>gb|AY613901.1| Mesenchytraeus solifugus clone C162 troponin-like mRNA, partial
           sequence
          Length = 590

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 165 gatgtcggcggccgagctgtt 185
           |||||||||||||||||||||
Sbjct: 85  gatgtcggcggccgagctgtt 65

>ref|XM_458458.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C18909g)
           partial mRNA
          Length = 1872

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 198 ttccaccaactgctgcttcat 218
           |||||||||||||||||||||
Sbjct: 348 ttccaccaactgctgcttcat 328

>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces
               hansenii
          Length = 1592360

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 198     ttccaccaactgctgcttcat 218
               |||||||||||||||||||||
Sbjct: 1561171 ttccaccaactgctgcttcat 1561151

>emb|BX640426.1| Bordetella parapertussis strain 12822, complete genome; segment 4/14
          Length = 348866

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 161    cgtcgatgtcggcggccgagc 181
              |||||||||||||||||||||
Sbjct: 157330 cgtcgatgtcggcggccgagc 157310

>emb|BX571865.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
             7/17
          Length = 348813

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 207   ctgctgcttcatcttggccga 227
             |||||||||||||||||||||
Sbjct: 28990 ctgctgcttcatcttggccga 29010

>gb|AC112031.4| Rattus norvegicus  BAC CH230-99K18 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 242158

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 207    ctgctgcttcatcttggccgaggtg 231
              ||||| |||||||||||||||||||
Sbjct: 108743 ctgcttcttcatcttggccgaggtg 108719

>gb|AE005135.1| Halobacterium sp. NRC-1 section 166 of 170 of the complete genome
          Length = 10922

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 154  gcttcgtcgtcgatgtcggcg 174
            |||||||||||||||||||||
Sbjct: 4083 gcttcgtcgtcgatgtcggcg 4063

>ref|XM_365055.1| Magnaporthe grisea 70-15 hypothetical protein (MG09900.4) partial
           mRNA
          Length = 600

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 157 tcgtcgtcgatgtcggcggccgag 180
           |||||||| |||||||||||||||
Sbjct: 362 tcgtcgtcaatgtcggcggccgag 339

>gb|DQ334245.1| Drosophila miranda CG9279 gene, partial cds
          Length = 999

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 ctgctgcttcatcttggccg 226
           ||||||||||||||||||||
Sbjct: 909 ctgctgcttcatcttggccg 890

>emb|AL158149.14| Human DNA sequence from clone RP11-208G24 on chromosome 9 Contains
            the GAS1 gene for growth arrest-specific 1, the 5' end of
            a novel gene and a CpG island, complete sequence
          Length = 102100

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 202  accaactgctgcttcatctt 221
            ||||||||||||||||||||
Sbjct: 2654 accaactgctgcttcatctt 2673

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 157     tcgtcgtcgatgtcggcggc 176
               ||||||||||||||||||||
Sbjct: 1170793 tcgtcgtcgatgtcggcggc 1170774

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   cgtcgatgtcggcggccgag 180
             ||||||||||||||||||||
Sbjct: 68315 cgtcgatgtcggcggccgag 68296


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,273,399
Number of Sequences: 3902068
Number of extensions: 1273399
Number of successful extensions: 22823
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22724
Number of HSP's gapped (non-prelim): 99
length of query: 231
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 209
effective length of database: 17,147,199,772
effective search space: 3583764752348
effective search space used: 3583764752348
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)