |||| ||||||||
Sbjct: 67519 gccccgacatggc 67507

---

>dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-A04, full
           insert sequence
          Length = 672

 Score =  517 bits (261), Expect = e-143
 Identities = 300/313 (95%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 341

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 340 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 281

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 280 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 221

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 220 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 161

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 160 ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 101

                        
Query: 532 gcccggacatggc 544
           |||| ||||||||
Sbjct: 100 gccccgacatggc 88

---

>ref|XM_475394.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  511 bits (258), Expect = e-142
 Identities = 297/310 (95%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 130 cgccgcccctccttgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 70  ggagcaccttccggtgacgcttggcgccgcccttgccgagccccttgcctcccttgccgc 11

                     
Query: 532 gcccggacat 541
           |||| |||||
Sbjct: 10  gccccgacat 1

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  507 bits (256), Expect = e-140
 Identities = 304/320 (95%)
 Strand = Plus / Minus

                                                                           
Query: 232     agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060862 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1060803

                                                                           
Query: 292     cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1060802 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1060743

                                                                           
Query: 352     cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
               |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1060742 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 1060683

                                                                           
Query: 412     cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
               ||||||| |  |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060682 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1060623

                                                                           
Query: 472     gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
               |||||||||||| ||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 1060622 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 1060563

                                   
Query: 532     gcccggacatggctgacgat 551
               | || |||||||||||||||
Sbjct: 1060562 ggcccgacatggctgacgat 1060543



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 314      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacgcc 373
                |||||||||||||||||| | ||||  | ||||||||| |||||||||||||| ||||||
Sbjct: 25649298 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25649239

                                                    
Query: 374      gcgggtctcctcgtagatgagccccgagatgcgctt 409
                 |  || ||||||||||||||||  |||||||||||
Sbjct: 25649238 acatgt-tcctcgtagatgagcctggagatgcgctt 25649204



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 509     gagccccttgcctcccttgcc 529
               |||||||||||||||||||||
Sbjct: 3353170 gagccccttgcctcccttgcc 3353150



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 362      cttgagcacgccgcgggtctcctcgtagatga 393
                |||| ||| |||||||||||||||||| ||||
Sbjct: 25649206 cttgggcatgccgcgggtctcctcgtaaatga 25649175

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  507 bits (256), Expect = e-140
 Identities = 304/320 (95%)
 Strand = Plus / Minus

                                                                           
Query: 232     agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060860 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1060801

                                                                           
Query: 292     cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1060800 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1060741

                                                                           
Query: 352     cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
               |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1060740 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 1060681

                                                                           
Query: 412     cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
               ||||||| |  |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1060680 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 1060621

                                                                           
Query: 472     gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
               |||||||||||| ||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 1060620 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 1060561

                                   
Query: 532     gcccggacatggctgacgat 551
               | || |||||||||||||||
Sbjct: 1060560 ggcccgacatggctgacgat 1060541



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 83/96 (86%), Gaps = 1/96 (1%)
 Strand = Plus / Minus

                                                                            
Query: 314      gtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacgcc 373
                |||||||||||||||||| | ||||  | ||||||||| |||||||||||||| ||||||
Sbjct: 25740607 gtgctcggtgtaggtgacagtgtcgtaggtgacgttcttgaggaagatcttgatcacgcc 25740548

                                                    
Query: 374      gcgggtctcctcgtagatgagccccgagatgcgctt 409
                 |  || ||||||||||||||||  |||||||||||
Sbjct: 25740547 acatgt-tcctcgtagatgagcctggagatgcgctt 25740513



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 509     gagccccttgcctcccttgcc 529
               |||||||||||||||||||||
Sbjct: 3353281 gagccccttgcctcccttgcc 3353261



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 362      cttgagcacgccgcgggtctcctcgtagatga 393
                |||| ||| |||||||||||||||||| ||||
Sbjct: 25740515 cttgggcatgccgcgggtctcctcgtaaatga 25740484

---

>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11,
             complete sequence
          Length = 126827

 Score =  507 bits (256), Expect = e-140
 Identities = 304/320 (95%)
 Strand = Plus / Minus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 81077 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 81018

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 81017 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 80958

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 80957 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 80898

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             ||||||| |  |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 80897 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 80838

                                                                         
Query: 472   gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
             |||||||||||| ||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 80837 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 80778

                                 
Query: 532   gcccggacatggctgacgat 551
             | || |||||||||||||||
Sbjct: 80777 ggcccgacatggctgacgat 80758

---

>dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G08, full
           insert sequence
          Length = 526

 Score =  507 bits (256), Expect = e-140
 Identities = 304/320 (95%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 318

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 317 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 258

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 257 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 198

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 138

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||||| ||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 137 gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 78

                               
Query: 532 gcccggacatggctgacgat 551
           | || |||||||||||||||
Sbjct: 77  ggcccgacatggctgacgat 58

---

>emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4
          Length = 616

 Score =  505 bits (255), Expect = e-140
 Identities = 304/321 (94%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||||||||| |||||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 361 ctagccgccgaagccgtagagagtgcgaccctggcgcttgagcgcgtagactacgtccat 302

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 301 ggcggtgacggtcttgcggcsggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 242

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           |||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 241 ctcgaggaagatcttgagcacgccacgggtctcctcgtagatgagcccggagatgcgctt 182

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
           ||||||||| ||||||||||| || ||||| |||||||||||||||||||||||||||||
Sbjct: 181 cacgccgccgcggcgagccaggcggcggatggccggcttggtgatgccctggatgttgtc 122

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||| || ||||| ||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 121 gcggaggaccttgcggtggcgcttggcgccgcccttgccgagcccctttcctcccttgcc 62

                                
Query: 530 gcgcccggacatggctgacga 550
           ||| || ||||||||||||||
Sbjct: 61  gcggcccgacatggctgacga 41

---

>ref|XM_473659.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  492 bits (248), Expect = e-136
 Identities = 296/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 192 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 133

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            |||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||
Sbjct: 132 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 73

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 72  gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 13

                       
Query: 530 gcgcccggacat 541
           |||||| |||||
Sbjct: 12  gcgccccgacat 1

---

>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01,
              complete sequence
          Length = 186325

 Score =  492 bits (248), Expect = e-136
 Identities = 296/312 (94%)
 Strand = Plus / Plus

                                                                          
Query: 230    ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
              |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135379 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 135438

                                                                          
Query: 290    ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135439 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 135498

                                                                          
Query: 350    ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 135499 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 135558

                                                                          
Query: 410    cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
               |||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||
Sbjct: 135559 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 135618

                                                                          
Query: 470    gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
              ||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 135619 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 135678

                          
Query: 530    gcgcccggacat 541
              |||||| |||||
Sbjct: 135679 gcgccccgacat 135690

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  492 bits (248), Expect = e-136
 Identities = 296/312 (94%)
 Strand = Plus / Plus

                                                                            
Query: 230      ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
                |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29462363 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 29462422

                                                                            
Query: 290      ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29462423 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 29462482

                                                                            
Query: 350      ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 29462483 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 29462542

                                                                            
Query: 410      cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
                 |||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||
Sbjct: 29462543 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 29462602

                                                                            
Query: 470      gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
                ||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 29462603 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 29462662

                            
Query: 530      gcgcccggacat 541
                |||||| |||||
Sbjct: 29462663 gcgccccgacat 29462674

---

>dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-B02, full
           insert sequence
          Length = 594

 Score =  492 bits (248), Expect = e-136
 Identities = 296/312 (94%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 388 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 329

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 269

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 268 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgctt 209

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            |||||||| |  |  ||||||| ||||||||||||||||||||| ||||||||||||||
Sbjct: 208 gacgccgcccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtc 149

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 148 gcggagcaccttgcggtggcgcttcgcgccgcccttgcccagccccttgcctcccttgcc 89

                       
Query: 530 gcgcccggacat 541
           |||||| |||||
Sbjct: 88  gcgccccgacat 77

---

>ref|NM_187563.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  488 bits (246), Expect = e-134
 Identities = 294/310 (94%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||||| ||| ||||| |||||||||||||| || |||||||||||||||||||
Sbjct: 70  gcagcaccttcctgtgccgcttcgcgccgcccttgccaagacccttgcctcccttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  ggcccgacat 1

---

>gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence
          Length = 622

 Score =  488 bits (246), Expect = e-134
 Identities = 297/314 (94%)
 Strand = Plus / Minus

                                                                       
Query: 228 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 gcctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 325

                                                                       
Query: 288 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 324 atggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacg 265

                                                                       
Query: 348 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 ttctcgagaaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 205

                                                                       
Query: 408 ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
           |||||||| || |  | |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 204 ttcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttg 145

                                                                       
Query: 468 tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
           ||||| |||||||||||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 144 tcgcggagcaccttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttg 85

                         
Query: 528 ccgcgcccggacat 541
           |||||||| |||||
Sbjct: 84  ccgcgcccagacat 71

---

>ref|XM_467181.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  480 bits (242), Expect = e-132
 Identities = 293/310 (94%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           |||| || |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 130 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | |||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||
Sbjct: 70  ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 11

                     
Query: 532 gcccggacat 541
           |||| |||||
Sbjct: 10  gcccagacat 1

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  480 bits (242), Expect = e-132
 Identities = 293/310 (94%)
 Strand = Plus / Plus

                                                                            
Query: 232      agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 28012831 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 28012890

                                                                            
Query: 292      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 28012891 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 28012950

                                                                            
Query: 352      cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 28012951 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 28013010

                                                                            
Query: 412      cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
                |||| || |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 28013011 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 28013070

                                                                            
Query: 472      gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
                | |||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||
Sbjct: 28013071 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 28013130

                          
Query: 532      gcccggacat 541
                |||| |||||
Sbjct: 28013131 gcccagacat 28013140

---

>dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1212_A08
          Length = 119304

 Score =  480 bits (242), Expect = e-132
 Identities = 293/310 (94%)
 Strand = Plus / Plus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56493 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 56552

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 56553 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 56612

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 56613 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 56672

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             |||| || |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 56673 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 56732

                                                                         
Query: 472   gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
             | |||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||
Sbjct: 56733 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 56792

                       
Query: 532   gcccggacat 541
             |||| |||||
Sbjct: 56793 gcccagacat 56802

---

>dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1717_A09
          Length = 203132

 Score =  480 bits (242), Expect = e-132
 Identities = 293/310 (94%)
 Strand = Plus / Plus

                                                                        
Query: 232  agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2478 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 2537

                                                                        
Query: 292  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 2538 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 2597

                                                                        
Query: 352  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 2598 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttca 2657

                                                                        
Query: 412  cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
            |||| || |  |  ||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 2658 cgccccccctcctcgccagcctccggatcgccggcttggtgatcccctggatgttgtcgc 2717

                                                                        
Query: 472  gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
            | |||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||
Sbjct: 2718 ggagcaccttgcggtggcgcttcgccccgcccttgcccagccccttgcctcccttgccgc 2777

                      
Query: 532  gcccggacat 541
            |||| |||||
Sbjct: 2778 gcccagacat 2787

---

>gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), complete cds
          Length = 1135

 Score =  480 bits (242), Expect = e-132
 Identities = 296/314 (94%)
 Strand = Plus / Minus

                                                                       
Query: 228 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
           ||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 gcctaccctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 726

                                                                       
Query: 288 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 725 atggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacg 666

                                                                       
Query: 348 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 665 ttctcgagaaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 606

                                                                       
Query: 408 ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
           |||||||| || |  | |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 605 ttcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttg 546

                                                                       
Query: 468 tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
           ||||| |||||||||||||||||||| |||||||||||||| || |||||||| ||||||
Sbjct: 545 tcgcggagcaccttccggtggcgcttcgcgccgcccttgcccagacccttgccgcccttg 486

                         
Query: 528 ccgcgcccggacat 541
           |||||||| |||||
Sbjct: 485 ccgcgcccagacat 472

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  478 bits (241), Expect = e-131
 Identities = 295/313 (94%)
 Strand = Plus / Minus

                                                                            
Query: 232      agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 35834191 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 35834132

                                                                            
Query: 292      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 35834131 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 35834072

                                                                            
Query: 352      cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
                |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 35834071 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 35834012

                                                                            
Query: 412      cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
                ||||||| |  |  ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 35834011 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 35833952

                                                                            
Query: 472      gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
                | |||||||| || || | ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 35833951 ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 35833892

                             
Query: 532      gcccggacatggc 544
                |||| ||||||||
Sbjct: 35833891 gccccgacatggc 35833879

---

>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0506B12
          Length = 170759

 Score =  478 bits (241), Expect = e-131
 Identities = 295/313 (94%)
 Strand = Plus / Minus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98649 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 98590

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 98589 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 98530

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 98529 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 98470

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             ||||||| |  |  ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 98469 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 98410

                                                                         
Query: 472   gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
             | |||||||| || || | ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 98409 ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 98350

                          
Query: 532   gcccggacatggc 544
             |||| ||||||||
Sbjct: 98349 gccccgacatggc 98337

---

>dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-F07, full
            insert sequence
          Length = 1449

 Score =  478 bits (241), Expect = e-131
 Identities = 295/313 (94%)
 Strand = Plus / Minus

                                                                        
Query: 232  agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1156 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 1097

                                                                        
Query: 292  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1096 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 1037

                                                                        
Query: 352  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
            |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 1036 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 977

                                                                        
Query: 412  cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
            ||||||| |  |  ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 976  cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 917

                                                                        
Query: 472  gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
            | |||||||| || || | ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 916  ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 857

                         
Query: 532  gcccggacatggc 544
            |||| ||||||||
Sbjct: 856  gccccgacatggc 844

---

>gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds
          Length = 727

 Score =  474 bits (239), Expect = e-130
 Identities = 296/315 (93%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 564 ctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 505

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 504 ggcggtgacggttttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 445

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           |||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||
Sbjct: 444 ctcgaggaagatcttgaggacgccgcgggtctcctcgtagatgaggccggagatgcgctt 385

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
           ||||||||| |  |  ||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 384 cacgccgcccctcctggccagcctccggatcgccggcttggtgatgccctggatgttgtc 325

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||| || ||||||||||| |||||||||||||||||||| ||||||||||| |||||| |
Sbjct: 324 gcggaggaccttccggtgccgcttggcgccgcccttgcccagccccttgccgcccttgtc 265

                          
Query: 530 gcgcccggacatggc 544
           |||||| ||||||||
Sbjct: 264 gcgcccagacatggc 250

---

>ref|NM_190485.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 312

 Score =  472 bits (238), Expect = e-130
 Identities = 292/310 (94%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 250 cggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 190 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 130 cgccgcccctcctcgccagcctccggatcgccggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | |||||||| || || | ||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 70  ggagcaccttgcgatgcctcttcgcgccgcccttgccgagccccttgccgcccttgccgc 11

                     
Query: 532 gcccggacat 541
           |||| |||||
Sbjct: 10  gccccgacat 1

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  472 bits (238), Expect = e-130
 Identities = 295/314 (93%)
 Strand = Plus / Minus

                                                                            
Query: 228      gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
                |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21774023 gcctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 21773964

                                                                            
Query: 288      atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21773963 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 21773904

                                                                            
Query: 348      ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 21773903 ttctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgc 21773844

                                                                            
Query: 408      ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
                ||||| ||||| |  |  ||||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 21773843 ttcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 21773784

                                                                            
Query: 468      tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
                ||||| |||||||||||||||||||| ||||| |||||||| || ||||| |||||||| 
Sbjct: 21773783 tcgcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttc 21773724

                              
Query: 528      ccgcgcccggacat 541
                |||||||| |||||
Sbjct: 21773723 ccgcgcccagacat 21773710

---

>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0534A03
          Length = 153170

 Score =  472 bits (238), Expect = e-130
 Identities = 295/314 (93%)
 Strand = Plus / Minus

                                                                         
Query: 228   gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91206 gcctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 91147

                                                                         
Query: 288   atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 91146 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 91087

                                                                         
Query: 348   ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 91086 ttctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgc 91027

                                                                         
Query: 408   ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
             ||||| ||||| |  |  ||||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 91026 ttcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 90967

                                                                         
Query: 468   tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
             ||||| |||||||||||||||||||| ||||| |||||||| || ||||| |||||||| 
Sbjct: 90966 tcgcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttc 90907

                           
Query: 528   ccgcgcccggacat 541
             |||||||| |||||
Sbjct: 90906 ccgcgcccagacat 90893

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  470 bits (237), Expect = e-129
 Identities = 294/313 (93%)
 Strand = Plus / Minus

                                                                            
Query: 229      cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
                ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 15861722 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 15861663

                                                                            
Query: 289      tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15861662 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 15861603

                                                                            
Query: 349      tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
                |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 15861602 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 15861543

                                                                            
Query: 409      tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
                |||| ||||| |  |  ||||||| ||||||||||||||| ||||| |||||||||||||
Sbjct: 15861542 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 15861483

                                                                            
Query: 469      cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
                |||| |||||||||||||| ||||| || |||||||||||||| ||||| ||||||||||
Sbjct: 15861482 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 15861423

                             
Query: 529      cgcgcccggacat 541
                ||||||| |||||
Sbjct: 15861422 cgcgccccgacat 15861410



 Score =  464 bits (234), Expect = e-127
 Identities = 285/302 (94%)
 Strand = Plus / Plus

                                                                            
Query: 228      gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21610885 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 21610944

                                                                            
Query: 288      atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
                |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 21610945 atggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacg 21611004

                                                                            
Query: 348      ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
                |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 21611005 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgc 21611064

                                                                            
Query: 408      ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
                ||||||||||| |  |  ||||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 21611065 ttcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 21611124

                                                                            
Query: 468      tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
                |||||||||||||||| ||| | ||| ||||||||||| |||||||||||||| ||||||
Sbjct: 21611125 tcgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttg 21611184

                  
Query: 528      cc 529
                ||
Sbjct: 21611185 cc 21611186

---

>dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1081_G10
          Length = 107955

 Score =  470 bits (237), Expect = e-129
 Identities = 294/313 (93%)
 Strand = Plus / Minus

                                                                         
Query: 229   cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
             ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 24848 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 24789

                                                                         
Query: 289   tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 24788 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 24729

                                                                         
Query: 349   tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 24728 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 24669

                                                                         
Query: 409   tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
             |||| ||||| |  |  ||||||| ||||||||||||||| ||||| |||||||||||||
Sbjct: 24668 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 24609

                                                                         
Query: 469   cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
             |||| |||||||||||||| ||||| || |||||||||||||| ||||| ||||||||||
Sbjct: 24608 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 24549

                          
Query: 529   cgcgcccggacat 541
             ||||||| |||||
Sbjct: 24548 cgcgccccgacat 24536

---

>dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-A10, full
           insert sequence
          Length = 469

 Score =  470 bits (237), Expect = e-129
 Identities = 294/313 (93%)
 Strand = Plus / Minus

                                                                       
Query: 229 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
           ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 363 cctagccgccgaagccgtagagggtgcggccctggcgcttgagggcgtagacgacgtcca 304

                                                                       
Query: 289 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 244

                                                                       
Query: 349 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 243 tctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgct 184

                                                                       
Query: 409 tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
           |||| ||||| |  |  ||||||| ||||||||||||||| ||||| |||||||||||||
Sbjct: 183 tcaccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 124

                                                                       
Query: 469 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
           |||| |||||||||||||| ||||| || |||||||||||||| ||||| ||||||||||
Sbjct: 123 cgcggagcaccttccggtgccgcttcgccccgcccttgccgagacccttccctcccttgc 64

                        
Query: 529 cgcgcccggacat 541
           ||||||| |||||
Sbjct: 63  cgcgccccgacat 51

---

>ref|NM_185758.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 312

 Score =  468 bits (236), Expect = e-128
 Identities = 293/312 (93%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 312 ctagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 253

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 252 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 193

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 192 ctcgaggaagatcttgagcaccccgcgggtctcctcgtagatgagccccgagatgcgctt 133

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
           ||| ||||| |  |  ||||||| ||||||||||||||| ||||| ||||||||||||||
Sbjct: 132 caccccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgtc 73

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||| |||||||||||||||||||| ||||| |||||||| || ||||| |||||||| ||
Sbjct: 72  gcggagcaccttccggtggcgcttcgcgcctcccttgcccaggcccttccctcccttccc 13

                       
Query: 530 gcgcccggacat 541
           |||||| |||||
Sbjct: 12  gcgcccagacat 1

---

>gb|AC137596.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0031H05, complete sequence
          Length = 141200

 Score =  464 bits (234), Expect = e-127
 Identities = 285/302 (94%)
 Strand = Plus / Plus

                                                                         
Query: 228   gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 67511 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 67570

                                                                         
Query: 288   atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 67571 atggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacg 67630

                                                                         
Query: 348   ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
             |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 67631 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgc 67690

                                                                         
Query: 408   ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
             ||||||||||| |  |  ||||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 67691 ttcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 67750

                                                                         
Query: 468   tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
             |||||||||||||||| ||| | ||| ||||||||||| |||||||||||||| ||||||
Sbjct: 67751 tcgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttg 67810

               
Query: 528   cc 529
             ||
Sbjct: 67811 cc 67812

---

>dbj|AP005564.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1228_C03, complete sequence
          Length = 31468

 Score =  464 bits (234), Expect = e-127
 Identities = 285/302 (94%)
 Strand = Plus / Plus

                                                                         
Query: 228   gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 19209 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 19268

                                                                         
Query: 288   atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 19269 atggcggtgacggtcttgcggcgggcgtgctccgtgtaggtgacggcgtcgcggatgacg 19328

                                                                         
Query: 348   ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
             |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 19329 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgc 19388

                                                                         
Query: 408   ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
             ||||||||||| |  |  ||||||| ||||||||||||||| ||||| ||||||||||||
Sbjct: 19389 ttcacgccgcccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttg 19448

                                                                         
Query: 468   tcgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttg 527
             |||||||||||||||| ||| | ||| ||||||||||| |||||||||||||| ||||||
Sbjct: 19449 tcgcgcagcaccttcctgtgcctcttcgcgccgcccttcccgagccccttgccgcccttg 19508

               
Query: 528   cc 529
             ||
Sbjct: 19509 cc 19510

---

>ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone H4
           (OSJNBb0064P21.1), mRNA
          Length = 372

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 311

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 251

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 250 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 191

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 190 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 131

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 130 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 71

                              
Query: 532 gcccggacatggctgacga 550
           | || |||||| |||||||
Sbjct: 70  ggcccgacatgtctgacga 52

---

>gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 genomic sequence,
            complete sequence
          Length = 14849

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Minus

                                                                        
Query: 232  agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4262 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 4203

                                                                        
Query: 292  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4202 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 4143

                                                                        
Query: 352  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
            |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 4142 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 4083

                                                                        
Query: 412  cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
            ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 4082 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 4023

                                                                        
Query: 472  gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
            |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 4022 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 3963

                               
Query: 532  gcccggacatggctgacga 550
            | || |||||| |||||||
Sbjct: 3962 ggcccgacatgtctgacga 3944

---

>gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 genomic sequence,
            complete sequence
          Length = 142114

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Plus

                                                                        
Query: 232  agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5636 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 5695

                                                                        
Query: 292  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5696 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 5755

                                                                        
Query: 352  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
            |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 5756 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 5815

                                                                        
Query: 412  cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
            ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 5816 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 5875

                                                                        
Query: 472  gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
            |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 5876 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 5935

                               
Query: 532  gcccggacatggctgacga 550
            | || |||||| |||||||
Sbjct: 5936 ggcccgacatgtctgacga 5954

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Plus

                                                                            
Query: 232      agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20500346 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 20500405

                                                                            
Query: 292      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20500406 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 20500465

                                                                            
Query: 352      cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
                |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 20500466 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 20500525

                                                                            
Query: 412      cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
                ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 20500526 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 20500585

                                                                            
Query: 472      gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
                |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 20500586 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 20500645

                                   
Query: 532      gcccggacatggctgacga 550
                | || |||||| |||||||
Sbjct: 20500646 ggcccgacatgtctgacga 20500664

---

>dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-D04, full
           insert sequence
          Length = 544

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 325

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 265

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 264 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 205

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 204 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 145

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 144 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 85

                              
Query: 532 gcccggacatggctgacga 550
           | || |||||| |||||||
Sbjct: 84  ggcccgacatgtctgacga 66

---

>dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-C07, full
           insert sequence
          Length = 531

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 321

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 261

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 260 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 201

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 200 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 141

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 140 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 81

                              
Query: 532 gcccggacatggctgacga 550
           | || |||||| |||||||
Sbjct: 80  ggcccgacatgtctgacga 62

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  458 bits (231), Expect = e-125
 Identities = 297/319 (93%)
 Strand = Plus / Plus

                                                                            
Query: 232      agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20511618 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 20511677

                                                                            
Query: 292      cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20511678 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 20511737

                                                                            
Query: 352      cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
                |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 20511738 cgaggaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgcttca 20511797

                                                                            
Query: 412      cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
                ||||||| |  |  ||||||| ||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 20511798 cgccgcccctcctcgccagcctccggatcgcgggcttcgtgatcccctggatgttgtcgc 20511857

                                                                            
Query: 472      gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
                |||||||||||| ||| | ||| ||||| |||||||| |||||||||||||||||||| |
Sbjct: 20511858 gcagcaccttcctgtgcctcttcgcgcctcccttgcccagccccttgcctcccttgccac 20511917

                                   
Query: 532      gcccggacatggctgacga 550
                | || |||||| |||||||
Sbjct: 20511918 ggcccgacatgtctgacga 20511936

---

>emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene
          Length = 1029

 Score =  442 bits (223), Expect = e-121
 Identities = 294/315 (93%), Gaps = 2/315 (0%)
 Strand = Plus / Minus

                                                                       
Query: 228 gcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 287
           |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 648 gcctagcctccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcc 589

                                                                       
Query: 288 atggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacg 347
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 588 atggcggtcacggtcttgcggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgacg 529

                                                                       
Query: 348 ttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgc 407
           |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 ttctcgagaaagatcttgcgcacgccgcgggtctcctcgtagatgagccccgagatgcgc 469

                                                                       
Query: 408 ttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttg 467
           |||||||| || |  | |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 468 ttcacgccacccctcctagccagcctccggatcgccggcttggtgatgccctggatgttg 409

                                                                       
Query: 468 tcgcgcagcaccttccggtggcgctt-ggcgccgcccttgccgagccccttgcctccctt 526
           ||||| ||||||||||||||||||||  ||| ||||||| || || |||||||| |||||
Sbjct: 408 tcgcggagcaccttccggtggcgcttccgcg-cgccctttcccagacccttgccgccctt 350

                          
Query: 527 gccgcgcccggacat 541
           ||||||||| |||||
Sbjct: 349 gccgcgcccagacat 335

---

>gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence
          Length = 594

 Score =  434 bits (219), Expect = e-118
 Identities = 288/311 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 354 tagccgccgaacccgtagagggtgcggccctggcgcttgagggcgtagacgacgtccatg 295

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           ||||||||||| || || ||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 294 gcggtgacggtttttcgacgggcgtgctcagtgtaggtgacggcgtcgcggatgacgttc 235

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 234 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccggagatgcgcttc 175

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |  |  || |||| ||||||||||||||| ||||| || ||||||||||||
Sbjct: 174 acgccgcccctcctcgcaagcctccggatcgccggcttcgtgatcccttggatgttgtcg 115

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           || |||||||| ||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 114 cggagcaccttgcggtgccgcttggcgccgcccttgcccagccccttgccgcccttgccg 55

                      
Query: 531 cgcccggacat 541
           ||||| |||||
Sbjct: 54  cgcccagacat 44

---

>gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), complete cds
          Length = 868

 Score =  420 bits (212), Expect = e-114
 Identities = 287/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 659 agccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccatgg 600

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| ||||
Sbjct: 599 cggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacattct 540

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 539 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 480

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||| || |||||||||||||||||||
Sbjct: 479 cgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtcgc 420

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | || ||||| ||||| ||||| |||||||||||||| |||||||| || ||||| ||||
Sbjct: 419 ggaggaccttgcggtgacgcttcgcgccgcccttgcccagccccttcccgccctttccgc 360

                       
Query: 532 gcccggacatgg 543
           |||| |||||||
Sbjct: 359 gccccgacatgg 348

---

>gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds
          Length = 949

 Score =  420 bits (212), Expect = e-114
 Identities = 287/312 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 647 agccgccaaatccgtagagggtgcggccctgccgcttgagcgcgtagacgacgtccatgg 588

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||||||||
Sbjct: 587 cggtgacggtcttacggcgggcgtgctccgtgtaggtgacagcgtcgcgaatgacgttct 528

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 527 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 468

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| |  |  ||||||| ||||||||||||||| || |||||||||||||||||||
Sbjct: 467 cgccgccccttctcgccagcctccggatcgccggcttcgtaatgccctggatgttgtcgc 408

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | || ||||| ||||| ||||| ||||||||||| || |||||||| || ||||| ||||
Sbjct: 407 ggaggaccttgcggtgacgcttcgcgccgccctttcccagccccttcccgccctttccgc 348

                       
Query: 532 gcccggacatgg 543
           |||| |||||||
Sbjct: 347 gccccgacatgg 336

---

>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds
          Length = 2297

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Plus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1689 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 1748

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1749 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 1808

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 1809 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 1868

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 1869 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 1928

                                                                       
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
            ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 1929 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 1987



 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 511 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 452

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 392

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 391 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 332

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 331 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 272

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 271 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 213

---

>ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC417946), mRNA
          Length = 312

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 191 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

---

>ref|NM_001037843.1| Gallus gallus similar to germinal histone H4 gene (LOC417950), mRNA
          Length = 312

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 251 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 191 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

---

>gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds
          Length = 661

 Score =  410 bits (207), Expect = e-111
 Identities = 276/299 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 471 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 412

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 352

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 351 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 292

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 291 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 232

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 231 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 173

---

>ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427889), mRNA
          Length = 312

 Score =  404 bits (204), Expect = e-109
 Identities = 273/296 (92%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           ||||| || || ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

---

>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC417952), mRNA
          Length = 1374

 Score =  404 bits (204), Expect = e-109
 Identities = 273/296 (92%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 308 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 249

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 248 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 189

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 188 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 129

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           ||||| || || ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 128 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 69

                                                                   
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 68  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 13

---

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  404 bits (204), Expect = e-109
 Identities = 273/296 (92%)
 Strand = Plus / Plus

                                                                        
Query: 234  ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 6357 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 6416

                                                                        
Query: 294  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 6417 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 6476

                                                                        
Query: 354  aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
            ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 6477 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 6536

                                                                        
Query: 414  ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
            ||||| || || ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 6537 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 6596

                                                                    
Query: 474  agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
            |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 6597 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 6652



 Score =  396 bits (200), Expect = e-107
 Identities = 272/296 (91%)
 Strand = Plus / Minus

                                                                        
Query: 234  ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
            |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 1095 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 1036

                                                                        
Query: 294  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
            ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1035 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 976

                                                                        
Query: 354  aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
            ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 975  aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 916

                                                                        
Query: 414  ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
            ||||| || || ||||| || ||||| ||||||||||||||||||||||| |||||||||
Sbjct: 915  ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatattgtcgcgc 856

                                                                    
Query: 474  agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
            |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 855  agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 800

---

>ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene
           (LOC427884), mRNA
          Length = 516

 Score =  402 bits (203), Expect = e-109
 Identities = 275/299 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 515 tagccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatg 456

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 455 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggataacgttc 396

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 395 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 336

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 335 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 276

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 275 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 217

---

>gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds
          Length = 630

 Score =  402 bits (203), Expect = e-109
 Identities = 275/299 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||| ||||| ||||||||||||||||||||||| |||||||||
Sbjct: 454 tagccgccgaagccgtagagagtgcgtccctggcgcttgagcgcgtagaccacgtccatg 395

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||||||||||||||||||||||||||||||||||
Sbjct: 394 gccgtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 335

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 334 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 275

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 274 acgccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 215

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 214 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 156

---

>ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611513), mRNA
          Length = 450

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 448 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 389

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 388 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 329

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 328 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 269

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 268 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 209

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 208 gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 149

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 148 gaccagacat 139

---

>ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611490), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  gaccagacat 1

---

>ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611106), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  gaccagacat 1

---

>ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488260), mRNA
          Length = 312

 Score =  400 bits (202), Expect = e-108
 Identities = 283/310 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 250 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 190 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 70  gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  gaccagacat 1

---

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  398 bits (201), Expect = e-108
 Identities = 285/313 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 429 tagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatg 370

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||||||   ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 369 gccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttc 310

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 309 tccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 250

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || ||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 249 acgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcg 190

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| ||||| ||||||||||| ||||||||||||||||| || |||||||| 
Sbjct: 189 cgcagcaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcct 130

                        
Query: 531 cgcccggacatgg 543
           |  ||||||||||
Sbjct: 129 ctgccggacatgg 117



 Score =  391 bits (197), Expect = e-105
 Identities = 284/313 (90%)
 Strand = Plus / Plus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 4289 tagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagaccacgtccatg 4348

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            || ||||| ||||||||   ||||||||||||||||||||||||||||||||| ||||||
Sbjct: 4349 gccgtgaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttc 4408

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || ||||| | ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 4409 tccaggaacaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 4468

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            |||||||| || || ||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 4469 acgccgccgcgccgcgccaggcgccggatggccggcttggtgatgccctggatgttgtcg 4528

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            |||| |||||| ||||| ||||||||||| ||||||||||||||||| || |||||||| 
Sbjct: 4529 cgcaacaccttgcggtgccgcttggcgccccccttgccgagccccttcccgcccttgcct 4588

                         
Query: 531  cgcccggacatgg 543
            |  ||||||||||
Sbjct: 4589 ctgccggacatgg 4601

---

>ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488265), mRNA
          Length = 714

 Score =  396 bits (200), Expect = e-107
 Identities = 281/308 (91%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 707 ccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtg 648

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 647 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccagg 588

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 587 aacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccg 528

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || || || |||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 527 ccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagc 468

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| |||||||||||||||||||||||||| |||||||| || ||||||||||| || 
Sbjct: 467 accttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgcgacca 408

                   
Query: 537 gacatggc 544
           ||||||||
Sbjct: 407 gacatggc 400

---

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC417953), mRNA
          Length = 2271

 Score =  394 bits (199), Expect = e-106
 Identities = 271/295 (91%)
 Strand = Plus / Minus

                                                                       
Query: 235 cgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcgg 294
           ||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| |
Sbjct: 640 cgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggccg 581

                                                                       
Query: 295 tgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcga 354
           |||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 580 tgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcca 521

                                                                       
Query: 355 ggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgc 414
           |||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||
Sbjct: 520 ggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacgc 461

                                                                       
Query: 415 cgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgca 474
           |||| || || ||||| || ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 460 cgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgca 401

                                                                  
Query: 475 gcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||| ||||||||||||||||||||||| ||||||||||| || ||||||||
Sbjct: 400 gcaccttgcggtggcgcttggcgccgcccttaccgagccccttcccgcccttgcc 346

---

>ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611148), mRNA
          Length = 312

 Score =  394 bits (199), Expect = e-106
 Identities = 274/299 (91%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| ||||||
Sbjct: 251 gccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 191 tccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttg 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || || |||||||||||||| || |||||||||||||||||||||||||||
Sbjct: 131 acgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcg 72

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 13

---

>ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611486), mRNA
          Length = 444

 Score =  391 bits (197), Expect = e-105
 Identities = 275/301 (91%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 442 agccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatgg 383

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 382 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 323

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 322 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 263

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 262 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 203

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||
Sbjct: 202 gcagcaccttgcggtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgc 143

            
Query: 532 g 532
           |
Sbjct: 142 g 142

---

>gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 H4h-like mRNA,
           complete sequence
          Length = 874

 Score =  389 bits (196), Expect = e-105
 Identities = 283/312 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||
Sbjct: 350 tagccgccgaagccgtagagggtgcgaccctggcgcttgagggcgtagaccacgtccatg 291

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||| |    ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 290 gccgtgaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 231

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| 
Sbjct: 230 tccaggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttg 171

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| || |||||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 170 acgccgccgcgccgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 111

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||| 
Sbjct: 110 cgcagcaccttgcggtggcgcttggcgccgcccttgccgagccctttgccgcccttgccc 51

                       
Query: 531 cgcccggacatg 542
           || || ||||||
Sbjct: 50  cggccagacatg 39

---

>gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complete cds
          Length = 1481

 Score =  389 bits (196), Expect = e-105
 Identities = 271/296 (91%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||||||||||||  |||||||||||||||||||||| ||||||||||| 
Sbjct: 671 ccgccgaagccgtagagggtgcgttcctggcgcttgagcgcgtagaccacgtccatggcc 612

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 611 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcc 552

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 551 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgaaatgcgcttgacg 492

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           ||||| || || ||||| || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 491 ccgccgcgccgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcgcgc 432

                                                                   
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 431 agcaccttgcggtggcgcttggcgccgcccttgccgagccccttcccgcccttgcc 376

---

>ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
            (LOC611231), mRNA
          Length = 1428

 Score =  385 bits (194), Expect = e-103
 Identities = 281/310 (90%)
 Strand = Plus / Minus

                                                                        
Query: 232  agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
            |||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 1426 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcatagaccacgtccatgg 1367

                                                                        
Query: 292  cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 1366 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 1307

                                                                        
Query: 352  cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
            | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 1306 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 1247

                                                                        
Query: 412  cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
            ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 1246 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 1187

                                                                        
Query: 472  gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
            |||||||||| |||||||||||||||||||||||||| || ||||| || ||||||||||
Sbjct: 1186 gcagcaccttgcggtggcgcttggcgccgcccttgcctagtcccttcccgcccttgccgc 1127

                      
Query: 532  gcccggacat 541
            | || |||||
Sbjct: 1126 gaccagacat 1117

---

>ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611344), mRNA
          Length = 456

 Score =  379 bits (191), Expect = e-102
 Identities = 263/287 (91%)
 Strand = Plus / Minus

                                                                       
Query: 243 ccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtc 302
           |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||
Sbjct: 443 ccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggccgtgaccgtc 384

                                                                       
Query: 303 ttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatc 362
           |||||   ||||||||| ||||||||||||||||| ||||| |||||||| ||||| | |
Sbjct: 383 ttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttctccaggaacacc 324

                                                                       
Query: 363 ttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgg 422
           |||||||| ||||||||||||||||||||||| |||||||||||||| |||||||| || 
Sbjct: 323 ttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgc 264

                                                                       
Query: 423 cgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttc 482
           || |||||||||||||| || |||||||||||||||||||||||||||||||||||||| 
Sbjct: 263 cgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttg 204

                                                          
Query: 483 cggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           |||||||||||||||||||||||||| |||||||| || ||||||||
Sbjct: 203 cggtggcgcttggcgccgcccttgcccagccccttcccgcccttgcc 157

---

>ref|XM_848834.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC611192), mRNA
          Length = 405

 Score =  377 bits (190), Expect = e-101
 Identities = 256/278 (92%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 403 agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 344

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||| ||||||||   ||||||||| ||||||||||||||||| ||||| |||||||
Sbjct: 343 ccgtgaccgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcccggatcacgttct 284

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 283 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttga 224

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| || || |||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 223 cgccgccgcgccgggccagccgccggatggcgggcttggtgatgccctggatgttgtcgc 164

                                                 
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccg 509
           |||||||||| |||||||||||||||||||||||||||
Sbjct: 163 gcagcaccttgcggtggcgcttggcgccgcccttgccg 126

---

>gb|BT017111.1| Zea mays clone EL01N0363F03.c mRNA sequence
          Length = 525

 Score =  367 bits (185), Expect = 3e-98
 Identities = 272/301 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
           ||||||||||||| || ||||| |||||||||||||| ||||| ||||| ||||||||||
Sbjct: 367 cctagccgccgaagccatagagagtgcggccctggcgtttgagggcgtacacgacgtcca 308

                                                                       
Query: 289 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
           | ||||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| |
Sbjct: 307 tagcggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgacat 248

                                                                       
Query: 349 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
           ||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 247 tctcgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 188

                                                                       
Query: 409 tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
           ||||||| || |  |  ||||||| ||||||||||||||| ||||| |||||||||||||
Sbjct: 187 tcacgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 128

                                                                       
Query: 469 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
           ||||||||||||||||||| ||||| ||||||||||| |||||||||||||| |||||||
Sbjct: 127 cgcgcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgcccttgc 68

            
Query: 529 c 529
           |
Sbjct: 67  c 67

---

>gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8
          Length = 675

 Score =  365 bits (184), Expect = 1e-97
 Identities = 268/296 (90%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 578 ccgccgaagccgtagagggtgcgtccctggcgcttgagcgcgtagaccacgtccatggcc 519

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||| |    |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 518 gtgaccgtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctca 459

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||
Sbjct: 458 aggaagaccttgagcacgccgcgcgtctcctcgtagatgagccccgagatgcgcttgacg 399

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           ||||| || || ||||| || || || ||||||||||||||||||||||| |||||||||
Sbjct: 398 ccgccgcgccgcgccaggcggcgaatggccggcttggtgatgccctggatattgtcgcgc 339

                                                                   
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           |||||||| |||||||||||||| || || |||||||||||||| || ||||||||
Sbjct: 338 agcaccttgcggtggcgcttggcaccccctttgccgagccccttcccgcccttgcc 283

---

>gb|BT017112.1| Zea mays clone EL01N0363G04.c mRNA sequence
          Length = 666

 Score =  359 bits (181), Expect = 7e-96
 Identities = 271/301 (90%)
 Strand = Plus / Minus

                                                                       
Query: 229 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
           ||||||||||||| || || || |||||||||||||| ||||| ||||| ||||||||||
Sbjct: 387 cctagccgccgaagccataaagagtgcggccctggcgtttgagggcgtacacgacgtcca 328

                                                                       
Query: 289 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
           | ||||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| |
Sbjct: 327 tagcggtgacggttttgcgacgggcgtgctccgtgtaggtcacagcgtcgcggatgacat 268

                                                                       
Query: 349 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
           ||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 267 tctcgagaaagatcttgagcacgccgcgggtctcctcgtagatcagcccggagatgcgct 208

                                                                       
Query: 409 tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
           ||||||| || |  |  ||||||| ||||||||||||||| ||||| |||||||||||||
Sbjct: 207 tcacgccacccctcctcgccagcctccggatcgccggcttcgtgatcccctggatgttgt 148

                                                                       
Query: 469 cgcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
           ||||||||||||||||||| ||||| ||||||||||| |||||||||||||| |||||||
Sbjct: 147 cgcgcagcaccttccggtgacgcttcgcgccgcccttcccgagccccttgccgcccttgc 88

            
Query: 529 c 529
           |
Sbjct: 87  c 87

---

>gb|AY105603.1| Zea mays PCO094685 mRNA sequence
          Length = 731

 Score =  359 bits (181), Expect = 7e-96
 Identities = 274/305 (89%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| ||||| || |||||||||||||||||||| ||||| || || ||||||||||||
Sbjct: 385 ccgaacccgtacagagtgcggccctggcgcttgagggcgtacacaacatccatggcggtg 326

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           |||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 325 acggtcttgcggcgagcgtgctcggtgtaggtgaccgcgtcgcggatgacattctcgagg 266

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           ||||||||||||||||||||||| ||||||||||| ||||| ||||| ||||||||||||
Sbjct: 265 aagatcttgagcacgccgcgggtttcctcgtagataagcccggagatacgcttcacgccg 206

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |  |  ||||||| |||||| |||||||| ||||| ||||||||||||||||| || 
Sbjct: 205 cccctcctcgccagcctccggattgccggcttcgtgataccctggatgttgtcgcggaga 146

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| |||||||| || |||||||||||||| ||||||||||| |||||||||||||| 
Sbjct: 145 accttacggtggcgtttcgcgccgcccttgcccagccccttgccgcccttgccgcgccca 86

                
Query: 537 gacat 541
           |||||
Sbjct: 85  gacat 81

---

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4 (ch4-III),
            histone H2B (ch2b-III) and histone H2A (ch2a-III) genes,
            complete cds
          Length = 4582

 Score =  357 bits (180), Expect = 3e-95
 Identities = 279/312 (89%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||| ||||| ||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1466 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1407

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            ||||| |||||||||||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 1406 gcggtcacggtcttgcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttc 1347

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || |||||| |||| |||||   ||||||||||||||||||||| ||   ||| ||||||
Sbjct: 1346 tccaggaaggtcttcagcaccgtgcgggtctcctcgtagatgaggccgctgatacgcttc 1287

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || ||||||||||||||||| || ||||| || ||||| |||||||||||||||||||||
Sbjct: 1286 acaccgccacggcgagccagacggcggatagcgggcttcgtgatgccctggatgttgtcg 1227

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || |||||||| || ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 1226 cggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcca 1167

                        
Query: 531  cgcccggacatg 542
            || |||||||||
Sbjct: 1166 cgtccggacatg 1155

---

>ref|XM_543797.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC486670), mRNA
          Length = 561

 Score =  353 bits (178), Expect = 4e-94
 Identities = 277/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 559 agccgccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatgg 500

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||| ||||||||   ||||||||| |||||||| || ||||||||||| |||||||
Sbjct: 499 cggtgaccgtcttgcgcttggcgtgctccgtgtaggtcaccgcgtcgcggatcacgttct 440

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||||||||| |||||||||||||||||||||||||| || ||||||||||
Sbjct: 439 ccaggaacaccttgagcaccccgcgggtctcctcgtagatgagcccagaaatgcgcttca 380

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           | ||||| ||||| || ||||| ||||| || ||||| |||||||||||||||||||| |
Sbjct: 379 ccccgcctcggcgggcaagccggcggatggcgggcttcgtgatgccctggatgttgtccc 320

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||| ||||||||||||||||||||||| |||||||| ||||| ||||| || || ||||
Sbjct: 319 gcaggaccttccggtggcgcttggcgcctcccttgcccagccctttgccgcctttcccgc 260

                     
Query: 532 gcccggacat 541
           ||||||||||
Sbjct: 259 gcccggacat 250

---

>gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds
          Length = 451

 Score =  353 bits (178), Expect = 4e-94
 Identities = 277/310 (89%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| || || ||||| | |||||| | |||||||||||| |||||||||||||
Sbjct: 310 agccgccgaagccatacagggtcctgccctgcctcttgagcgcgtacacgacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           |||| || ||||| ||||| |||||||| |||||||| |||||||||||||| |||||||
Sbjct: 250 cggtcaccgtcttccggcgcgcgtgctccgtgtaggtcacggcgtcgcggatcacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||||||||| |||||||||||||||||||||||||| |||||   ||| |||||||
Sbjct: 190 ccaggaagatcttcagcacgccgcgggtctcctcgtagatcagcccgctgatccgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           | ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 130 ccccgccacggcgggccagccgccggatcgccggcttcgtgatgccctggatgttgtcgc 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||| ||||| | ||| ||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 70  gcaggacctttctgtgccgcttcgcgccgcccttgccaagccccttgcctcccttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  ggcccgacat 1

---

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  349 bits (176), Expect = 7e-93
 Identities = 278/312 (89%)
 Strand = Plus / Plus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1030 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1089

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 1090 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 1149

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 1150 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 1209

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 1210 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 1269

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 1270 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 1329

                        
Query: 531  cgcccggacatg 542
            || || ||||||
Sbjct: 1330 cgacccgacatg 1341

---

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  349 bits (176), Expect = 7e-93
 Identities = 278/312 (89%)
 Strand = Plus / Minus

                                                                          
Query: 231    tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 127531 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 127472

                                                                          
Query: 291    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 127471 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 127412

                                                                          
Query: 351    tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
              || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 127411 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 127352

                                                                          
Query: 411    acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
              || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 127351 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 127292

                                                                          
Query: 471    cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
              || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 127291 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 127232

                          
Query: 531    cgcccggacatg 542
              || || ||||||
Sbjct: 127231 cgacccgacatg 127220



 Score =  335 bits (169), Expect = 1e-88
 Identities = 271/305 (88%)
 Strand = Plus / Plus

                                                                          
Query: 237    ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
              |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 131053 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 131112

                                                                          
Query: 297    acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
              |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 131113 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 131172

                                                                          
Query: 357    aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
              || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 131173 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 131232

                                                                          
Query: 417    ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
              || || || ||||| || ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 131233 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 131292

                                                                          
Query: 477    accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
              || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 131293 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 131352

                   
Query: 537    gacat 541
              |||||
Sbjct: 131353 gacat 131357

---

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
            complete cds
          Length = 2321

 Score =  349 bits (176), Expect = 7e-93
 Identities = 278/312 (89%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1858 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1799

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 1798 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 1739

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 1738 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 1679

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 1678 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 1619

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 1618 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 1559

                        
Query: 531  cgcccggacatg 542
            || || ||||||
Sbjct: 1558 cgacccgacatg 1547

---

>gb|AY158965.1| Mus musculus histone protein Hist1h4a gene, complete cds
          Length = 1246

 Score =  349 bits (176), Expect = 7e-93
 Identities = 278/312 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 748 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 689

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 688 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 629

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 628 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 569

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 568 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 509

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 508 cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 449

                       
Query: 531 cgcccggacatg 542
           || || ||||||
Sbjct: 448 cgacccgacatg 437

---

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
            genes, complete cds
          Length = 1338

 Score =  349 bits (176), Expect = 7e-93
 Identities = 278/312 (89%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||| ||||| ||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1204 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1145

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            ||||| |||||||| ||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 1144 gcggtcacggtctttcggcgagcgtgctcggtgtaggtgaccgagtcgcggatgacgttc 1085

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || |||||| ||||||||||   |||||||||||||||||| || ||   ||| ||||||
Sbjct: 1084 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttc 1025

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || |||||||| |||||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 1024 acaccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcg 965

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || |||||||| || ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 964  cggagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcca 905

                        
Query: 531  cgcccggacatg 542
            || |||||||||
Sbjct: 904  cgtccggacatg 893

---

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
            histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
            complete cds
          Length = 3777

 Score =  349 bits (176), Expect = 7e-93
 Identities = 278/312 (89%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||| ||||| ||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1279 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1220

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            || || |||||||||||||| |||||||||||||||||||||| ||||||||||||||||
Sbjct: 1219 gcagtcacggtcttgcggcgagcgtgctcggtgtaggtgacggagtcgcggatgacgttc 1160

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || |||||| ||||||||||   |||||||||||||||||| || ||   ||| ||||||
Sbjct: 1159 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccactgatacgcttc 1100

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || ||||||||||||||||| || ||||| || ||||||||||| ||||||||||| |||
Sbjct: 1099 acaccgccacggcgagccagacggcggatagcgggcttggtgatcccctggatgttatcg 1040

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || |||||||| || ||||||||||||||||||||||| || |||||||| |||||||| 
Sbjct: 1039 cgaagcaccttgcgatggcgcttggcgccgcccttgcccaggcccttgccgcccttgcca 980

                        
Query: 531  cgcccggacatg 542
            || |||||||||
Sbjct: 979  cgtccggacatg 968

---

>ref|NM_178192.1| Mus musculus histone 1, H4a (Hist1h4a), mRNA
          Length = 312

 Score =  347 bits (175), Expect = 3e-92
 Identities = 277/311 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 72

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           || || ||||| ||||||||||| |||||||| ||||| || || || ||||||||||||
Sbjct: 71  cggagaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttgccg 12

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 11  cgacccgacat 1

---

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
            histone H2A genes, complete cds
          Length = 4358

 Score =  341 bits (172), Expect = 2e-90
 Identities = 277/312 (88%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||| ||||| ||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1271 tagccaccgaagccgtacagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 1212

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            ||||| |||||||||||||| |||||||||||||| ||||| | ||||||||||||||||
Sbjct: 1211 gcggtcacggtcttgcggcgagcgtgctcggtgtatgtgaccgagtcgcggatgacgttc 1152

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || |||||| ||||||||||   |||||||||||||||||| || ||   ||| ||||||
Sbjct: 1151 tccaggaaggtcttgagcaccgtgcgggtctcctcgtagatcaggccgctgatacgcttc 1092

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || |||||||| |||||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 1091 acaccgccacgacgagccagacggcggatagcgggcttggtgatgccctggatgttgtcg 1032

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            || |||||||| || ||||||||||| ||||||||||| || |||||||| |||||||| 
Sbjct: 1031 cgaagcaccttgcgatggcgcttggcaccgcccttgcccaggcccttgccgcccttgcca 972

                        
Query: 531  cgcccggacatg 542
            || |||||||||
Sbjct: 971  cgtccggacatg 960

---

>ref|NM_153173.1| Mus musculus histone 1, H4h (Hist1h4h), mRNA
          Length = 472

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 75  ccagacatgg 66

---

>gb|BC058529.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:6817839),
           partial cds
          Length = 457

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 316 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 257

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 256 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 197

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 196 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 137

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 77

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 76  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 17

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 16  ccagacatgg 7

---

>gb|BC028550.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:1398106),
           partial cds
          Length = 439

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 140 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 81

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 21

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 20  ccagacatgg 11

---

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Plus

                                                                          
Query: 234    ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 103956 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 104015

                                                                          
Query: 294    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 104016 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 104075

                                                                          
Query: 354    aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
              ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 104076 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 104135

                                                                          
Query: 414    ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
              || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 104136 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 104195

                                                                          
Query: 474    agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
              ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 104196 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 104255

                        
Query: 534    ccggacatgg 543
              || |||||||
Sbjct: 104256 ccagacatgg 104265



 Score =  325 bits (164), Expect = 1e-85
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                         
Query: 234   ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 84042 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 83983

                                                                         
Query: 294   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 83982 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 83923

                                                                         
Query: 354   aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
             ||||| | ||| ||||| |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 83922 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 83863

                                                                         
Query: 414   ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
             || || || || ||||| || ||||| || ||||||||||||||||||||||| ||||| 
Sbjct: 83862 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 83803

                                                                         
Query: 474   agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
             || ||||| ||||||||||| |||||||| ||||| || || || |||||||| || || 
Sbjct: 83802 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 83743

                         
Query: 534   ccggacatggct 545
             || |||||||||
Sbjct: 83742 ccagacatggct 83731



 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Plus

                                                                         
Query: 231   tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
             |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 53466 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 53525

                                                                         
Query: 291   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
             |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 53526 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 53585

                                                                         
Query: 351   tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
             || ||||| | ||| ||||| || |||||||||||||||||||| || ||||||||||||
Sbjct: 53586 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 53645

                                                                         
Query: 411   acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
             || || || || || ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 53646 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 53705

                                                                         
Query: 471   cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
             ||||| || || ||||||||||| || || ||||| || || |||||||| || || |||
Sbjct: 53706 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 53765

                         
Query: 531   cgcccggacatg 542
             || || ||||||
Sbjct: 53766 cgtccagacatg 53777

---

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                         
Query: 234   ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 12024 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 11965

                                                                         
Query: 294   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 11964 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 11905

                                                                         
Query: 354   aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
             ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 11904 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 11845

                                                                         
Query: 414   ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
             || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 11844 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 11785

                                                                         
Query: 474   agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
             ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 11784 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 11725

                       
Query: 534   ccggacatgg 543
             || |||||||
Sbjct: 11724 ccagacatgg 11715



 Score =  325 bits (164), Expect = 1e-85
 Identities = 275/312 (88%)
 Strand = Plus / Plus

                                                                         
Query: 234   ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 31942 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 32001

                                                                         
Query: 294   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 32002 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 32061

                                                                         
Query: 354   aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
             ||||| | ||| ||||| |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 32062 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 32121

                                                                         
Query: 414   ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
             || || || || ||||| || ||||| || ||||||||||||||||||||||| ||||| 
Sbjct: 32122 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 32181

                                                                         
Query: 474   agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
             || ||||| ||||||||||| |||||||| ||||| || || || |||||||| || || 
Sbjct: 32182 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 32241

                         
Query: 534   ccggacatggct 545
             || |||||||||
Sbjct: 32242 ccagacatggct 32253



 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Minus

                                                                         
Query: 231   tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
             |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 62327 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 62268

                                                                         
Query: 291   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
             |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 62267 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 62208

                                                                         
Query: 351   tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
             || ||||| | ||| ||||| || |||||||||||||||||||| || ||||||||||||
Sbjct: 62207 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 62148

                                                                         
Query: 411   acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
             || || || || || ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 62147 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 62088

                                                                         
Query: 471   cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
             ||||| || || ||||||||||| || || ||||| || || |||||||| || || |||
Sbjct: 62087 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 62028

                         
Query: 531   cgcccggacatg 542
             || || ||||||
Sbjct: 62027 cgtccagacatg 62016



 Score =  295 bits (149), Expect = 9e-77
 Identities = 239/269 (88%)
 Strand = Plus / Plus

                                                                          
Query: 234    ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
              ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 178557 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 178616

                                                                          
Query: 294    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
              ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 178617 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 178676

                                                                          
Query: 354    aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
              ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 178677 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 178736

                                                                          
Query: 414    ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
              || || || || ||||| || ||||| || |||||||| |||||||||||||| || || 
Sbjct: 178737 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 178796

                                           
Query: 474    agcaccttccggtggcgcttggcgccgcc 502
              || ||||| ||||||||||| ||||||||
Sbjct: 178797 agaaccttacggtggcgcttagcgccgcc 178825

---

>gb|BC087952.1| Mus musculus histone 1, H4h, mRNA (cDNA clone MGC:107599
           IMAGE:6787571), complete cds
          Length = 472

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 368 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 309

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 308 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 249

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 248 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 189

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 188 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 129

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 128 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 69

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 68  ccagacatgg 59

---

>dbj|AK007642.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
           enriched library, clone:1810029H14 product:histone 4
           protein, full insert sequence
          Length = 472

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 375 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 316

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 315 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 256

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 255 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 196

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 195 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 136

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 135 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 76

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 75  ccagacatgg 66

---

>gb|AY158960.1| Mus musculus histone protein Hist1h4h gene, complete cds
          Length = 1470

 Score =  337 bits (170), Expect = 3e-89
 Identities = 275/310 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 873 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 814

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 813 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 754

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 753 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 694

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||| |||||||||||||||||||| |||
Sbjct: 693 cccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcacgc 634

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || || |||||||| || 
Sbjct: 633 agcactttgcggtggcgcttggcgccgcctttgccaagacctttaccgcccttgccacga 574

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 573 ccagacatgg 564

---

>ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA
          Length = 312

 Score =  335 bits (169), Expect = 1e-88
 Identities = 271/305 (88%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 305 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || || || ||||| || ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 125 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 66

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 65  actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 6

                
Query: 537 gacat 541
           |||||
Sbjct: 5   gacat 1

---

>dbj|AK016310.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930578O05 product:histone 4 protein,
           full insert sequence
          Length = 541

 Score =  335 bits (169), Expect = 1e-88
 Identities = 278/313 (88%), Gaps = 1/313 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 385 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 326

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 325 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 266

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 265 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 206

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 205 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 146

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgc-ccttgccgagccccttgcctcccttgcc 529
           || || ||||| ||||||||||| ||||||| | ||||| || || || |||||||||||
Sbjct: 145 cggagaaccttacggtggcgcttagcgccgcgctttgcccaggccttttcctcccttgcc 86

                        
Query: 530 gcgcccggacatg 542
           ||| || ||||||
Sbjct: 85  gcgacccgacatg 73

---

>gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, complete cds
          Length = 1186

 Score =  335 bits (169), Expect = 1e-88
 Identities = 271/305 (88%)
 Strand = Plus / Plus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 505 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcggtg 564

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 565 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 624

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 625 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactccc 684

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || || || ||||| || ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 685 ccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcgcgcagc 744

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 745 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 804

                
Query: 537 gacat 541
           |||||
Sbjct: 805 gacat 809

---

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
             genes for H2b histone family member A, two H2a, two H4 and
             an H2b histone family member, a serine/threonine protein
             kinase pseudogene, a novel pseudogene, a novel gene
             (4930500C15Rik), the gene for a novel KRAB box and C2H2
             Zinc Finger containing protein, a ribosomal protein L21
             (RPL21) pseudogene, a TU mitochondrial translation
             elongation factor (tufa) pseudogene, the 5' end of the
             gene for a novel protein similar to nuclear envelope pore
             membrane protein POM121 and four CpG islands, complete
             sequence
          Length = 182817

 Score =  333 bits (168), Expect = 4e-88
 Identities = 276/312 (88%)
 Strand = Plus / Plus

                                                                         
Query: 231   tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 32015 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 32074

                                                                         
Query: 291   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
             |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 32075 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 32134

                                                                         
Query: 351   tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
             || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 32135 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 32194

                                                                         
Query: 411   acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
             || || || || || ||||| || ||||| || ||||| ||||||||||||||||| |||
Sbjct: 32195 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 32254

                                                                         
Query: 471   cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
             |||||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| 
Sbjct: 32255 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 32314

                         
Query: 531   cgcccggacatg 542
             || || ||||||
Sbjct: 32315 cgaccagacatg 32326



 Score =  333 bits (168), Expect = 4e-88
 Identities = 276/312 (88%)
 Strand = Plus / Minus

                                                                         
Query: 231   tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 12261 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 12202

                                                                         
Query: 291   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
             |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 12201 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 12142

                                                                         
Query: 351   tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
             || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 12141 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 12082

                                                                         
Query: 411   acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
             || || || || || ||||| || ||||| || ||||| ||||||||||||||||| |||
Sbjct: 12081 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 12022

                                                                         
Query: 471   cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
             |||||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| 
Sbjct: 12021 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 11962

                         
Query: 531   cgcccggacatg 542
             || || ||||||
Sbjct: 11961 cgaccagacatg 11950

---

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  333 bits (168), Expect = 4e-88
 Identities = 255/284 (89%)
 Strand = Plus / Plus

                                                                          
Query: 231    tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
              ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 171185 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 171244

                                                                          
Query: 291    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 171245 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 171304

                                                                          
Query: 351    tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
              || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 171305 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 171364

                                                                          
Query: 411    acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
              || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 171365 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 171424

                                                          
Query: 471    cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
              |||||||| || ||||||||||||||||| || || ||||||||
Sbjct: 171425 cgcagcactttgcggtggcgcttggcgccacctttaccgagccc 171468



 Score =  325 bits (164), Expect = 1e-85
 Identities = 254/284 (89%)
 Strand = Plus / Minus

                                                                          
Query: 231    tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
              ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 156396 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 156337

                                                                          
Query: 291    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
              |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 156336 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 156277

                                                                          
Query: 351    tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
              || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 156276 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 156217

                                                                          
Query: 411    acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
              || || || || || ||||| || ||||| || ||||| |||||||||||||||||||||
Sbjct: 156216 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 156157

                                                          
Query: 471    cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
              |||||||| || ||||||||||| ||||| || || ||||||||
Sbjct: 156156 cgcagcactttgcggtggcgcttagcgccacctttaccgagccc 156113

---

>dbj|AK139521.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020002O07 product:histone 1, H4j, full insert
           sequence
          Length = 594

 Score =  333 bits (168), Expect = 4e-88
 Identities = 255/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 346 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 287

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 286 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 227

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 226 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 167

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 166 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 107

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||||||||| || || ||||||||
Sbjct: 106 cgcagcactttgcggtggcgcttggcgccacctttaccgagccc 63

---

>gb|BC096767.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:30094179)
          Length = 3447

 Score =  333 bits (168), Expect = 4e-88
 Identities = 255/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 326 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 267

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 266 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 207

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 206 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 147

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 146 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 87

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||||||||| || || ||||||||
Sbjct: 86  cgcagcactttgcggtggcgcttggcgccacctttaccgagccc 43

---

>gb|AY158958.1| Mus musculus histone protein Hist1h4m gene, complete cds
          Length = 1309

 Score =  333 bits (168), Expect = 4e-88
 Identities = 276/312 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 811 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 752

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||| ||||||||||||||||| |||
Sbjct: 631 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 572

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           |||||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| 
Sbjct: 571 cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcca 512

                       
Query: 531 cgcccggacatg 542
           || || ||||||
Sbjct: 511 cgaccagacatg 500

---

>gb|AY158957.1| Mus musculus histone protein Hist1h4k gene, complete cds
          Length = 1309

 Score =  333 bits (168), Expect = 4e-88
 Identities = 255/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 811 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 752

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 631 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 572

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||||||||| || || ||||||||
Sbjct: 571 cgcagcactttgcggtggcgcttggcgccacctttaccgagccc 528

---

>ref|NM_178211.1| Mus musculus histone 1, H4k (Hist1h4k), mRNA
          Length = 312

 Score =  333 bits (168), Expect = 4e-88
 Identities = 255/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagcctccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||||||||||||||||||||| |||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcg 72

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||||||||| || || ||||||||
Sbjct: 71  cgcagcactttgcggtggcgcttggcgccacctttaccgagccc 28

---

>ref|NM_175657.1| Mus musculus histone 1, H4m (Hist1h4m), mRNA
          Length = 312

 Score =  331 bits (167), Expect = 2e-87
 Identities = 266/299 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacagtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||| ||||||||||||||||| |||
Sbjct: 131 actcctccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttatcg 72

                                                                      
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           |||||||| || |||||||||||||||||||| ||||| || || || ||||| |||||
Sbjct: 71  cgcagcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgcc 13

---

>gb|AF140034.1|AF140034 Phreatamoeba balamuthi histone H4 mRNA, complete cds
          Length = 394

 Score =  327 bits (165), Expect = 2e-86
 Identities = 243/269 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||
Sbjct: 326 tagccgccgaagccgtagagcgtgcggccctggcgcttgagcgcgtagacaacgtccatg 267

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| |||||||| | ||||||||| ||||| ||||| | ||||||||||||||||
Sbjct: 266 gccgtgaccgtcttgcgcctggcgtgctccgtgtacgtgaccgagtcgcggatgacgttc 207

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           |||||||||| ||||||||||||||| ||||||||||||||||||||   ||||||||| 
Sbjct: 206 tcgaggaagaccttgagcacgccgcgcgtctcctcgtagatgagcccgctgatgcgcttg 147

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           ||||| || ||||| ||||| || ||||| ||||||||||||||||||||||||||||||
Sbjct: 146 acgcccccgcggcgcgccaggcggcggatggccggcttggtgatgccctggatgttgtcg 87

                                        
Query: 471 cgcagcaccttccggtggcgcttggcgcc 499
           ||||||||||| ||||| | |||||||||
Sbjct: 86  cgcagcaccttgcggtgcctcttggcgcc 58



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 514 ccttgcctcccttgccgcgcccgg 537
           ||||||||||||||||||| ||||
Sbjct: 28  ccttgcctcccttgccgcgtccgg 5

---

>ref|NM_178210.1| Mus musculus histone 1, H4j (Hist1h4j), mRNA
          Length = 312

 Score =  325 bits (164), Expect = 1e-85
 Identities = 254/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||| |||||||||||||||||||||
Sbjct: 131 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 72

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||| ||||| || || ||||||||
Sbjct: 71  cgcagcactttgcggtggcgcttagcgccacctttaccgagccc 28

---

>gb|AY158961.1| Mus musculus histone protein Hist1h4f gene, complete cds
          Length = 1309

 Score =  325 bits (164), Expect = 1e-85
 Identities = 275/312 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 629

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||||||||||||||||||||| ||||| 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 569

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           || ||||| ||||||||||| |||||||| ||||| || || || |||||||| || || 
Sbjct: 568 agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctcccttaccacga 509

                       
Query: 534 ccggacatggct 545
           || |||||||||
Sbjct: 508 ccagacatggct 497

---

>gb|AY158956.1| Mus musculus histone protein Hist1h4j gene, complete cds
          Length = 1776

 Score =  325 bits (164), Expect = 1e-85
 Identities = 254/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 845 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 786

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 785 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 726

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 725 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 666

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || ||||| |||||||||||||||||||||
Sbjct: 665 actcccccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcg 606

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||| ||||| || || ||||||||
Sbjct: 605 cgcagcactttgcggtggcgcttagcgccacctttaccgagccc 562

---

>emb|CR719166.2|CNS0GHUS Tetraodon nigroviridis full-length cDNA
          Length = 522

 Score =  321 bits (162), Expect = 1e-84
 Identities = 267/302 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||| ||||| ||||| |||||||| ||||| |||||||||||||| || || ||||||
Sbjct: 344 tagcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatg 285

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||| |    |||||||||||||||||||||||| || ||||| ||||||
Sbjct: 284 gcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttc 225

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 224 tccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttg 165

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| ||||||||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 164 acgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 105

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           || |||||||| ||||||||||||||||| || ||||| || || |||||||| ||||||
Sbjct: 104 cggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccg 45

             
Query: 531 cg 532
           ||
Sbjct: 44  cg 43

---

>emb|CR707537.2|CNS0G8VX Tetraodon nigroviridis full-length cDNA
          Length = 625

 Score =  321 bits (162), Expect = 1e-84
 Identities = 267/302 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||| ||||| ||||| |||||||| ||||| |||||||||||||| || || ||||||
Sbjct: 444 tagcctccgaagccgtacagggtgcgtccctgccgcttgagcgcgtacaccacatccatg 385

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||| |    |||||||||||||||||||||||| || ||||| ||||||
Sbjct: 384 gcggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttc 325

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||||||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 324 tccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttg 265

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| ||||||||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 264 acgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 205

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           || |||||||| ||||||||||||||||| || ||||| || || |||||||| ||||||
Sbjct: 204 cggagcaccttgcggtggcgcttggcgcctcctttgcccaggcctttgcctcctttgccg 145

             
Query: 531 cg 532
           ||
Sbjct: 144 cg 143

---

>ref|NM_175655.1| Mus musculus histone 1, H4f (Hist1h4f), mRNA
          Length = 312

 Score =  319 bits (161), Expect = 6e-84
 Identities = 260/293 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| |||||||| |||||||||||||| || |||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtttcctcgtagatgagaccggagatgcgcttcact 129

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||||||||||||||||||||| ||||| 
Sbjct: 128 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttatcgcga 69

                                                                
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
           || ||||| ||||||||||| |||||||| ||||| || || || ||||||||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttgcccaggccttttcctccctt 16

---

>dbj|AK010085.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310067E17 product:histone 4 protein,
           full insert sequence
          Length = 778

 Score =  317 bits (160), Expect = 2e-83
 Identities = 253/284 (89%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 347 tagccgccgaacccgtagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 288

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 287 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 228

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 227 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 168

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || |||||  | ||||| |||||||||||||||||||||
Sbjct: 167 actcccccgcgccgggccaggcggcggatgacgggcttcgtgatgccctggatgttgtcg 108

                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccc 514
           |||||||| || ||||||||||| ||||| || || ||||||||
Sbjct: 107 cgcagcactttgcggtggcgcttagcgccacctttaccgagccc 64

---

>gb|AY158962.1| Mus musculus histone protein Hist1h4d gene, complete cds
          Length = 1309

 Score =  317 bits (160), Expect = 2e-83
 Identities = 274/312 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 811 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 752

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 751 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 692

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| || |||||||||||||||||||| || ||||||||||||
Sbjct: 691 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 632

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 631 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 572

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||| || || ||||||||||| || || ||||| || || |||||||| || || |||
Sbjct: 571 cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 512

                       
Query: 531 cgcccggacatg 542
           || || ||||||
Sbjct: 511 cgtccagacatg 500

---

>ref|NM_175654.1| Mus musculus histone 1, H4d (Hist1h4d), mRNA
          Length = 312

 Score =  315 bits (159), Expect = 9e-83
 Identities = 273/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaatccgtagagggtgcgaccctggcgcttgagcgcgtagacaacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 251 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| || |||||||||||||||||||| || ||||||||||||
Sbjct: 191 tccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 131 actcctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 72

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||| || || ||||||||||| || || ||||| || || |||||||| || || |||
Sbjct: 71  cgcagaactttgcggtggcgcttagcaccacccttaccaagacccttgccgcctttcccg 12

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 11  cgtccagacat 1

---

>gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408
          Length = 392

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 24  gacatg 19

---

>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6
          Length = 91567

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Plus

                                                                         
Query: 237   ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 70023 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 70082

                                                                         
Query: 297   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 70083 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 70142

                                                                         
Query: 357   aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 70143 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 70202

                                                                         
Query: 417   ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
             || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 70203 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 70262

                                                                         
Query: 477   accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
             || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 70263 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 70322

                   
Query: 537   gacatg 542
             ||||||
Sbjct: 70323 gacatg 70328



 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                         
Query: 237   ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 63229 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 63170

                                                                         
Query: 297   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 63169 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 63110

                                                                         
Query: 357   aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 63109 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 63050

                                                                         
Query: 417   ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
             || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 63049 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 62990

                                                                         
Query: 477   accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
             || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 62989 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 62930

                   
Query: 537   gacatg 542
             ||||||
Sbjct: 62929 gacatg 62924



 Score =  204 bits (103), Expect = 2e-49
 Identities = 259/311 (83%)
 Strand = Plus / Minus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             ||||||| || || || ||||||||||||||||||||||||||||| || ||||||||||
Sbjct: 21251 agccgccaaagccatacagggtgcggccctggcgcttgagcgcgtaaaccacgtccatgg 21192

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             | ||||| ||||||||   ||||||||| |||||||| || || |||||||| || ||||
Sbjct: 21191 ctgtgactgtcttgcgtttggcgtgctccgtgtaggtaactgcatcgcggattacattct 21132

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             | |  || |  || || || ||||| ||||||||||| || || || ||||||||||| |
Sbjct: 21131 ccaaaaacactttaagaactccgcgtgtctcctcgtatataaggcctgagatgcgcttaa 21072

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             |||| ||||| || ||||| || ||||| || ||||||||||||||||| ||||||||||
Sbjct: 21071 cgcctccacgccgtgccaggcgtcggatggcgggcttggtgatgccctgaatgttgtcgc 21012

                                                                         
Query: 472   gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
             |||| || || ||||||||||| ||||| || ||||| || ||||| || || |||||||
Sbjct: 21011 gcagaactttgcggtggcgcttagcgcctcctttgcccagacccttcccgcctttgccgc 20952

                        
Query: 532   gcccggacatg 542
             |||| ||||||
Sbjct: 20951 gcccagacatg 20941

---

>gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, complete cds
          Length = 930

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 315 gacatg 310

---

>gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, complete cds
          Length = 930

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 616 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 557

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 556 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 497

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 496 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 437

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 436 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 377

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 376 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 317

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 316 gacatg 311

---

>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2
             Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs,
             STSs, GSSs and three CpG islands, complete sequence
          Length = 24706

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Plus

                                                                         
Query: 237   ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 19570 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 19629

                                                                         
Query: 297   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 19630 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 19689

                                                                         
Query: 357   aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 19690 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 19749

                                                                         
Query: 417   ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
             || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 19750 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 19809

                                                                         
Query: 477   accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
             || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 19810 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 19869

                   
Query: 537   gacatg 542
             ||||||
Sbjct: 19870 gacatg 19875



 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                         
Query: 237   ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
             ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 12776 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 12717

                                                                         
Query: 297   acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
             || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 12716 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 12657

                                                                         
Query: 357   aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
             || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 12656 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 12597

                                                                         
Query: 417   ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
             || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 12596 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 12537

                                                                         
Query: 477   accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
             || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 12536 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 12477

                   
Query: 537   gacatg 542
             ||||||
Sbjct: 12476 gacatg 12471

---

>emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone
          Length = 859

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 615 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 556

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 555 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 496

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 495 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 436

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 435 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 376

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 375 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 316

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 315 gacatg 310

---

>emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone
          Length = 1528

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 916 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 857

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 856 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 797

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 796 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 737

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 736 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 677

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 676 actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 617

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 616 gacatg 611

---

>emb|X13235.1|MMHIS412 Mouse histone H4 gene (clone 12)
          Length = 637

 Score =  313 bits (158), Expect = 4e-82
 Identities = 272/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 541 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 482

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 481 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 422

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 421 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 362

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || ||||||||||||||||||||||| ||||| 
Sbjct: 361 cccccgcgccgggccaggcggcggatggcaggcttggtgatgccctggatgttatcgcgg 302

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           || ||||| ||||||||||| |||||||| || || || || || || |||||||| || 
Sbjct: 301 agaaccttacggtggcgcttagcgccgcctttcccaaggcctttaccacccttgccacgt 242

                     
Query: 534 ccggacatgg 543
           || |||||||
Sbjct: 241 ccagacatgg 232

---

>gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, complete cds
          Length = 416

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 324 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 265

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 264 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 205

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 204 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 145

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 144 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 85

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 84  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 25

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 24  gacatg 19

---

>gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA clone ZE16D01
          Length = 382

 Score =  313 bits (158), Expect = 4e-82
 Identities = 269/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 322 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 263

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 262 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 203

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 202 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 143

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 142 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 83

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 82  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 23

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 22  gacatg 17

---

>ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA
          Length = 356

 Score =  311 bits (157), Expect = 1e-81
 Identities = 268/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 537 gacat 541
           |||||
Sbjct: 5   gacat 1

---

>ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA
          Length = 354

 Score =  311 bits (157), Expect = 1e-81
 Identities = 268/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 305 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 185 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||| 
Sbjct: 125 ccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatattgtcgcgcagt 66

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 65  actttacggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 6

                
Query: 537 gacat 541
           |||||
Sbjct: 5   gacat 1

---

>dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-19327, similar to human
           histone 1, H4j (HIST1H4J), mRNA, RefSeq: NM_021968.3
          Length = 2002

 Score =  311 bits (157), Expect = 1e-81
 Identities = 271/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| |||||||||||||| ||||||||||| |||||||| || || |||||||||
Sbjct: 393 ccgccgaaaccgtagagggtgcgaccctggcgcttcagcgcgtaaaccacatccatggcg 334

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||||||   ||||||||| |||||||| || ||||| ||||| |||||||| 
Sbjct: 333 gtgaccgtcttgcgcttggcgtgctccgtgtaggtcacagcgtcccggatcacgttctcc 274

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           |||||||  || ||||| || |||||||||||||||||||| || |||||||||||||||
Sbjct: 273 aggaagactttcagcaccccacgggtctcctcgtagatgagaccagagatgcgcttcacg 214

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           ||||| |||||||| || |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 213 ccgccgcggcgagcaaggcgccggatggccggcttggtgatgccctggatgttgtcacgc 154

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           |||||||| ||||||||||| |||||||| ||||| || ||||| || || |||||||| 
Sbjct: 153 agcaccttgcggtggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcgg 94

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 93  ccagacatg 85

---

>ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (predicted)
            (Hist1h2bm_predicted), mRNA
          Length = 1023

 Score =  309 bits (156), Expect = 6e-81
 Identities = 273/312 (87%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||| ||||| || |||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 1013 tagccaccgaagccatagagggtacggccctggcgcttgagcgcgtagaccacgtccatg 954

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||| 
Sbjct: 953  gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttt 894

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 893  tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 834

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            || || || || || ||||| || ||||| || |||||||||||||||||||||||||||
Sbjct: 833  actcctccccgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcg 774

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            ||||| || || ||||||||||| |||||||| ||||| || ||||| || |||||||| 
Sbjct: 773  cgcaggactttgcggtggcgcttagcgccgcctttgcccagacccttcccgcccttgcct 714

                        
Query: 531  cgcccggacatg 542
            || || ||||||
Sbjct: 713  cggccagacatg 702

---

>gb|BC016336.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:24014
           IMAGE:4101102), complete cds
          Length = 1260

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 342 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 283

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 282 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 223

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 222 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 163

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 162 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 103

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 102 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 43

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 42  cgtcctgacat 32

---

>gb|AY128662.1| Homo sapiens clone HIST1H4I histone H4 gene, complete cds
          Length = 930

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 622 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 563

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 562 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 503

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 502 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 443

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 442 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 383

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 382 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 323

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 322 cgtcctgacat 312

---

>gb|BC075806.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:87855
           IMAGE:5225467), complete cds
          Length = 1418

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 323 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 264

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 263 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 204

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 203 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 144

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 143 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 84

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 83  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 24

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 23  cgtcctgacat 13

---

>gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79353
           IMAGE:7002105), complete cds
          Length = 365

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 11  cggccagacat 1

---

>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1
             Contains a vomeronasal olfactory 1 receptor chromosome 6-2
             (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the
             gene for a novel protein identical to H2B histone family
             member A (H2BFA), the gene for a novel protein identical
             to H2A histone family member I (H2AFI), a novel histone
             gene similar to H4F2 and three CpG islands, complete
             sequence
          Length = 89016

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                         
Query: 231   tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
             ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 62924 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 62865

                                                                         
Query: 291   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
             |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 62864 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 62805

                                                                         
Query: 351   tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
             || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 62804 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 62745

                                                                         
Query: 411   acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
             |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 62744 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 62685

                                                                         
Query: 471   cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
             ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 62684 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 62625

                        
Query: 531   cgcccggacat 541
             || || |||||
Sbjct: 62624 cgtcctgacat 62614

---

>emb|CR599017.1| full-length cDNA clone CS0DC001YE12 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1321

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 326 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 267

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 266 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 207

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 206 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 147

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 146 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 87

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 86  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 27

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 26  cgtcctgacat 16

---

>gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79354
           IMAGE:7002106), complete cds
          Length = 365

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 11  cggccagacat 1

---

>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6
          Length = 20621

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                         
Query: 231   tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
             ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 12125 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 12066

                                                                         
Query: 291   gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
             |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 12065 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 12006

                                                                         
Query: 351   tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
             || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 12005 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 11946

                                                                         
Query: 411   acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
             |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 11945 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 11886

                                                                         
Query: 471   cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
             ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 11885 cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 11826

                        
Query: 531   cgcccggacat 541
             || || |||||
Sbjct: 11825 cgtcctgacat 11815

---

>ref|NM_003495.2| Homo sapiens histone 1, H4i (HIST1H4I), mRNA
          Length = 370

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 11  cgtcctgacat 1

---

>emb|X13236.1|MMHIS453 Mouse histone H4 gene
          Length = 1678

 Score =  307 bits (155), Expect = 2e-80
 Identities = 267/305 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||||||||||||||||||||||||||| ||||||  |||||| |||||||||||||||
Sbjct: 964 ccgaatccgtagagggtgcggccctggcgyttgagccggtagaccacgtccatggcggtg 905

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           |||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 904 acggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 845

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 844 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 785

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || || || ||||| || ||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 784 ccgcgccgggccaggcggcggatggcgggcttcgtgatgccctggatgttgtcgcgcagc 725

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || || |||||||| ||||| || ||||| || || || |||||||||||||| || 
Sbjct: 724 actttgcgatggcgcttagcgccacctttgcccaggccttttcctcccttgccgcgacca 665

                
Query: 537 gacat 541
           |||||
Sbjct: 664 gacat 660

---

>dbj|AB000905.1| Homo sapiens DNA for H4 histone, complete cds
          Length = 1293

 Score =  307 bits (155), Expect = 2e-80
 Identities = 272/311 (87%)
 Strand = Plus / Minus

                                                                        
Query: 231  tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
            ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1031 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 972

                                                                        
Query: 291  gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
            |||||||| ||||||||   ||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 971  gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttc 912

                                                                        
Query: 351  tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
            || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 911  tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 852

                                                                        
Query: 411  acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
            |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 851  acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 792

                                                                        
Query: 471  cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
            ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 791  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 732

                       
Query: 531  cgcccggacat 541
            || || |||||
Sbjct: 731  cgtcctgacat 721

---

>gb|BC052219.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:60536
           IMAGE:30017176), complete cds
          Length = 724

 Score =  303 bits (153), Expect = 3e-79
 Identities = 270/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 320 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 261

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 260 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 201

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 200 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 141

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 140 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 81

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 80  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 21

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 20  ccagacatg 12

---

>emb|CR657174.2|CNS0F61O Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score =  303 bits (153), Expect = 3e-79
 Identities = 265/301 (88%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||| ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||
Sbjct: 341 agcctccgaagccgtacagggtgcgcccctgccgcttgagcgcgtacaccacatccatgg 282

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||||||||| |    |||||||||||||||||||||||| || ||||| |||||||
Sbjct: 281 cggtgacggtcttcctcttggcgtgctcggtgtaggtgacggcatcccggatcacgttct 222

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | |||||||||||||||||||||||||||||| || |||||||||||||| |
Sbjct: 221 ccaggaacaccttgagcacgccgcgggtctcctcgtagatcaggcccgagatgcgcttga 162

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           ||||||| ||||||||||| || ||||| || ||||||||||||||||||||||||||||
Sbjct: 161 cgccgccgcggcgagccaggcggcggatggcgggcttggtgatgccctggatgttgtcgc 102

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | | |||||| ||||||||||||||||| || ||||| || || |||||||| |||||||
Sbjct: 101 gga-caccttgcggtggcgcttggcgccccctttgcccaggcctttgcctcctttgccgc 43

            
Query: 532 g 532
           |
Sbjct: 42  g 42

---

>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to nuclear
             envelope pore membrane protein POM121, the Prss16 gene for
             thymus serine protease16, three novel genes, the genes for
             two H2a, two H2b and one H4 histone family members, a
             ribosomal protein L37A (Rpl37a) pseudogene, a novel
             pseudogene, three genes for novel vomeronasal 1 receptor H
             (V1rh) family members, the gene for a novel vomeronasal 1
             receptor I (V1ri) family member, six V1ri pseudogenes, a
             V1rh pseudogene and six CpG islands, complete sequence
          Length = 210845

 Score =  303 bits (153), Expect = 3e-79
 Identities = 270/309 (87%)
 Strand = Plus / Plus

                                                                         
Query: 234   ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
             |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 58372 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 58431

                                                                         
Query: 294   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
             ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 58432 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 58491

                                                                         
Query: 354   aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
             ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 58492 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 58551

                                                                         
Query: 414   ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
             || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 58552 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 58611

                                                                         
Query: 474   agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
             ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 58612 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 58671

                      
Query: 534   ccggacatg 542
             || ||||||
Sbjct: 58672 ccagacatg 58680

---

>gb|BC092144.1| Mus musculus histone 1, H4i, mRNA (cDNA clone MGC:106611
           IMAGE:30612926), complete cds
          Length = 562

 Score =  303 bits (153), Expect = 3e-79
 Identities = 270/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 37  ccagacatg 29

---

>ref|NM_175656.2| Mus musculus histone 1, H4i (Hist1h4i), mRNA
          Length = 562

 Score =  303 bits (153), Expect = 3e-79
 Identities = 270/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 97  agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 37  ccagacatg 29

---

>gb|AY158959.1| Mus musculus histone protein Hist1h4i gene, complete cds
          Length = 1309

 Score =  303 bits (153), Expect = 3e-79
 Identities = 270/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 628 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 569

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 568 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 509

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 508 ccagacatg 500

---

>gb|BC114196.1| Bos taurus histone H4, mRNA (cDNA clone IMAGE:8186024)
          Length = 409

 Score =  299 bits (151), Expect = 5e-78
 Identities = 271/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 340 agccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 281

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 280 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 221

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||| ||||| |||||||||||||||||||||||||| |||||||||||||
Sbjct: 220 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 161

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           | || ||||| |||||||| ||||| || || |||||||| |||||||||||||| || |
Sbjct: 160 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 101

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | || || || ||||||||||| ||||| || ||||| || ||||| || || |||||||
Sbjct: 100 gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 41

                      
Query: 532 gcccggacatg 542
           | || ||||||
Sbjct: 40  gaccagacatg 30

---

>gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79352
           IMAGE:7002103), complete cds
          Length = 364

 Score =  299 bits (151), Expect = 5e-78
 Identities = 271/311 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 311 tagccgccgaagccatagagggtgcggccctggcgcttgagcgcgtagaccacgtccatg 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||| ||||||||   ||||||||| ||||||||  ||||||| ||||| ||||||
Sbjct: 251 gcggtgaccgtcttgcgcttggcgtgctccgtgtaggtcgcggcgtcccggatcacgttc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| | ||| |||||||||||||| |||||||| || || |||||||||
Sbjct: 191 tccaggaacaccttcaacactccgcgggtctcctcatagatgaggccagaaatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           |||||||| |||||||| || ||||| || || ||||||||||| |||||||||||||||
Sbjct: 131 acgccgccgcggcgagcaaggcgccgaatggctggcttggtgataccctggatgttgtcg 72

                                                                       
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
           ||||||||||| |||||||||||||| || || || || || ||||| ||||| ||||||
Sbjct: 71  cgcagcaccttgcggtggcgcttggcaccccctttccccaggcccttacctcctttgccg 12

                      
Query: 531 cgcccggacat 541
           || || |||||
Sbjct: 11  cggccagacat 1

---

>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507),
           mRNA
          Length = 846

 Score =  297 bits (150), Expect = 2e-77
 Identities = 267/306 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 830 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 771

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| |||
Sbjct: 770 accgtcttgcgcttggcgtgctctgtataggtcacggcgtcccggatcacgttctccagg 711

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 710 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 651

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || |||||||| || |||||||| ||||||||||||||||||||||| ||||||||||  
Sbjct: 650 ccgcggcgagcaaggcgccggatagccggcttggtgatgccctggatattgtcgcgcaat 591

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || || |||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 590 actttacgatggcgcttagcgccgcctttgccaagacccttcccgcctttgccgcggcca 531

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 530 gacatg 525

---

>ref|XM_868981.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC527645), mRNA
          Length = 312

 Score =  297 bits (150), Expect = 2e-77
 Identities = 270/310 (87%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagggtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||| ||||| |||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           | || ||||| |||||||| ||||| || || |||||||| |||||||||||||| || |
Sbjct: 130 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | || || || ||||||||||| ||||| || ||||| || ||||| || || |||||||
Sbjct: 70  gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  gaccagacat 1

---

>ref|XM_976380.1| PREDICTED: Mus musculus similar to germinal histone H4 gene
           (LOC674678), mRNA
          Length = 2984

 Score =  297 bits (150), Expect = 2e-77
 Identities = 255/290 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 476 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 417

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || |||
Sbjct: 416 gccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattc 357

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||| || ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 356 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 297

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           ||||||||||| ||||||| ||||||||| || |||||||| ||||||||||||||||||
Sbjct: 296 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 237

                                                             
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
           || || ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 236 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 187

---

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score =  297 bits (150), Expect = 2e-77
 Identities = 255/290 (87%)
 Strand = Plus / Minus

                                                                          
Query: 231    tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
              ||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 113214 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 113155

                                                                          
Query: 291    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
              || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 113154 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 113095

                                                                          
Query: 351    tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
              || ||||| | |||||| || ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 113094 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 113035

                                                                          
Query: 411    acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
              ||||||||||| ||||||| ||||||||| || |||||||| ||||||||||||||||||
Sbjct: 113034 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 112975

                                                                
Query: 471    cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
              || || ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 112974 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 112925

---

>gb|AY158967.1| Mus musculus histone protein Hist4h4 gene, complete cds
          Length = 1200

 Score =  297 bits (150), Expect = 2e-77
 Identities = 255/290 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 702 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 643

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 642 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 583

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||| || ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 582 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 523

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           ||||||||||| ||||||| ||||||||| || |||||||| ||||||||||||||||||
Sbjct: 522 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 463

                                                             
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
           || || ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 462 cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 413

---

>gb|BC111813.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:40040608),
           partial cds
          Length = 311

 Score =  297 bits (150), Expect = 2e-77
 Identities = 255/290 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 310 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 251

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || ||||| ||||||||   ||||||||||||||| ||||||||||||||||| || |||
Sbjct: 250 gccgtgaccgtcttgcgcttggcgtgctcggtgtatgtgacggcgtcgcggatcacattc 191

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||| || ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 190 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 131

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           ||||||||||| ||||||| ||||||||| || |||||||| ||||||||||||||||||
Sbjct: 130 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 71

                                                             
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
           || || ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 70  cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 21

---

>ref|NM_175652.1| Mus musculus histone 4, H4 (Hist4h4), mRNA
          Length = 312

 Score =  297 bits (150), Expect = 2e-77
 Identities = 255/290 (87%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 311 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 252

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 251 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 192

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||| || ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 191 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 132

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           ||||||||||| ||||||| ||||||||| || |||||||| ||||||||||||||||||
Sbjct: 131 acgccgccacgccgagccaaccgccggatagcgggcttggtaatgccctggatgttgtcg 72

                                                             
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
           || || ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 71  cggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 22

---

>ref|NM_178208.1| Mus musculus histone 1, H4c (Hist1h4c), mRNA
          Length = 312

 Score =  295 bits (149), Expect = 9e-77
 Identities = 239/269 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 308 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 249

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 248 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 189

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 188 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 129

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||| |||||||||||||| || || 
Sbjct: 128 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 69

                                        
Query: 474 agcaccttccggtggcgcttggcgccgcc 502
           || ||||| ||||||||||| ||||||||
Sbjct: 68  agaaccttacggtggcgcttagcgccgcc 40

---

>gb|BC019757.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:4205460),
           partial cds
          Length = 733

 Score =  295 bits (149), Expect = 9e-77
 Identities = 269/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 337 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 278

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 277 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 218

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 217 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 158

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 157 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 98

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || ||||| |||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 97  agcactttgcggtgacgcttggcgccgcctttgcccaggccttttcctcctttgccacga 38

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 37  ccagacatg 29

---

>gb|DQ400915.1| Elaeis guineensis histone 4 mRNA, complete cds
          Length = 561

 Score =  295 bits (149), Expect = 9e-77
 Identities = 257/293 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 358 ccgaagccgtagagggtgcggccctggcgcttgagagcgtagacaacgtccatggcggtg 299

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           |||||||| ||||| |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 298 acggtcttccggcgagcgtgctccgtgtaggtgacggcgtcgcggataacgttctccagg 239

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           ||||||||||||||||| |  ||||||||||||||||| ||   ||| ||||||||||| 
Sbjct: 238 aagatcttgagcacgcctcttgtctcctcgtagatgagaccgctgatacgcttcacgcca 179

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           ||||| || || || |||||||| || |||||||||||||||||||||||||| || || 
Sbjct: 178 ccacgccgtgcgagacgccggatggcgggcttggtgatgccctggatgttgtcccggagg 119

                                                                
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||| ||| ||||||| || || ||||| || |  ||||| |||||||||||
Sbjct: 118 accttgcgggggcgctttgcacctccctttcccaaacccttacctcccttgcc 66

---

>dbj|AK011560.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2610027B07 product:histone 4
           protein, full insert sequence
          Length = 720

 Score =  295 bits (149), Expect = 9e-77
 Identities = 269/309 (87%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           |||||||| ||||| || || |||||||||||||||||||||||||| ||||||||||||
Sbjct: 348 ccgccgaacccgtacagagtacggccctggcgcttgagcgcgtagaccacgtccatggcg 289

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           |||||||||| |||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 288 gtgacggtctcgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 229

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 228 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 169

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||||||||||||||||||||| || 
Sbjct: 168 cctccgcgccgggccaggcggcggatggcgggcttggtgatgccctggatgttgtcccga 109

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           ||||| || |||||||||||||||||||| ||||| || || || ||||| ||||| || 
Sbjct: 108 agcactttgcggtggcgcttggcgccgcctttgcccaggccttttcctcctttgccacga 49

                    
Query: 534 ccggacatg 542
           || ||||||
Sbjct: 48  ccagacatg 40

---

>gb|AY158963.1| Mus musculus histone protein Hist1h4c gene, complete cds
          Length = 1309

 Score =  295 bits (149), Expect = 9e-77
 Identities = 239/269 (88%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 808 ccgccgaatccgtagagagtgcggccctggcgcttgagcgcgtagaccacgtccatggcg 749

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||||||||||||   ||||||||| ||||||||||||||||||||||| |||||||| 
Sbjct: 748 gtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctcc 689

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           ||||| | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| 
Sbjct: 688 aggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcact 629

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || || || || ||||| || ||||| || |||||||| |||||||||||||| || || 
Sbjct: 628 cccccgcgccgggccaggcggcggatggcgggcttggtaatgccctggatgttatcacgg 569

                                        
Query: 474 agcaccttccggtggcgcttggcgccgcc 502
           || ||||| ||||||||||| ||||||||
Sbjct: 568 agaaccttacggtggcgcttagcgccgcc 540

---

>gb|AY389612.1| Hyacinthus orientalis unknown mRNA
          Length = 436

 Score =  289 bits (146), Expect = 5e-75
 Identities = 237/266 (89%), Gaps = 1/266 (0%)
 Strand = Plus / Minus

                                                                       
Query: 229 cctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtcca 288
           ||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 266 cctagccgccgaagccgtagagggtgcgtccctggcgcttgagggcgtagacgacgtcca 207

                                                                       
Query: 289 tggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgt 348
           | || || || ||||| ||||| |||||||||||||||||||||||||| ||||||||||
Sbjct: 206 tcgccgtcaccgtcttccggcgcgcgtgctcggtgtaggtgacggcgtcacggatgacgt 147

                                                                       
Query: 349 tctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgct 408
           ||||||||||||||||||| || ||||| ||||||||||||||||||||    || | ||
Sbjct: 146 tctcgaggaagatcttgaggaccccgcgcgtctcctcgtagatgagcccgcttatcctct 87

                                                                       
Query: 409 tcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgt 468
           |||| || |||||||||||||| || |||||||||||||| |||||||||||||||||||
Sbjct: 86  tcactcctccacggcgagccaggcggcggatcgccggcttcgtgatgccctggatgttgt 27

                                     
Query: 469 -cgcgcagcaccttccggtggcgctt 493
            | || || |||| ||||||||||||
Sbjct: 26  ccccggagtacctgccggtggcgctt 1

---

>ref|XM_606749.2| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC528329), mRNA
          Length = 312

 Score =  289 bits (146), Expect = 5e-75
 Identities = 269/310 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| |||||||| ||||||||||| ||||| ||||||||||| ||||||||||
Sbjct: 310 agccgccgaagccgtagagcgtgcggccctgtcgcttcagcgcgtagaccacgtccatgg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           ||||||| ||||||||   ||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 250 cggtgacagtcttgcgcttggcgtgctcggtgtaggtgaccgcgtcgcggatcacgttct 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||| | ||| ||||| |||||||||||||||||||||||||| |||||||||||||
Sbjct: 190 ccaggaacaccttcagcaccccgcgggtctcctcgtagatgagcccggagatgcgcttca 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           | || ||||| |||||||| ||||| || || |||||||| |||||||||||||| || |
Sbjct: 130 caccaccacgacgagccaggcgccgaatagcaggcttggtaatgccctggatgttatcac 71

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           | || || || ||||||||||| ||||| || ||||| || ||||| || || |||||||
Sbjct: 70  gaaggactttgcggtggcgcttagcgcctcctttgcccagaccctttccgcctttgccgc 11

                     
Query: 532 gcccggacat 541
           | || |||||
Sbjct: 10  gaccagacat 1

---

>gb|BC100619.1| Rattus norvegicus germinal histone H4 gene, mRNA (cDNA clone
           MGC:124607 IMAGE:7938313), complete cds
          Length = 1326

 Score =  289 bits (146), Expect = 5e-75
 Identities = 245/278 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || |||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 334 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 275

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 274 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 215

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 214 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 155

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || || || || |||||||||||||||||||||||||||
Sbjct: 154 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 95

                                                 
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||||| || || ||||||||||| |||||||| |||||
Sbjct: 94  cgcaggactttgcggtggcgcttagcgccgcctttgcc 57

---

>ref|NM_022686.2| Rattus norvegicus germinal histone H4 gene (Hist1h4b), mRNA
          Length = 1296

 Score =  289 bits (146), Expect = 5e-75
 Identities = 245/278 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || |||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 330 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 271

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 270 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 211

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 210 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 151

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || || || || |||||||||||||||||||||||||||
Sbjct: 150 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 91

                                                 
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||||| || || ||||||||||| |||||||| |||||
Sbjct: 90  cgcaggactttgcggtggcgcttagcgccgcctttgcc 53

---

>gb|AY936209.1| Rattus norvegicus histone H4 variant H4-v.1 mRNA, complete cds
          Length = 1296

 Score =  289 bits (146), Expect = 5e-75
 Identities = 245/278 (88%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || |||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 330 tagccgccgaagccatagagggtacggccctggcgtttgagtgcgtagaccacgtccatg 271

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           |||||||||||||||||   ||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 270 gcggtgacggtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttc 211

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | ||| ||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 210 tccaggaacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttc 151

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || || || || ||||| || || || || |||||||||||||||||||||||||||
Sbjct: 150 actcctccgcgccgggccaggcggcgaatggcgggcttggtgatgccctggatgttgtcg 91

                                                 
Query: 471 cgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||||| || || ||||||||||| |||||||| |||||
Sbjct: 90  cgcaggactttgcggtggcgcttagcgccgcctttgcc 53

---

>gb|AF457966.1| Zea mays clone cho1c.pk003.e4, mRNA sequence
          Length = 248

 Score =  287 bits (145), Expect = 2e-74
 Identities = 160/165 (96%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 165 ggcctagccgccgaagccgtagagggtgcggccctggcgcttaagcgcgtagacgacgtc 106

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 105 catggcggtgacggtcttacggcgcgcgtgctcggtgtaggtgacggcgtcgcggatgac 46

                                                        
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagat 391
           |||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 45  gttctccaggaagatcttgagcacgccgcgggtctcctcgtagat 1

---

>dbj|AK045187.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130044J01 product:H4 HISTONE
           homolog [Homo sapiens], full insert sequence
          Length = 2875

 Score =  283 bits (143), Expect = 3e-73
 Identities = 255/291 (87%), Gaps = 1/291 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| ||||| || |||||||||||||||||||||||||| || |||||||| 
Sbjct: 358 tagccgccgaagccgtacagagtgcggccctggcgcttgagcgcgtacaccacgtccata 299

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           || || || ||||||||   ||||||||||||||||||||||||||||||||| || |||
Sbjct: 298 gccgtaaccgtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatcacattc 239

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || ||||| | |||||| || ||||| ||||||||||||||||| |||||||||||||||
Sbjct: 238 tcaaggaaaaccttgaggacaccgcgagtctcctcgtagatgagacccgagatgcgcttc 179

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgat-gccctggatgttgtc 469
           ||||||||||| ||||||| ||||||||| || |||||||| || |||||||||||||||
Sbjct: 178 acgccgccacgccgagccaaccgccggatagcgggcttggtaatggccctggatgttgtc 119

                                                              
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
           ||| || ||||| ||||| ||||||||||| || || || || ||||||||
Sbjct: 118 gcggagaaccttgcggtgtcgcttggcgccacctttccccagacccttgcc 68

---

>emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.2 genes for histone H3 and for
            histone H4
          Length = 1860

 Score =  272 bits (137), Expect = 1e-69
 Identities = 266/309 (86%)
 Strand = Plus / Minus

                                                                        
Query: 234  ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
            |||||||| |||||||||||||| |||||||||||||| ||||||||||| || |  | |
Sbjct: 1596 ccgccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgag 1537

                                                                        
Query: 294  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
            ||||||||||||||   ||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1536 gtgacggtcttgcgcttggcgtgctcagtgtaggtgacggcgtcacggatgacgttctcg 1477

                                                                        
Query: 354  aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
            ||||||| |||||| |||  ||||||||||||||||||||| || ||||| ||||| || 
Sbjct: 1476 aggaagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgaca 1417

                                                                        
Query: 414  ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
            || ||||| || || || || ||||| || ||||||||||| |||||||||||||| || 
Sbjct: 1416 ccaccacgacgggcgagacgacggatggcgggcttggtgattccctggatgttgtcacga 1357

                                                                        
Query: 474  agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
            || | ||| ||||| |||||||| |||||||| ||||| ||||| |||||||||||||| 
Sbjct: 1356 agaatcttgcggtgacgcttggcaccgccctttccgagaccctttcctcccttgccgcgg 1297

                     
Query: 534  ccggacatg 542
            || ||||||
Sbjct: 1296 ccagacatg 1288

---

>emb|CR657322.2|CNS0F65S Tetraodon nigroviridis full-length cDNA
          Length = 586

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||||||||| ||||| |||||||||||||| | ||| || ||||| || ||||||||
Sbjct: 319 ctagccgccgaagccgtacagggtgcggccctgcctcttcagggcgtacaccacgtccat 260

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||| || || ||||| |    ||||||||| ||||||||||||||||||||||| |||||
Sbjct: 259 ggccgtcaccgtcttcctcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgtt 200

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| |||||||||||||||||||| || || |||||||||||
Sbjct: 199 ctccaggaacaccttcagcaccccgcgggtctcctcgtagatcaggccggagatgcgctt 140

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
           ||||||||| || || ||||| || ||||| || ||||||||||||||||||||||||||
Sbjct: 139 cacgccgccgcgccgcgccaggcggcggatggcgggcttggtgatgccctggatgttgtc 80

                                                                    
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
           ||| || ||||| |||||||||||||||||||| ||||| || || |||||||||||
Sbjct: 79  gcggaggaccttgcggtggcgcttggcgccgcctttgcccagacctttgcctccctt 23

---

>gb|BC057955.1| Mus musculus histone 1, H4h, mRNA (cDNA clone IMAGE:5359141), with
           apparent retained intron
          Length = 1631

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 319 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 260

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 259 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 200

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 199 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 140

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 139 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 80

                                                                    
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
            ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 79  acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 23

---

>emb|BX061454.1|CNS09JKY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 537 g 537
           |
Sbjct: 102 g 102

---

>emb|BX057867.1|CNS09GTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 413 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 354

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 353 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 294

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 293 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 234

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 233 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 174

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 173 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 114

            
Query: 537 g 537
           |
Sbjct: 113 g 113

---

>emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 402 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 343

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 342 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 283

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 537 g 537
           |
Sbjct: 102 g 102

---

>emb|BX048034.1|CNS09986 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 382 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 323

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 322 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 263

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 262 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 203

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 202 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 143

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 142 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 83

            
Query: 537 g 537
           |
Sbjct: 82  g 82

---

>emb|BX037780.1|CNS091BC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 622

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Plus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 237 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 296

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 356

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 357 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 416

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 417 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 476

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 477 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 536

            
Query: 537 g 537
           |
Sbjct: 537 g 537

---

>emb|BX037779.1|CNS091BB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 421 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 362

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 361 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 302

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 301 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 242

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 241 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 182

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 181 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 122

            
Query: 537 g 537
           |
Sbjct: 121 g 121

---

>emb|BX020583.1|CNS08O1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 394

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 323 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 264

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 263 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 204

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 203 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 144

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 143 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 84

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 83  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 24

            
Query: 537 g 537
           |
Sbjct: 23  g 23

---

>emb|BX009114.1|CNS08F72 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 384 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 325

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 324 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 265

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 264 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 205

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 204 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 145

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 144 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 85

            
Query: 537 g 537
           |
Sbjct: 84  g 84

---

>emb|V00753.1|MMHI01 Mouse gene encoding the mouse histone H4
          Length = 968

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 569 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 510

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 509 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 450

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 449 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 390

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 389 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 330

                                                                    
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
            ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 329 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 273

---

>ref|NM_033596.1| Mus musculus histone 2, H4 (Hist2h4), mRNA
          Length = 400

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 341 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 282

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 281 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 222

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 221 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 162

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 161 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 102

                                                                    
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
            ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 101 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 45

---

>gb|AY158966.1| Mus musculus histone protein Hist2h4 gene, complete cds
          Length = 1309

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 812 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 753

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 752 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 693

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 692 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 633

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 632 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 573

                                                                    
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
            ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 572 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 516

---

>ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125
           (ENSANGG00000000123), partial mRNA
          Length = 312

 Score =  272 bits (137), Expect = 1e-69
 Identities = 260/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 6

            
Query: 537 g 537
           |
Sbjct: 5   g 5

---

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Plus

                                                                         
Query: 230   ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
             |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 87632 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 87691

                                                                         
Query: 290   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
              |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 87692 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 87751

                                                                         
Query: 350   ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
             ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 87752 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 87811

                                                                         
Query: 410   cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
              || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 87812 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 87871

                                                                      
Query: 470   gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
              ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 87872 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 87928

---

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                         
Query: 230   ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
             |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 13061 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 13002

                                                                         
Query: 290   ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
              |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 13001 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 12942

                                                                         
Query: 350   ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
             ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 12941 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 12882

                                                                         
Query: 410   cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
              || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 12881 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 12822

                                                                      
Query: 470   gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
              ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 12821 acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 12765

---

>gb|BC051566.1| Mus musculus histone 2, H4, mRNA (cDNA clone IMAGE:1446370)
          Length = 358

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| ||||||||||||||||||||||||||||| ||||| || || |||||
Sbjct: 333 ctagcctccgaagccgtagagggtgcggccctggcgcttgagagcgtacaccacatccat 274

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
            |||||||||||||||||   ||||||||||||||||||||| |||||||||||||||||
Sbjct: 273 agcggtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcgcggatgacgtt 214

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 213 ctccaggaacaccttcagcacaccacgggtctcctcgtagatgaggccggagatgcgctt 154

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            || || || || |||||||| || ||||| || ||||||||||| ||||||||||||||
Sbjct: 153 gaccccaccgcgccgagccaggcggcggatggcgggcttggtgataccctggatgttgtc 94

                                                                    
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
            ||||  || || || |||||||||||||| |||||||| || ||||| || |||||
Sbjct: 93  acgcaagactttgcgatggcgcttggcgccacccttgcctagaccctttccaccctt 37

---

>ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (predicted)
           (Hist1h4m_predicted), mRNA
          Length = 312

 Score =  266 bits (134), Expect = 8e-68
 Identities = 251/290 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||| ||||||||||||||||| ||||| ||||| || |||||||| |||
Sbjct: 305 ccgaagccgtagagagtgcggccctggcgcttaagcgcatagacaacatccatggcagtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 245 acagtcttgcgcttggcgtgctctgtgtaggtgacggcgtcgcggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 185 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || || |||||||  || ||||| || ||||| |||||||||||||||||||||||||| 
Sbjct: 125 ccccgccgagccaagcggcggatggcgggcttagtgatgccctggatgttgtcgcgcagg 66

                                                             
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
           || || ||||||||||| |||||||| ||||| || ||||| || |||||
Sbjct: 65  actttgcggtggcgcttagcgccgcctttgcccagacccttcccgccctt 16

---

>emb|BX039313.1|CNS092HX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score =  264 bits (133), Expect = 3e-67
 Identities = 260/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 408 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 349

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 348 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 290

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 289 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 230

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 229 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 170

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 169 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 110

            
Query: 537 g 537
           |
Sbjct: 109 g 109

---

>emb|BX032921.1|CNS08XKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||| | || ||||| || || ||||| || |||
Sbjct: 404 ccgaatccgtagagcgtacggccctggcgcctcagagcgtacaccacatccatcgccgtg 345

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 344 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 285

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 284 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 225

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 224 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 165

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 164 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 105

            
Query: 537 g 537
           |
Sbjct: 104 g 104

---

>ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626
           (ENSANGG00000016137), partial mRNA
          Length = 312

 Score =  264 bits (133), Expect = 3e-67
 Identities = 259/301 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 305 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||| ||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 245 accgtcttacgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 185 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 125 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 66

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 65  accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 6

            
Query: 537 g 537
           |
Sbjct: 5   g 5

---

>emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score =  262 bits (132), Expect = 1e-66
 Identities = 256/296 (86%), Gaps = 1/296 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 357 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 298

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 297 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 239

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 238 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 179

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 178 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 119

                                                                   
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcg 532
           ||||| || || |||||||| || ||||| || || ||||||||||||||||||||
Sbjct: 118 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 63

---

>emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score =  262 bits (132), Expect = 1e-66
 Identities = 256/296 (86%), Gaps = 1/296 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 388 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 329

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 328 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 270

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 269 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 210

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 209 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 150

                                                                   
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcg 532
           ||||| || || |||||||| || ||||| || || ||||||||||||||||||||
Sbjct: 149 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcg 94

---

>emb|X02916.1|SGH4H2B Rainbow trout histone H4 and H2B genes
          Length = 2930

 Score =  260 bits (131), Expect = 5e-66
 Identities = 248/287 (86%)
 Strand = Plus / Minus

                                                                        
Query: 234  ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
            |||||||| ||||| |||||||| |||||||| || || |||||||| ||||||||||| 
Sbjct: 1145 ccgccgaaaccgtacagggtgcgtccctggcgtttcagagcgtagaccacgtccatggcc 1086

                                                                        
Query: 294  gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
            || |||||||| |    ||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1085 gtaacggtcttcctcttggcgtgctcggtgtaggtgacggcgtcgcggatcacgttctca 1026

                                                                        
Query: 354  aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
            ||||| | ||| || || |||||||||||||||||||| ||||| ||||| |||||||||
Sbjct: 1025 aggaacaccttcaggacaccgcgggtctcctcgtagatcagcccggagatacgcttcacg 966

                                                                        
Query: 414  ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
            ||||||||||||||||| || || || || ||||||||||| ||||||||||| ||||| 
Sbjct: 965  ccgccacggcgagccagacggcgaatggcgggcttggtgattccctggatgttatcgcgg 906

                                                           
Query: 474  agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcc 520
            || ||||| ||||| ||||||||||| || || ||||| ||||||||
Sbjct: 905  agaaccttacggtgacgcttggcgcctccttttccgagtcccttgcc 859

---

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score =  260 bits (131), Expect = 5e-66
 Identities = 254/295 (86%)
 Strand = Plus / Plus

                                                                          
Query: 232    agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
              |||||||||| ||||| | ||||||||||||||||||||||||||| |||||||| |  |
Sbjct: 656515 agccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgagcg 656574

                                                                          
Query: 292    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
               |||||||||||||||   |||||||||||||||||||||||||||||||||||||  ||
Sbjct: 656575 aggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacggact 656634

                                                                          
Query: 352    cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
              | ||||    |||||||||  ||||    |||||||| ||||| || ||||||||||| |
Sbjct: 656635 ccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgcttga 656694

                                                                          
Query: 412    cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
              |||||||||| || ||||| ||| |||| || ||||||||||||||||||||||||||||
Sbjct: 656695 cgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtcgc 656754

                                                                     
Query: 472    gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
              | || | ||| ||||||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 656755 ggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 656809

---

>ref|NM_210226.1| Eremothecium gossypii AER012Cp (AER012C), mRNA
          Length = 312

 Score =  260 bits (131), Expect = 5e-66
 Identities = 254/295 (86%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| ||||| | ||||||||||||||||||||||||||| |||||||| |  |
Sbjct: 310 agccgccgaagccgtacaaggtgcggccctggcgcttgagcgcgtacacgacgtcgagcg 251

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
            |||||||||||||||   |||||||||||||||||||||||||||||||||||||  ||
Sbjct: 250 aggtgacggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcgcggatgacggact 191

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | ||||    |||||||||  ||||    |||||||| ||||| || ||||||||||| |
Sbjct: 190 ccaggaccgacttgagcaccgcgcgcacgtcctcgtaaatgaggccggagatgcgcttga 131

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           |||||||||| || ||||| ||| |||| || ||||||||||||||||||||||||||||
Sbjct: 130 cgccgccacgacgggccaggcgcaggatggcgggcttggtgatgccctggatgttgtcgc 71

                                                                  
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctccctt 526
           | || | ||| ||||||||||| ||||||||||||||||| |||||||| |||||
Sbjct: 70  ggaggatcttgcggtggcgcttcgcgccgcccttgccgaggcccttgcccccctt 16

---

>emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes for histone H3 and histone H4
          Length = 1630

 Score =  258 bits (130), Expect = 2e-65
 Identities = 262/306 (85%)
 Strand = Plus / Minus

                                                                        
Query: 237  ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
            ||||| |||||||||||||| |||||||||||||| ||||||||||| || |  | ||||
Sbjct: 1394 ccgaaaccgtagagggtgcgtccctggcgcttgagggcgtagacgacatcgagcgaggtg 1335

                                                                        
Query: 297  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
            |||||||||||   ||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1334 acggtcttgcgcttggcgtgctcggtgtaggtgacggcgtcacggatgacgttctcgagg 1275

                                                                        
Query: 357  aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
            |||| |||||| |||  ||||||||||||||||||||| || ||||| ||||| || || 
Sbjct: 1274 aagaccttgaggacggagcgggtctcctcgtagatgaggccggagatacgcttgacacca 1215

                                                                        
Query: 417  ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
            ||||| || || || || ||||| || ||||||||||| |||||||||||||| || || 
Sbjct: 1214 ccacgacgggcgagacggcggatagcgggcttggtgattccctggatgttgtcacgaaga 1155

                                                                        
Query: 477  accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
            | ||| |||||||||||||| || ||||| ||||| ||||| ||||| || ||||| || 
Sbjct: 1154 atcttgcggtggcgcttggcaccaccctttccgagaccctttcctcctttaccgcggcca 1095

                  
Query: 537  gacatg 542
            ||||||
Sbjct: 1094 gacatg 1089

---

>emb|BX052400.1|CNS09CLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score =  258 bits (130), Expect = 2e-65
 Identities = 260/302 (86%), Gaps = 1/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 279

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 278 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 219

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 218 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 159

                                                                       
Query: 477 accttccggtggcgcttggcgccgcc-cttgccgagccccttgcctcccttgccgcgccc 535
           ||||| || || |||||||| || || ||| || || |||||||||||||||||||| ||
Sbjct: 158 accttgcgatgacgcttggctcctccgctttcccagtcccttgcctcccttgccgcgacc 99

             
Query: 536 gg 537
           ||
Sbjct: 98  gg 97

---

>emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score =  256 bits (129), Expect = 7e-65
 Identities = 259/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 407 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 348

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||| ||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 347 accgtcttacgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 289

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 288 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 229

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 228 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 169

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 168 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 109

            
Query: 537 g 537
           |
Sbjct: 108 g 108

---

>emb|BX053099.1|CNS09D4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 434

 Score =  256 bits (129), Expect = 7e-65
 Identities = 258/301 (85%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 347 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 288

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || || || ||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 287 accgttttacgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 228

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 227 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 168

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 167 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 108

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 107 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 48

            
Query: 537 g 537
           |
Sbjct: 47  g 47

---

>emb|BX047092.1|CNS098I0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score =  256 bits (129), Expect = 7e-65
 Identities = 259/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||| ||||| || ||||| || || ||||| || |||
Sbjct: 392 ccgaatccgtagagcgtacggccctgccgcttcagagcgtacaccacatccatcgccgtg 333

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 332 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 274

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 273 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 214

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 213 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 154

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 153 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 94

            
Query: 537 g 537
           |
Sbjct: 93  g 93

---

>emb|BX043671.1|CNS095UZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score =  256 bits (129), Expect = 7e-65
 Identities = 253/293 (86%), Gaps = 1/293 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 379 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 320

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 319 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 261

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 260 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 201

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 200 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 141

                                                                
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||| || || |||||||| || ||||| || || |||||||||||||||||
Sbjct: 140 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgcc 88

---

>emb|BX036322.1|CNS0906U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score =  256 bits (129), Expect = 7e-65
 Identities = 259/301 (86%), Gaps = 1/301 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 401 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 342

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||| ||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 341 accgtcttacgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 283

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 282 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 223

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 222 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 163

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 162 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 103

            
Query: 537 g 537
           |
Sbjct: 102 g 102

---

>emb|BX054530.1|CNS09E8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score =  254 bits (128), Expect = 3e-64
 Identities = 248/288 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 279

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 278 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 219

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 218 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 159

                                                           
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctccc 524
           ||||| || || |||||||| || ||||| || || ||||||||||||
Sbjct: 158 accttgcgatgacgcttggctcctccctttcccagtcccttgcctccc 111

---

>emb|BX047203.1|CNS098L3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score =  252 bits (127), Expect = 1e-63
 Identities = 244/283 (86%)
 Strand = Plus / Minus

                                                                       
Query: 255 cggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcg 314
           |||||||||||||| || ||||| || || ||||| || ||||| ||||||||   ||||
Sbjct: 313 cggccctggcgcttcagagcgtacaccacatccatcgccgtgaccgtcttgcgcttggcg 254

                                                                       
Query: 315 tgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacgccg 374
           ||||||||||||||||| || |||||||| |||||||| ||||| | ||| ||||| |||
Sbjct: 253 tgctcggtgtaggtgaccgcatcgcggatcacgttctccaggaacaccttcagcacaccg 194

                                                                       
Query: 375 cgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagccagccgc 434
           || ||||| |||||||| || || ||||| |||||||||||||||||||||||||| || 
Sbjct: 193 cgcgtctcttcgtagatcaggccggagatacgcttcacgccgccacggcgagccagacgg 134

                                                                       
Query: 435 cggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtggcgcttg 494
           ||||| || ||||||||||||||||||||||| |||||||||||||| || || ||||||
Sbjct: 133 cggatggcgggcttggtgatgccctggatgttatcgcgcagcaccttgcgatgacgcttg 74

                                                      
Query: 495 gcgccgcccttgccgagccccttgcctcccttgccgcgcccgg 537
           || || ||||| || || |||||||||||||||||||| ||||
Sbjct: 73  gctcctccctttcccagtcccttgcctcccttgccgcgaccgg 31

---

>emb|BX053377.1|CNS09DCL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score =  250 bits (126), Expect = 5e-63
 Identities = 260/302 (86%), Gaps = 2/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 398 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 339

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||||||||||||| | |||||||| |||||||| |||
Sbjct: 338 accgtcttgcgcttggcgtgctcggtgtaggtgacg-catcgcggatcacgttctccagg 280

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 279 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 220

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 219 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 160

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcct-cccttgccgcgccc 535
           ||||| || || |||||||| || ||||| || || ||||||||| ||||||||||| ||
Sbjct: 159 accttgcgatgacgcttggctcctccctttcccagtcccttgcctccccttgccgcgacc 100

             
Query: 536 gg 537
           ||
Sbjct: 99  gg 98

---

>emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score =  250 bits (126), Expect = 5e-63
 Identities = 259/302 (85%), Gaps = 1/302 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 395 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 336

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 335 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 276

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| || || ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 275 aacaccttcagtacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 216

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 215 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 156

                                                                       
Query: 477 accttccggtggcgcttggc-gccgcccttgccgagccccttgcctcccttgccgcgccc 535
           ||||| || || ||||||||  || ||||| || || |||||||||||||||||||| ||
Sbjct: 155 accttgcgatgacgcttggctccctccctttcccagtcccttgcctcccttgccgcgacc 96

             
Query: 536 gg 537
           ||
Sbjct: 95  gg 94

---

>emb|X00091.1|HSHISH4 Human histone H4 gene
          Length = 709

 Score =  250 bits (126), Expect = 5e-63
 Identities = 262/306 (85%), Gaps = 1/306 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 424 ccgaaaccgtagagggtgcggccctggcgcttgagcgcgtagaccacatccatggcggtg 365

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| || ||||| |||||||| ||||| |||||||| | |
Sbjct: 364 accgtcttgcgcttggcgtgctctgtataggttacggcgtcccggattacgttctccaag 305

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 304 aacaccttcagcaccccgcgagtctcctcgtagatgaggccggagatgcgcttcacgccg 245

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           || ||||| || || || || || || || ||||||||||| ||||| ||||||||||| 
Sbjct: 244 ccgcggcg-gcaaggcgtcgaatggctggtttggtgatgccatggatattgtcgcgcagt 186

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           || || ||||||||||| |||||||| ||||| || ||||| || || |||||||| || 
Sbjct: 185 actttacggtggcgcttagcgccgcctttgccaaggcccttcccgcctttgccgcggcca 126

                 
Query: 537 gacatg 542
           ||||||
Sbjct: 125 gacatg 120

---

>emb|BX061455.1|CNS09JKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score =  248 bits (125), Expect = 2e-62
 Identities = 258/301 (85%), Gaps = 1/301 (0%)
 Strand = Plus / Plus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 578 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 637

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 638 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 697

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 698 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 757

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           ||||||||||||||  | ||||| || ||||||||||||||||||||||| ||||||| |
Sbjct: 758 ccacggcgagccagaaggcggatggcgggcttggtgatgccctggatgttatcgcgca-c 816

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 817 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 876

            
Query: 537 g 537
           |
Sbjct: 877 g 877

---

>emb|BX041120.1|CNS093W4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score =  246 bits (124), Expect = 7e-62
 Identities = 251/292 (85%), Gaps = 1/292 (0%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 359 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 300

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   |||||||||||| ||||||||| | |||||||| |||||||| |||
Sbjct: 299 accgtcttgcgcttggcgtgctcggtttaggtgacg-catcgcggatcacgttctccagg 241

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 240 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 181

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 180 ccacggcgagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcagc 121

                                                               
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgc 528
           ||||| || || |||||||| || ||||| || || ||||||||||||||||
Sbjct: 120 accttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgc 69

---

>gb|AY104535.1| Zea mays PCO094675 mRNA sequence
          Length = 995

 Score =  246 bits (124), Expect = 7e-62
 Identities = 176/192 (91%), Gaps = 1/192 (0%)
 Strand = Plus / Plus

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 756 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagcccagaaatgcgctt 815

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            |||||||| |  |  |||||||  |||||||||||||| ||||||||||||||||||||
Sbjct: 816 gacgccgcccctcctggccagcctacggatcgccggcttcgtgatgccctggatgttgtc 875

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
           ||||||| |||| |||||||||||||||||||||||||| ||||||||||| ||||||||
Sbjct: 876 gcgcagc-ccttgcggtggcgcttggcgccgcccttgcccagccccttgccgcccttgcc 934

                       
Query: 530 gcgcccggacat 541
           |||||| |||||
Sbjct: 935 gcgccccgacat 946

---

>gb|M27433.1|RATHIS4G Rattus norvegicus histone H4 gene, complete cds
          Length = 594

 Score =  244 bits (123), Expect = 3e-61
 Identities = 210/239 (87%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| |||||||| |||||||||||||| || ||||||||||| ||||||||||| |||
Sbjct: 494 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 435

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 434 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 375

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 374 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 315

                                                                      
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcag 475
           || || || ||||| || ||||| || ||||| ||||||||||||||||||||||||||
Sbjct: 314 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcag 256

---

>gb|M28409.1|RATH1TH4T Rat testis-specific histone H1t and histone H4t, complete cds
          Length = 6861

 Score =  244 bits (123), Expect = 3e-61
 Identities = 210/239 (87%)
 Strand = Plus / Plus

                                                                        
Query: 237  ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
            ||||| |||||||| |||||||||||||| || ||||||||||| ||||||||||| |||
Sbjct: 4742 ccgaagccgtagagtgtgcggccctggcgtttaagcgcgtagaccacgtccatggcagtg 4801

                                                                        
Query: 297  acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
            || ||||||||   ||||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 4802 accgtcttgcgcttggcgtgctccgtgtaggtgacggcgtcgcggatcacgttctccagg 4861

                                                                        
Query: 357  aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
            || | ||| ||||| ||||||||||||||||||||||| || |||||||||||||| || 
Sbjct: 4862 aacaccttcagcacaccgcgggtctcctcgtagatgaggccggagatgcgcttcactcct 4921

                                                                       
Query: 417  ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcag 475
            || || || ||||| || ||||| || ||||| ||||||||||||||||||||||||||
Sbjct: 4922 ccgcgccgggccaggcggcggatggcgggctttgtgatgccctggatgttgtcgcgcag 4980

---

>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on
            chromosome 6
          Length = 269712

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                        
Query: 249  agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
            |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 5913 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 5854

                                                                        
Query: 309  cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
              ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 5853 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 5794

                                                                        
Query: 369  acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
            || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 5793 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 5734

                                                                        
Query: 429  agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
            || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 5733 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 5674

                             
Query: 489  cgcttggcgccgccctt 505
            |||||||| || |||||
Sbjct: 5673 cgcttggcacccccctt 5657



 Score =  172 bits (87), Expect = 8e-40
 Identities = 219/263 (83%)
 Strand = Plus / Minus

                                                                          
Query: 243    ccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtc 302
              ||||| || ||||| ||||||||||||||||||||||| || ||||| || ||||| |||
Sbjct: 224724 ccgtacagagtgcgtccctggcgcttgagcgcgtagacaacatccattgcagtgactgtc 224665

                                                                          
Query: 303    ttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatc 362
              || ||   ||||||||| |||||||| |||||||| || || || ||||| ||||| | |
Sbjct: 224664 ttacgcttggcgtgctccgtgtaggttacggcgtcccgtatcacattctccaggaacacc 224605

                                                                          
Query: 363    ttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacgg 422
              || || || |||||||||||||| || ||||| ||||| ||||| ||||||||||| || 
Sbjct: 224604 ttaagaacaccgcgggtctcctcataaatgaggcccgaaatgcgtttcacgccgccgcgt 224545

                                                                          
Query: 423    cgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttc 482
              || ||||  || ||||| || ||||| ||||||||||| |||||||| |||||||| || 
Sbjct: 224544 cgggccaagcgacggatggcgggcttcgtgatgccctgtatgttgtcacgcagcactttg 224485

                                     
Query: 483    cggtggcgcttggcgccgccctt 505
              || |||||||||||||| |||||
Sbjct: 224484 cgatggcgcttggcgcctccctt 224462



 Score =  170 bits (86), Expect = 3e-39
 Identities = 254/310 (81%)
 Strand = Plus / Plus

                                                                          
Query: 232    agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
              |||||||||| || || || ||||| |||||||||||||||||||| || ||||||||||
Sbjct: 172767 agccgccgaagccataaagagtgcgtccctggcgcttgagcgcgtacaccacgtccatgg 172826

                                                                          
Query: 292    cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
              | ||||| ||||||||   |||||| || ||||||||||| || |||||||| || || |
Sbjct: 172827 ctgtgactgtcttgcgtttggcgtgttccgtgtaggtgacagcatcgcggattacatttt 172886

                                                                          
Query: 352    cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
              | ||||| |  || ||||| ||||| || ||||| || ||||| || || || ||||| |
Sbjct: 172887 ccaggaaaactttcagcactccgcgagtttcctcataaatgaggccagaaatacgcttga 172946

                                                                          
Query: 412    cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
              ||||||| ||||||||||| || ||||| || ||||||||||| || ||||| ||||| |
Sbjct: 172947 cgccgccgcggcgagccaggcggcggatagcgggcttggtgattccttggatattgtcac 173006

                                                                          
Query: 472    gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
              |||  ||||| ||||| ||||||||||| ||||| || || ||||| || ||||| ||||
Sbjct: 173007 gcaataccttacggtgacgcttggcgccacccttacctagaccctttccgcccttaccgc 173066

                        
Query: 532    gcccggacat 541
              | || |||||
Sbjct: 173067 ggccagacat 173076



 Score =  135 bits (68), Expect = 2e-28
 Identities = 221/272 (81%)
 Strand = Plus / Plus

                                                                         
Query: 234   ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
             |||||||| ||||| || ||||| || || |||||||||||||| || || |||||||| 
Sbjct: 10887 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 10946

                                                                         
Query: 294   gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
             ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 10947 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 11006

                                                                         
Query: 354   aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
             || || | |||||| ||||| || |||||||| || || |  || || || ||||| || 
Sbjct: 11007 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 11066

                                                                         
Query: 414   ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
             || ||||| | ||| || ||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 11067 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 11126

                                             
Query: 474   agcaccttccggtggcgcttggcgccgccctt 505
             ||||| || ||||| |||||||| || |||||
Sbjct: 11127 agcacttttcggtgacgcttggcacctccctt 11158



 Score =  127 bits (64), Expect = 5e-26
 Identities = 199/244 (81%)
 Strand = Plus / Plus

                                                                          
Query: 231    tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
              ||||| ||||| ||||| || ||||| ||||| ||||| ||||||||||| || ||||| 
Sbjct: 269189 tagccaccgaagccgtaaagagtgcgtccctgtcgcttcagcgcgtagaccacatccatt 269248

                                                                          
Query: 291    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
              || || |||||||||||   ||||||||| ||||| ||||| ||||| || || ||||||
Sbjct: 269249 gctgtcacggtcttgcgtttggcgtgctctgtgtaagtgacagcgtcacgaatcacgttc 269308

                                                                          
Query: 351    tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
              || ||||| | ||| || || || || |||||||| ||||| || || || || ||||| 
Sbjct: 269309 tccaggaacaccttcagaacaccacgagtctcctcatagataaggccagaaattcgcttg 269368

                                                                          
Query: 411    acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
              || ||||| || ||||| || |||||||| || ||||| ||||||||||||||||| |||
Sbjct: 269369 acaccgccgcgacgagcaaggcgccggatagctggcttagtgatgccctggatgttatcg 269428

                  
Query: 471    cgca 474
              ||||
Sbjct: 269429 cgca 269432



 Score =  127 bits (64), Expect = 5e-26
 Identities = 250/312 (80%)
 Strand = Plus / Minus

                                                                          
Query: 231    tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
              ||||||||||| ||||| || ||||| ||||| | ||| ||||||||||| || ||||| 
Sbjct: 188955 tagccgccgaagccgtaaagagtgcgtccctgtctcttcagcgcgtagaccacatccatc 188896

                                                                          
Query: 291    gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
              || || || ||||||||   ||||||||| ||||| || || || || || || ||||| 
Sbjct: 188895 gctgtcactgtcttgcgtttggcgtgctccgtgtaagtcacagcatcacgaatcacgttt 188836

                                                                          
Query: 351    tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
              || || || | ||| || || ||||| ||||||||||||||||| || || |||||||| 
Sbjct: 188835 tccagaaacaccttcagaaccccgcgagtctcctcgtagatgagaccagaaatgcgcttg 188776

                                                                          
Query: 411    acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
              || || || || ||||| || |||||||| || |||||||| |||||||||||||| || 
Sbjct: 188775 acacccccgcgacgagcaaggcgccggatggcaggcttggtaatgccctggatgttatct 188716

                                                                          
Query: 471    cgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccg 530
              ||||| ||||| ||||| ||||| ||||| || || || || ||||| || || ||||||
Sbjct: 188715 cgcaggaccttacggtgacgcttagcgcctcctttacccagtccctttccgcctttgccg 188656

                          
Query: 531    cgcccggacatg 542
              || || ||||||
Sbjct: 188655 cgaccagacatg 188644



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 196/245 (80%)
 Strand = Plus / Plus

                                                                          
Query: 258    ccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcggcgggcgtgc 317
              |||||||| |||||| ||||||| ||| ||||||||||||| ||||||||   |||||||
Sbjct: 230694 ccctggcgtttgagcacgtagaccacggccatggcggtgaccgtcttgcgcttggcgtgc 230753

                                                                          
Query: 318    tcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagcacgccgcgg 377
              || |||| ||| |||||||  | ||| || || || ||||| | ||||| ||| | ||||
Sbjct: 230754 tccgtgttggtcacggcgtaccagatcacattttccaggaacaccttgaacacccggcgg 230813

                                                                          
Query: 378    gtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagccagccgccgg 437
              |||||||| || ||||| ||| |||||||||| || |||||| | || ||||  ||||||
Sbjct: 230814 gtctcctcataaatgaggcccaagatgcgcttgacaccgccatgccgggccaagcgccgg 230873

                                                                          
Query: 438    atcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtggcgcttggcg 497
              || |    |||||| |||||||| || || |||| ||| ||||| || |||| |||||| 
Sbjct: 230874 atagtgcacttggtaatgccctgaatattatcgctcagtaccttgcgatggcacttggca 230933

                   
Query: 498    ccgcc 502
              |||||
Sbjct: 230934 ccgcc 230938



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 208/262 (79%)
 Strand = Plus / Minus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| || || || ||||| ||||| || || || || || || || |||||||
Sbjct: 88199 agccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccatgg 88140

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             | ||||| || |||||   ||||||||| || |||||||||||||| || || |||||||
Sbjct: 88139 ctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgttct 88080

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             | | ||| | ||| ||||| || || |||||||| ||||| || || || |||||||| |
Sbjct: 88079 ctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgcttga 88020

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             |||| || || |||||||  || || || ||||| || || |||||||||||||| || |
Sbjct: 88019 cgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatccc 87960

                                   
Query: 472   gcagcaccttccggtggcgctt 493
             | |||||||| || ||||||||
Sbjct: 87959 ggagcaccttacgatggcgctt 87938

---

>ref|NM_003538.3| Homo sapiens histone 1, H4a (HIST1H4A), mRNA
          Length = 372

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 53  cgcttggcacccccctt 37

---

>gb|AY128654.1| Homo sapiens clone HIST1H4A histone H4 gene, complete cds
          Length = 930

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 604 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 545

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 544 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 485

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 484 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 425

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 424 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 365

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 364 cgcttggcacccccctt 348

---

>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene,
              hereditary haemochromatosis (HLA-H) gene, RoRet gene, and
              sodium phosphate transporter (NPT3) gene, complete cds
          Length = 246282

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Plus

                                                                          
Query: 249    agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
              |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 119088 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 119147

                                                                          
Query: 309    cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
                ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 119148 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 119207

                                                                          
Query: 369    acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
              || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 119208 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 119267

                                                                          
Query: 429    agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
              || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 119268 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 119327

                               
Query: 489    cgcttggcgccgccctt 505
              |||||||| || |||||
Sbjct: 119328 cgcttggcacccccctt 119344



 Score =  135 bits (68), Expect = 2e-28
 Identities = 221/272 (81%)
 Strand = Plus / Minus

                                                                          
Query: 234    ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
              |||||||| ||||| || ||||| || || |||||||||||||| || || |||||||| 
Sbjct: 114114 ccgccgaagccgtacagagtgcgtccttgacgcttgagcgcgtaaaccacatccatggca 114055

                                                                          
Query: 294    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
              ||||| ||||||||   ||||||||| |||||||| |||||||| ||||| |||||||| 
Sbjct: 114054 gtgacagtcttgcgcttggcgtgctccgtgtaggtcacggcgtcccggatcacgttctcc 113995

                                                                          
Query: 354    aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
              || || | |||||| ||||| || |||||||| || || |  || || || ||||| || 
Sbjct: 113994 agaaacaccttgagaacgccacgagtctcctcataaatcaaaccggaaattcgcttaacc 113935

                                                                          
Query: 414    ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
              || ||||| | ||| || ||||| || ||||| ||||||||||| |||||||| || |||
Sbjct: 113934 ccaccacgcctagcaaggcgccgaatggccggtttggtgatgccttggatgttatcccgc 113875

                                              
Query: 474    agcaccttccggtggcgcttggcgccgccctt 505
              ||||| || ||||| |||||||| || |||||
Sbjct: 113874 agcacttttcggtgacgcttggcacctccctt 113843



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 208/262 (79%)
 Strand = Plus / Plus

                                                                         
Query: 232   agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
             |||||||||| || || || ||||| ||||| || || || || || || || |||||||
Sbjct: 36802 agccgccgaagccatacagagtgcgcccctgacgttttagggcatatactacatccatgg 36861

                                                                         
Query: 292   cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
             | ||||| || |||||   ||||||||| || |||||||||||||| || || |||||||
Sbjct: 36862 ctgtgacagttttgcgcttggcgtgctccgtataggtgacggcgtctcgaataacgttct 36921

                                                                         
Query: 352   cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
             | | ||| | ||| ||||| || || |||||||| ||||| || || || |||||||| |
Sbjct: 36922 ctaagaaaaccttaagcacacctcgagtctcctcatagataagaccggaaatgcgcttga 36981

                                                                         
Query: 412   cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
             |||| || || |||||||  || || || ||||| || || |||||||||||||| || |
Sbjct: 36982 cgccaccgcgccgagccaaacggcgaatagccggttttgtaatgccctggatgttatccc 37041

                                   
Query: 472   gcagcaccttccggtggcgctt 493
             | |||||||| || ||||||||
Sbjct: 37042 ggagcaccttacgatggcgctt 37063

---

>gb|BC069654.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:97476
           IMAGE:7262752), complete cds
          Length = 365

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 53  cgcttggcacccccctt 37

---

>gb|BC067495.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79351
           IMAGE:7002090), complete cds
          Length = 349

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 53  cgcttggcacccccctt 37

---

>gb|BC066248.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79349
           IMAGE:7002088), complete cds
          Length = 349

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 53  cgcttggcacccccctt 37

---

>gb|BC066249.1| Homo sapiens histone 1, H4a, mRNA (cDNA clone MGC:79350
           IMAGE:7002089), complete cds
          Length = 349

 Score =  240 bits (121), Expect = 4e-60
 Identities = 223/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 293 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 234

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 233 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 174

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 173 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 114

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| ||||||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 113 agacgccggatggccggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 54

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 53  cgcttggcacccccctt 37

---

>ref|XM_595302.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC517138), mRNA
          Length = 312

 Score =  238 bits (120), Expect = 2e-59
 Identities = 261/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||| ||   ||| ||||||||||||||||| ||||| ||||| |||||||| 
Sbjct: 248 gtgaccgtcttccgcttggcatgctcggtgtaggtgaccgcgtcccggatcacgttctcc 189

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           || || |  || || || ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 188 agaaacactttcaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || ||||| |||||||| || ||||| || || || ||||||||||||||||||||||||
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           || ||||| ||||||||||| |||||||| || || || || ||||| || |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 534 ccggacat 541
           || |||||
Sbjct: 8   ccagacat 1

---

>ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene
           (LOC488274), mRNA
          Length = 366

 Score =  238 bits (120), Expect = 2e-59
 Identities = 156/168 (92%)
 Strand = Plus / Minus

                                                                       
Query: 365 gagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcg 424
           |||||| ||||||||||||||||||||||| |||||||||||||| |||||||| || ||
Sbjct: 240 gagcaccccgcgggtctcctcgtagatgaggcccgagatgcgcttgacgccgccgcgccg 181

                                                                       
Query: 425 agccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccg 484
            |||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||
Sbjct: 180 ggccagccgccggatggcgggcttggtgatgccctggatgttgtcgcgcagcaccttgcg 121

                                                           
Query: 485 gtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcg 532
           |||||||||||||||||||||||| |||||||| || |||||||||||
Sbjct: 120 gtggcgcttggcgccgcccttgcccagccccttcccgcccttgccgcg 73

---

>gb|DQ066258.1| Ixodes scapularis isolate ISN-L-157 hist1h4i protein mRNA, complete
           cds
          Length = 312

 Score =  238 bits (120), Expect = 2e-59
 Identities = 255/300 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||||||||| ||||| ||||| || || || | ||| ||||||||||||||||||||
Sbjct: 312 ctagccgccgaacccgtacagggtacgtccttgtctcttcagcgcgtagacgacgtccat 253

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||||||||| || || |    |||||| || ||||||||||||||||||||||| |||||
Sbjct: 252 ggcggtgaccgtttttctcttggcgtgttccgtgtaggtgacggcgtcgcggatcacgtt 193

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| |||||||  ||||||||||| ||||||||||||||||| || || ||||| |||||
Sbjct: 192 ctccaggaagactttgagcacgcctcgggtctcctcgtagatcagaccggagatacgctt 133

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            ||||| |||||||||||||| || || || || ||||| ||||| ||||||||||||||
Sbjct: 132 gacgccaccacggcgagccagacgacgaatggcgggctttgtgatcccctggatgttgtc 73

                                                                       
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgcc 529
            || |||||||| || || ||||||||||| || || |||||||||||||| || |||||
Sbjct: 72  tcggagcaccttgcgatgacgcttggcgcctccttttccgagccccttgccacctttgcc 13

---

>emb|CR542172.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0824D for
           gene HIST2H4, histone 2, H4; complete cds, incl.
           stopcodon
          Length = 312

 Score =  236 bits (119), Expect = 7e-59
 Identities = 239/279 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| |||||||||||||| |||||||||||||||||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtagagggtgcgcccctggcgcttgagcgcgtacaccacatccat 253

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||| ||||||||||||||   ||||||||||||||||||||| ||||| || || || ||
Sbjct: 252 ggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcacatt 193

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| |||||
Sbjct: 192 ctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccgctt 133

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            ||||||||||| ||||| || ||||| || || ||||||||||||||||| ||||||||
Sbjct: 132 aacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgttgtc 73

                                                  
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
            | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 72  tctcaagaccttgcggtggcgcttagcgccccctttgcc 34

---

>ref|XM_227462.3| PREDICTED: Rattus norvegicus histone 2, H4 (predicted)
           (Hist2h4_predicted), mRNA
          Length = 312

 Score =  236 bits (119), Expect = 7e-59
 Identities = 239/279 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 ctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccat 289
           |||||| ||||| ||||| ||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 312 ctagcctccgaagccgtacagggttcggccctggcgcttgagagcgtacaccacatccat 253

                                                                       
Query: 290 ggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgtt 349
           ||||||||||||||||||   ||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 252 ggcggtgacggtcttgcgcttggcgtgctcagtgtaggtgactgcgtcgcggatcacgtt 193

                                                                       
Query: 350 ctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgctt 409
           ||| ||||| | ||| || || || ||||||||||| |||||||| || |||||||||||
Sbjct: 192 ctccaggaacaccttcagtacaccacgggtctcctcatagatgaggccggagatgcgctt 133

                                                                       
Query: 410 cacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtc 469
            || |||||||| ||||| || || ||||| || ||||||||||| ||||||||||| ||
Sbjct: 132 gacaccgccacgccgagctaggcgacggatggcgggcttggtgatcccctggatgttatc 73

                                                  
Query: 470 gcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
            ||||  ||||| ||||| ||||||||||| ||||||||
Sbjct: 72  ccgcaagaccttgcggtgacgcttggcgccacccttgcc 34

---

>gb|BC019846.1| Homo sapiens cDNA clone IMAGE:5113140
          Length = 946

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 322 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 263

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 262 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 203

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 202 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 143

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 142 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 83

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 82  gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 41

---

>ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal histone H4 gene
           (LOC465305), mRNA
          Length = 1195

 Score =  234 bits (118), Expect = 3e-58
 Identities = 262/310 (84%)
 Strand = Plus / Minus

                                                                       
Query: 232 agccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatgg 291
           |||||||||| || ||||||||||| |||||||| || ||||| || || || |||||||
Sbjct: 457 agccgccgaaaccatagagggtgcgaccctggcgtttcagcgcatacaccacatccatgg 398

                                                                       
Query: 292 cggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttct 351
           | ||||||||||||||   ||||||||| ||||| || || ||||||||||| |||||||
Sbjct: 397 ccgtgacggtcttgcgcttggcgtgctccgtgtaagtcaccgcgtcgcggatcacgttct 338

                                                                       
Query: 352 cgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttca 411
           | |||||||  ||||| || || |||||||||||||||||||| || || |||||||| |
Sbjct: 337 ccaggaagactttgaggactccccgggtctcctcgtagatgagaccagaaatgcgcttaa 278

                                                                       
Query: 412 cgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgc 471
           |||| ||||| || || || || || ||||||||||| || ||||| ||||||||||| |
Sbjct: 277 cgcccccacgtcgggcgagacggcgaatcgccggctttgtaatgccttggatgttgtccc 218

                                                                       
Query: 472 gcagcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgc 531
           |||||||||||||||||||||| ||||| ||||| || ||||||||||| || || || |
Sbjct: 217 gcagcaccttccggtggcgcttagcgcctcccttacccagccccttgccacctttacctc 158

                     
Query: 532 gcccggacat 541
           |||| |||||
Sbjct: 157 gcccagacat 148

---

>ref|NM_003548.2| Homo sapiens histone 2, H4 (HIST2H4), mRNA
          Length = 396

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 343 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 284

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 283 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 224

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 223 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 164

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 163 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 104

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 103 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 62

---

>ref|XM_513765.1| PREDICTED: Pan troglodytes LOC457262 (LOC457262), mRNA
          Length = 1963

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 617 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 558

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 557 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 498

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 497 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 438

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 437 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 378

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 377 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 336

---

>gb|AC150544.3| Bos taurus  BAC CH240-75C8 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 190186

 Score =  234 bits (118), Expect = 3e-58
 Identities = 262/310 (84%)
 Strand = Plus / Plus

                                                                          
Query: 234    ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
              ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 184923 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 184982

                                                                          
Query: 294    gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
              ||||| ||||| ||   ||| |||||||||||||||||  |||| ||||| |||||||| 
Sbjct: 184983 gtgactgtcttccgcttggcatgctcggtgtaggtgaccacgtcccggatcacgttctcc 185042

                                                                          
Query: 354    aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
              || || |  || || || ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 185043 agaaacacttttaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 185102

                                                                          
Query: 414    ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
              || ||||| |||||||| || ||||| || || || ||||||||||||||||||||||||
Sbjct: 185103 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 185162

                                                                          
Query: 474    agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
              || ||||| ||||||||||| |||||||| || || || || ||||| || |||||||| 
Sbjct: 185163 agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 185222

                        
Query: 534    ccggacatgg 543
              || |||||||
Sbjct: 185223 ccagacatgg 185232

---

>ref|NM_001034077.3| Homo sapiens histone H4/o (H4/o), mRNA
          Length = 373

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 337 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 278

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 277 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 218

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 217 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 158

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 157 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 98

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 97  gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 56

---

>gb|AF525682.1| Homo sapiens histone H4 (HIST2H4) gene, complete cds
          Length = 864

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 626 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 567

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 566 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 507

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 506 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 447

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 446 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 387

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 386 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 345

---

>gb|BC112193.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:138398
           IMAGE:8327661), complete cds
          Length = 373

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 337 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 278

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 277 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 218

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 217 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 158

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 157 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 98

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 97  gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 56

---

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
              ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
              (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
              IgG, high affinity Ia, receptor for (CD64), a novel gene
              similar to histone 2, H2be (HIST2H2BE), a novel gene
              similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
              histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
              HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
              pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
              (HIST2H2BC), a novel gene similar to histone 2, H2aa
              (HIST2H2AA), a novel gene similar to histone 2, H3c
              (HIST2H3C), a novel gene similar to histone 1, H4
              (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
              HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
              histone 2, H2ab, a novel protein similar to histone 2, a
              novel gene, the SV2A gene for synaptic vesicle glycoprotein
              2A, the 3' end of the SF3B4 gene for splicing factor 3b,
              subunit 4, 49kDa and five CpG islands, complete sequence
          Length = 188956

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Plus

                                                                          
Query: 227    ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
              ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 122543 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 122602

                                                                          
Query: 287    catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
              |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 122603 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 122662

                                                                          
Query: 347    gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
               ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 122663 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 122722

                                                                          
Query: 407    cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
              ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 122723 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 122782

                                                        
Query: 467    gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
              ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 122783 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 122824



 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                         
Query: 227   ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
             ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 94723 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 94664

                                                                         
Query: 287   catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
             |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 94663 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 94604

                                                                         
Query: 347   gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
              ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 94603 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 94544

                                                                         
Query: 407   cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
             ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 94543 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 94484

                                                       
Query: 467   gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
             ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 94483 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 94442

---

>emb|BX047204.1|CNS098L4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 554

 Score =  234 bits (118), Expect = 3e-58
 Identities = 258/302 (85%), Gaps = 2/302 (0%)
 Strand = Plus / Plus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 140 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 199

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 200 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 259

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 260 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 319

                                                                       
Query: 417 ccacggcgagcc-agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcag 475
           |||||||||||| ||  | ||||| || ||||||||||||||||||||||| ||||||| 
Sbjct: 320 ccacggcgagccaagaaggcggatggcgggcttggtgatgccctggatgttatcgcgca- 378

                                                                       
Query: 476 caccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgccc 535
           |||||| || || |||||||| || ||||| || || |||||||||||||||||||| ||
Sbjct: 379 caccttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgacc 438

             
Query: 536 gg 537
           ||
Sbjct: 439 gg 440

---

>ref|XM_942850.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 4 (LOC648164), mRNA
          Length = 622

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 340 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 281

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 280 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 221

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 220 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 161

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 160 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 101

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 100 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 59

---

>ref|XM_942844.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 3 (LOC648164), mRNA
          Length = 1878

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 340 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 281

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 280 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 221

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 220 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 161

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 160 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 101

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 100 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 59

---

>ref|XM_942841.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 2 (LOC648164), mRNA
          Length = 1128

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 340 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 281

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 280 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 221

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 220 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 161

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 160 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 101

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 100 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 59

---

>ref|XM_936503.1| PREDICTED: Homo sapiens similar to germinal histone H4 gene,
           transcript variant 1 (LOC648164), mRNA
          Length = 2148

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 340 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 281

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 280 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 221

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 220 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 161

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 160 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 101

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 100 gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 59

---

>gb|BC093969.1| Homo sapiens histone 2, H4, mRNA (cDNA clone MGC:121004
           IMAGE:7939814), complete cds
          Length = 373

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 337 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 278

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 277 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 218

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 217 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 158

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 157 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 98

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 97  gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 56

---

>gb|BC108260.1| Homo sapiens histone H4/o, mRNA (cDNA clone MGC:102836
           IMAGE:6011519), complete cds
          Length = 1712

 Score =  234 bits (118), Expect = 3e-58
 Identities = 241/282 (85%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggcctagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtc 286
           ||||||||| ||||| ||||| |||||||| |||||||||||||||||||| || || ||
Sbjct: 332 ggcctagcctccgaagccgtacagggtgcgcccctggcgcttgagcgcgtacaccacatc 273

                                                                       
Query: 287 catggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgac 346
           |||||| ||||||||||||||   ||||||||||||||||||||| ||||| || || ||
Sbjct: 272 catggctgtgacggtcttgcgcttggcgtgctcggtgtaggtgactgcgtcccgaatcac 213

                                                                       
Query: 347 gttctcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcg 406
            ||||| ||||| | ||| ||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 212 attctccaggaacaccttcagcacaccgcgggtctcctcgtaaatgaggccagagatccg 153

                                                                       
Query: 407 cttcacgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgtt 466
           ||| ||||||||||| ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 152 cttaacgccgccacgccgagctagacgccgaatggcaggcttggtgatgccctgaatgtt 93

                                                     
Query: 467 gtcgcgcagcaccttccggtggcgcttggcgccgcccttgcc 508
           ||| | ||  ||||| ||||||||||| ||||| || |||||
Sbjct: 92  gtctctcaagaccttgcggtggcgcttagcgccccctttgcc 51

---

>emb|BX061530.1|CNS09JN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 788

 Score =  232 bits (117), Expect = 1e-57
 Identities = 255/301 (84%)
 Strand = Plus / Plus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 460 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 519

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || |||||||| |||||||| |||
Sbjct: 520 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcggatcacgttctccagg 579

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 580 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 639

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           ||||||  |||||| || ||||| || ||||||||||||||||||||||| |||||||  
Sbjct: 640 ccacgggaagccagacggcggatggcgggcttggtgatgccctggatgttatcgcgcaca 699

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
            |||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 700 cccttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 759

            
Query: 537 g 537
           |
Sbjct: 760 g 760

---

>emb|BX057868.1|CNS09GTC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score =  232 bits (117), Expect = 1e-57
 Identities = 255/301 (84%)
 Strand = Plus / Plus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           |||||||||||||| || |||||||||||||| || ||||| || || ||||| || |||
Sbjct: 524 ccgaatccgtagagcgtacggccctggcgcttcagagcgtacaccacatccatcgccgtg 583

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           || ||||||||   ||||||||||||||||||||| || ||||| || |||||||| |||
Sbjct: 584 accgtcttgcgcttggcgtgctcggtgtaggtgaccgcatcgcgaatcacgttctccagg 643

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| ||||| ||||| ||||| |||||||| || || ||||| ||||||||||||
Sbjct: 644 aacaccttcagcacaccgcgcgtctcttcgtagatcaggccggagatacgcttcacgccg 703

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           ||||||||||||||  | ||||| || ||||||||||||||||||||||| |||||||  
Sbjct: 704 ccacggcgagccagaaggcggatggcgggcttggtgatgccctggatgttatcgcgcaca 763

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
            |||| || || |||||||| || ||||| || || |||||||||||||||||||| |||
Sbjct: 764 cccttgcgatgacgcttggctcctccctttcccagtcccttgcctcccttgccgcgaccg 823

            
Query: 537 g 537
           |
Sbjct: 824 g 824

---

>emb|X60481.1|HSH4AHIS H.sapiens H4/a gene for H4 histone
          Length = 672

 Score =  232 bits (117), Expect = 1e-57
 Identities = 222/257 (86%)
 Strand = Plus / Minus

                                                                       
Query: 249 agggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtgacggtcttgcgg 308
           |||||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 473 agggtgcgtccctggcgcttaagcgcgtagaccacgtccatggcagtgactgtcttgcgc 414

                                                                       
Query: 309 cgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgaggaagatcttgagc 368
             ||||||||| || |||||||| ||||| ||||| |||||||| |  || | |||||||
Sbjct: 413 ttggcgtgctccgtataggtgacagcgtcacggatcacgttctccaaaaacaccttgagc 354

                                                                       
Query: 369 acgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccgccacggcgagcc 428
           || ||||| |||||||||||||| || || ||||| |||||||| |||||||| || |||
Sbjct: 353 accccgcgagtctcctcgtagatcagaccagagatccgcttcacaccgccacgccgggcc 294

                                                                       
Query: 429 agccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagcaccttccggtgg 488
           || |||||||| || |||||||||||||||||||||||||| |||| |||||| ||||||
Sbjct: 293 agacgccggatggctggcttggtgatgccctggatgttgtcacgcaacaccttgcggtgg 234

                            
Query: 489 cgcttggcgccgccctt 505
           |||||||| || |||||
Sbjct: 233 cgcttggcacccccctt 217

---

>ref|NM_173880.2| Bos taurus histone H4 (H4), mRNA
          Length = 1517

 Score =  232 bits (117), Expect = 1e-57
 Identities = 231/269 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||| |||||||||||||| ||||||||||| || |||||||| 
Sbjct: 351 tagccgccgaaaccatagagagtgcggccctggcgtttgagcgcgtaaaccacgtccata 292

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           ||||| || ||||||||   ||||||||| ||||||||||| ||||| ||||| || || 
Sbjct: 291 gcggttacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtcccggatcacattt 232

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || || || | ||| ||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 231 tccagaaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttc 172

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || ||||| |||||||| || ||||| || ||||||||||| |||||||| ||||||
Sbjct: 171 acaccaccacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcg 112

                                        
Query: 471 cgcagcaccttccggtggcgcttggcgcc 499
           ||||| ||||| ||||||||||| |||||
Sbjct: 111 cgcagaaccttgcggtggcgcttagcgcc 83

---

>ref|XM_315129.2| Anopheles gambiae str. PEST ENSANGP00000015255
           (ENSANGG00000012766), partial mRNA
          Length = 312

 Score =  232 bits (117), Expect = 1e-57
 Identities = 255/301 (84%)
 Strand = Plus / Minus

                                                                       
Query: 237 ccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcggtg 296
           ||||| ||||| || ||||||||||||||||| ||||||||||| || ||||| ||||||
Sbjct: 305 ccgaaaccgtacagtgtgcggccctggcgcttcagcgcgtagacaacatccatagcggtg 246

                                                                       
Query: 297 acggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcgagg 356
           |||||||||||   ||||||||||||||| || ||||| || ||||| |||||||| |||
Sbjct: 245 acggtcttgcgcttggcgtgctcggtgtacgtcacggcatcacggatcacgttctccagg 186

                                                                       
Query: 357 aagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacgccg 416
           || | ||| || ||||| || |||||||||||||| || || ||||| |||||||| || 
Sbjct: 185 aataccttcagtacgccacgcgtctcctcgtagatcaggccagagatacgcttcactcca 126

                                                                       
Query: 417 ccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgcagc 476
           |||||||||||||| || ||||| |||||||||||||||||||||||||| || || || 
Sbjct: 125 ccacggcgagccagacggcggatggccggcttggtgatgccctggatgttatcacgaaga 66

                                                                       
Query: 477 accttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgcccg 536
           ||||| || || ||||| || ||||| ||||| || || || |||||||||||||| |||
Sbjct: 65  accttgcgatgacgcttcgctccgcctttgcccagtccttttcctcccttgccgcgtccg 6

            
Query: 537 g 537
           |
Sbjct: 5   g 5

---

>gb|AF001288.1|AF001288 Bos taurus histone H4.1 mRNA, complete cds
          Length = 1517

 Score =  232 bits (117), Expect = 1e-57
 Identities = 231/269 (85%)
 Strand = Plus / Minus

                                                                       
Query: 231 tagccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatg 290
           ||||||||||| || ||||| |||||||||||||| ||||||||||| || |||||||| 
Sbjct: 351 tagccgccgaaaccatagagagtgcggccctggcgtttgagcgcgtaaaccacgtccata 292

                                                                       
Query: 291 gcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttc 350
           ||||| || ||||||||   ||||||||| ||||||||||| ||||| ||||| || || 
Sbjct: 291 gcggttacagtcttgcgtttggcgtgctccgtgtaggtgaccgcgtcccggatcacattt 232

                                                                       
Query: 351 tcgaggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttc 410
           || || || | ||| ||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 231 tccagaaacaccttcagcaccccacgggtctcctcgtagatgagcccggagatgcgcttc 172

                                                                       
Query: 411 acgccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcg 470
           || || ||||| |||||||| || ||||| || ||||||||||| |||||||| ||||||
Sbjct: 171 acaccaccacgacgagccaggcgacggatggcgggcttggtgataccctggatattgtcg 112

                                        
Query: 471 cgcagcaccttccggtggcgcttggcgcc 499
           ||||| ||||| ||||||||||| |||||
Sbjct: 111 cgcagaaccttgcggtggcgcttagcgcc 83

---

>ref|XM_604220.1| PREDICTED: Bos taurus similar to germinal histone H4 gene
           (LOC525863), mRNA
          Length = 312

 Score =  230 bits (116), Expect = 4e-57
 Identities = 260/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 234 ccgccgaatccgtagagggtgcggccctggcgcttgagcgcgtagacgacgtccatggcg 293
           ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 308 ccgccaaagccgtagagagtacggccctggcgcttgagagcgtagaccacgtccatagcg 249

                                                                       
Query: 294 gtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcgtcgcggatgacgttctcg 353
           ||||| ||||| ||   ||| |||||||||||||||||  |||| ||||| |||||||| 
Sbjct: 248 gtgactgtcttccgcttggcatgctcggtgtaggtgaccacgtcccggatcacgttctcc 189

                                                                       
Query: 354 aggaagatcttgagcacgccgcgggtctcctcgtagatgagccccgagatgcgcttcacg 413
           || || |  || || || ||||||||||| |||||||||||||| |||||||||||||| 
Sbjct: 188 agaaacacttttaggaccccgcgggtctcttcgtagatgagcccagagatgcgcttcaca 129

                                                                       
Query: 414 ccgccacggcgagccagccgccggatcgccggcttggtgatgccctggatgttgtcgcgc 473
           || ||||| |||||||| || ||||| || || || ||||||||||||||||||||||||
Sbjct: 128 ccaccacgacgagccaggcggcggatagcaggtttagtgatgccctggatgttgtcgcgc 69

                                                                       
Query: 474 agcaccttccggtggcgcttggcgccgcccttgccgagccccttgcctcccttgccgcgc 533
           || ||||| ||||||||||| |||||||| || || || || ||||| || |||||||| 
Sbjct: 68  agaaccttacggtggcgcttagcgccgcctttccccagacctttgccgcctttgccgcgt 9

                   
Query: 534 ccggacat 541
           || |||||
Sbjct: 8   ccagacat 1


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,420,635
Number of Sequences: 3902068
Number of extensions: 3420635
Number of successful extensions: 72049
Number of sequences better than 10.0: 929
Number of HSP's better than 10.0 without gapping: 930
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 68413
Number of HSP's gapped (non-prelim): 3181
length of query: 599
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 576
effective length of database: 17,143,297,704
effective search space: 9874539477504
effective search space used: 9874539477504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---